ID: 1181592312

View in Genome Browser
Species Human (GRCh38)
Location 22:23893069-23893091
Sequence GGGAATAAAGGGATAGTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 409
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 384}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181592312 Original CRISPR GGGAATAAAGGGATAGTGAA AGG Intronic
901125888 1:6928499-6928521 GGGAATAAAGGTAAAGGGGAGGG - Intronic
902336725 1:15758586-15758608 GGGAACAAAGGGAGGGGGAAGGG + Intronic
904581390 1:31546770-31546792 CAGGATGAAGGGATAGTGAATGG + Intergenic
908007819 1:59744798-59744820 GGGAATACAGAGAAAGTTAATGG + Intronic
908564484 1:65340488-65340510 AGGAAGAATGTGATAGTGAAAGG + Intronic
908628907 1:66079654-66079676 GGGACTAAAGGGAGAGCTAATGG + Intronic
909203899 1:72728170-72728192 AGGGACAAAGGGATAGTTAACGG + Intergenic
909791812 1:79689013-79689035 AGGAAAAAAAAGATAGTGAAAGG - Intergenic
909802446 1:79828067-79828089 GGGTATAAAGGGAAAGTGTCTGG - Intergenic
913221183 1:116661920-116661942 AGGAAGAAAAGGCTAGTGAAGGG - Intronic
913268730 1:117071758-117071780 GGGAATAAAGAGATCATGTATGG + Intronic
913572755 1:120137799-120137821 GGGAATAAAGGGGTGGGGTATGG + Intergenic
914294020 1:146302583-146302605 GGGAATAAAGGGGTGGGGTATGG + Intergenic
914453243 1:147811748-147811770 GGGAATGATGGGACAGTAAAAGG - Intergenic
914555064 1:148753366-148753388 GGGAATAAAGGGGTGGGGTATGG + Intergenic
915099402 1:153488119-153488141 GGGAATAAAAAGAAATTGAATGG + Intergenic
916865516 1:168853021-168853043 GGAAATAATGATATAGTGAAGGG + Intergenic
917182043 1:172309252-172309274 GGGAATATAGACATAATGAAAGG - Intronic
917235203 1:172884364-172884386 TGGAATAAAGAGACAGGGAAGGG - Intergenic
917823731 1:178794100-178794122 GGGAAAGAAGGGAAAGGGAAGGG - Intronic
921047628 1:211488792-211488814 GGGAATATGGGGAGAGGGAACGG - Intronic
922751319 1:228071372-228071394 TGGTATAGAGGGATAGTGTAGGG + Intergenic
924283590 1:242462773-242462795 GAGAAGAAAGGGAGAATGAATGG - Intronic
1062943694 10:1444250-1444272 GGAAATAGATGGATGGTGAATGG - Intronic
1063309705 10:4940690-4940712 GGCAATGAAGGAATAGTGCATGG - Intronic
1063317585 10:5021411-5021433 GGCAATGAAGGAATAGTGCATGG + Intronic
1065169233 10:23010592-23010614 GGGAAGGAAGGGAGAGAGAAGGG - Intronic
1065796590 10:29313877-29313899 GGGTATTAGGGGATAGTGATTGG + Intronic
1065946483 10:30609616-30609638 GGGTATTAGGGGATAGTGACTGG - Intergenic
1066091628 10:32027581-32027603 GGGAATAAATTTATAATGAATGG - Intronic
1066224424 10:33368451-33368473 GGGAATCAACGGAGAGTGATGGG + Intergenic
1067281539 10:44877081-44877103 GGGGATACAGGGGGAGTGAAAGG - Intergenic
1067292126 10:44950977-44950999 GGGAAGAAAGGGAAGGTGACTGG + Intergenic
1067899590 10:50225162-50225184 GGGACTAAAGGCATGGTGCAAGG - Intronic
1067936837 10:50620140-50620162 GTGAAGAAAGGGAAAGAGAAGGG - Intronic
1068194804 10:53702619-53702641 AGGAATAAAGGCATTTTGAAAGG + Intergenic
1068331424 10:55575987-55576009 GTGAATAGAGTGAAAGTGAACGG - Intronic
1068382747 10:56278749-56278771 GGGAATAGAGGGCTAGAGAGAGG + Intergenic
1068740652 10:60465592-60465614 GTGACTAGAGGGATATTGAAAGG + Intronic
1071973628 10:90933002-90933024 GAAAATAAAGGGATAGACAAAGG + Intergenic
1072767115 10:98104194-98104216 GAGAAGAAAGGGAGAGTGGAAGG - Intergenic
1072877965 10:99193571-99193593 GAAAATAAAGGGATAGTAAAAGG + Intronic
1073206939 10:101774572-101774594 GGGAAGAGAGGGCTAGGGAAGGG - Intronic
1075762724 10:124869213-124869235 GGGAAGAAAGGGAAAGTTGAAGG - Intergenic
1075820939 10:125310030-125310052 GGTAAGAAAAGGATAATGAAGGG + Intergenic
1077896551 11:6457607-6457629 GGGAATAAAGGGTCTGGGAAGGG - Intronic
1078030366 11:7744959-7744981 AGGATTAAATGGAAAGTGAATGG - Intergenic
1078332535 11:10437191-10437213 GGGAACAAAGGGATATTTAATGG + Intronic
1078452829 11:11453079-11453101 AGGATGAAAGGGAAAGTGAAGGG + Intronic
1078914538 11:15766650-15766672 GGGAATAATGGGATAGAAGATGG + Intergenic
1081114195 11:39177731-39177753 GGAAAGAAAGGGAAAGGGAAGGG + Intergenic
1081252928 11:40857942-40857964 GGAAAGAAAGGGAAAGGGAAAGG + Intronic
1082894198 11:58172932-58172954 GGGAAAGTAGGGATAGTTAATGG - Intronic
1084615516 11:70233188-70233210 AGGAATAAAGGGATGCTGAAGGG - Intergenic
1085702268 11:78755806-78755828 GGGAACAATGGGGTAGTGATGGG - Intronic
1085869115 11:80328429-80328451 GGAAGTAAATGGATACTGAATGG - Intergenic
1086116557 11:83257502-83257524 GAGAATTAAGAGATAGTTAAGGG - Intronic
1086527281 11:87742549-87742571 GAGAATAAAGTGAAAGTGAGGGG + Intergenic
1086855923 11:91865767-91865789 GGGAAGACAGGGAAAGTGAAGGG + Intergenic
1087106526 11:94414539-94414561 GGGATGAAAGGAATAGGGAAGGG + Intergenic
1087151786 11:94866587-94866609 GGGAATAATGGGATAATGGGGGG + Intronic
1087650198 11:100857473-100857495 GGGAAGGAAAGGATTGTGAAAGG - Intronic
1087930663 11:103973915-103973937 GGGAATAGAGAGTTACTGAAGGG + Intronic
1089166035 11:116477267-116477289 GAGAAAAAAGGGAGAGTGAAAGG + Intergenic
1089459061 11:118642170-118642192 GGAAATAAAGGGAAAGGAAAAGG - Intronic
1090727998 11:129544871-129544893 TGGAATGAAGGGATGGTGATGGG + Intergenic
1093054583 12:14543131-14543153 ACAAATAAAGGGATAGTAAATGG - Intronic
1094358228 12:29601363-29601385 GGAAATAAAGGCAGAGTGAAGGG - Intronic
1094411433 12:30171484-30171506 GGGAAAAAAGGATTAGTCAAAGG - Intergenic
1096755304 12:53794368-53794390 TAGAATAAAGGGACAGAGAAAGG + Intergenic
1097926525 12:65134215-65134237 GGGAAGGAAGGGAGAGAGAAAGG + Intergenic
1098148877 12:67526052-67526074 TTGAATAAGGGGACAGTGAAGGG + Intergenic
1098342644 12:69468611-69468633 AGGCCTAAAGGGATAGTGAGAGG - Intergenic
1098437116 12:70479672-70479694 GGCAAGAGAGGGAGAGTGAAGGG - Intergenic
1098699600 12:73607424-73607446 GGAAAAAAAGGGAGAGAGAAAGG + Intergenic
1099734433 12:86550106-86550128 GGAAAGAGAGGGAAAGTGAAGGG - Intronic
1101051240 12:100866291-100866313 GGGAATAAAGGAATAATGGAAGG + Intronic
1101688674 12:107052578-107052600 GGGAATAAAGGAATGGAGACTGG + Intronic
1104621534 12:130317453-130317475 GGGAATAAAGGAAAAGGAAAGGG - Intergenic
1105958646 13:25308095-25308117 TGGAATTAAGGGCTAGTGATAGG + Intronic
1106610608 13:31276023-31276045 GGTAATAAAGGGGTCATGAAGGG + Intronic
1106811779 13:33365178-33365200 GGTAAGAAAGGGATGCTGAAGGG + Intergenic
1106875339 13:34066014-34066036 GGGTATAAAGGGAGAGTGACTGG + Intergenic
1107293402 13:38883124-38883146 GGGAATAAAGGGAAGGAAAAAGG - Exonic
1107550200 13:41466990-41467012 GGGATAAAAGGGACAGAGAAGGG - Intronic
1108004187 13:45931173-45931195 GGCGATAAAGGGAGAATGAATGG - Intergenic
1108422955 13:50269179-50269201 GGGGAAAAAGGGATGTTGAAAGG - Intronic
1108466761 13:50724579-50724601 GGGAAAGTTGGGATAGTGAAAGG + Intronic
1108900875 13:55406673-55406695 GAAAATAAAGGGATAAAGAATGG - Intergenic
1109286355 13:60413020-60413042 GGGAGTACAGGGATACTGCAGGG - Intronic
1109688993 13:65861310-65861332 GGAAGTAAAGGGAGAGAGAAAGG + Intergenic
1110507400 13:76303555-76303577 GTGAATCAAGGGGCAGTGAAAGG + Intergenic
1111264132 13:85784945-85784967 GAGAATAAAGGGTAAGTGCATGG + Intergenic
1111426877 13:88096118-88096140 GTGAATAAGTGGTTAGTGAATGG + Intergenic
1112571009 13:100593504-100593526 GGGAATTAAGGCATATTGAGTGG + Intergenic
1112955561 13:105053769-105053791 GAGAATAAAATGATATTGAATGG - Intergenic
1114376681 14:22153916-22153938 GGGAAGAAAAGGATAGAGAAAGG + Intergenic
1115127613 14:30015189-30015211 GGGGATAGGGGGATAGGGAAGGG + Intronic
1117248706 14:53913641-53913663 GGCAACAAAGGGATATTTAAGGG - Intergenic
1117260419 14:54027244-54027266 GGCATTAAAAGGATAGTAAAGGG - Intergenic
1117269465 14:54127249-54127271 GTGAATGAAGGGAAAGTGAGAGG + Intergenic
1117538437 14:56723786-56723808 GGGGATAAAGGGATGGGGCAGGG + Intronic
1117690231 14:58298715-58298737 GGGAATCCGGGGATACTGAATGG + Intronic
1118510151 14:66463460-66463482 GGTAAAAAAGGGAAAGTGGAAGG - Intergenic
1119873488 14:78036693-78036715 GGGATTAGAGGGAAAGAGAAAGG + Intergenic
1119943652 14:78668521-78668543 GGGAGTAAAGGGATATTGAAGGG + Intronic
1120142771 14:80946971-80946993 TGGGAGAAAGGGAGAGTGAAGGG - Intronic
1121038386 14:90725575-90725597 GGGAATAAAGTGGTATGGAAGGG - Intronic
1121347604 14:93147644-93147666 GCGAATAAAGAGAGAGAGAAGGG - Intergenic
1121983257 14:98473775-98473797 GGGAATGAATGGTTAGTTAATGG - Intergenic
1123388034 15:19839034-19839056 TGGAAGGAAGGGATAGGGAAAGG + Intergenic
1124462056 15:29901123-29901145 GGGAAAAAGGTGATAGAGAAGGG + Intronic
1125822879 15:42648739-42648761 GGGAAAAAAGGGAAAGGTAATGG - Intronic
1125898990 15:43328316-43328338 GGGAAAAAAAGGATGGGGAAAGG + Exonic
1126125230 15:45289535-45289557 GAGAATATAGGGATGGTAAAAGG - Intergenic
1126357934 15:47815845-47815867 GGGCATAAAGAGTTAGTCAAGGG - Intergenic
1127582325 15:60349794-60349816 GAGAAGAAAGGGAAAGGGAAAGG + Intronic
1129768222 15:78183637-78183659 GGGAATAAAGGGAAGAAGAAAGG + Intronic
1129835856 15:78705074-78705096 GGGAAGAAAGGCATAGTGCTGGG + Intronic
1130243784 15:82223837-82223859 GGGAATAACAGGTCAGTGAATGG - Intronic
1131285921 15:91057281-91057303 GGGAACAGAAGGATAGGGAAGGG - Intergenic
1131794107 15:95995881-95995903 GAGAGTAAAGTGTTAGTGAAAGG + Intergenic
1131886956 15:96926359-96926381 TGGAATTAAGCGATAGTCAAGGG - Intergenic
1133525564 16:6602065-6602087 GGGAATAAATGAATAATGGAGGG - Intronic
1133630203 16:7613200-7613222 GGGAATAAAGAGATTCTGAATGG + Intronic
1134375479 16:13668650-13668672 AAGAATTAATGGATAGTGAATGG - Intergenic
1134563741 16:15232860-15232882 GGGAATGTAGGGATGGTTAATGG + Intergenic
1134738752 16:16523833-16523855 GGGAATGTAGGGATGGTTAATGG - Intergenic
1134928747 16:18188320-18188342 GGGAATGTAGGGATGGTTAATGG + Intergenic
1135277094 16:21122621-21122643 GGGAATAAAGGCTTTGGGAAAGG - Intronic
1135492291 16:22920010-22920032 AGGAATAAAGGGAATATGAATGG - Intergenic
1135853195 16:25983120-25983142 TGGAATGAAGGGAGAGTGATGGG + Intronic
1135909275 16:26544463-26544485 GGGAATCAAGGGAGAGTTAGGGG + Intergenic
1137415424 16:48273223-48273245 GGGAAAACAGGGAGAGTGAGTGG - Intronic
1138024345 16:53511195-53511217 GGAAATGAGGGGATGGTGAAGGG + Intergenic
1138050871 16:53776010-53776032 GGGAAAAAGGGGATGGTGGAGGG + Intronic
1138236803 16:55390365-55390387 AGGATTAAAGGGATAATGTATGG + Intronic
1138384498 16:56626854-56626876 GGGAAGAAGGGGAGAGTGAGAGG - Intronic
1138386146 16:56636826-56636848 GGGAAGAAGGGGAGAGTGAGAGG - Intergenic
1138388024 16:56649398-56649420 GGGAAGAAGGGGAGAGTGAGAGG - Intronic
1138388524 16:56652948-56652970 GGGAAGAAGGGGAGAGTGAGAGG - Intronic
1138392148 16:56677626-56677648 GGGAAGAAGGGGAGAGTGACAGG - Intronic
1138791544 16:59909582-59909604 GAGATAAAAGGGAAAGTGAAGGG + Intergenic
1138869395 16:60863382-60863404 GGGCATAAAGGGATAGTGCTAGG - Intergenic
1138927182 16:61606616-61606638 GGGACTAAAGAAAAAGTGAATGG - Intergenic
1139422206 16:66855786-66855808 GGGGAGAAAGGGACAGTGGAGGG + Intronic
1143731371 17:8884804-8884826 GGGAAGCCAGGGGTAGTGAAGGG - Intronic
1143968589 17:10775389-10775411 GAAAATGAAGGGACAGTGAAGGG - Intergenic
1144459931 17:15450322-15450344 GGGAAGGAAGGCATAGTGCAGGG - Intronic
1145931423 17:28688572-28688594 GGGTATAAAGAGATAAGGAAGGG + Intronic
1146944128 17:36862642-36862664 GGTGATAAAGGGATTGTGTAGGG + Intergenic
1148686404 17:49503491-49503513 GGGAATAAGGGGATAGAGCTGGG + Intronic
1148822090 17:50365672-50365694 AGGATTAAAGGGATGGAGAAAGG + Intergenic
1150012326 17:61516147-61516169 AGGAAGAAAGGGAAAATGAAGGG + Intergenic
1150453535 17:65288946-65288968 AGGAAGAAAAGGATAGTGAAGGG - Intergenic
1150582683 17:66489750-66489772 GGAATTAAAGGGAAAGGGAAAGG - Intronic
1152038604 17:77889018-77889040 GGGAAGAAAGGGGAAGGGAAGGG + Intergenic
1154534197 18:15381116-15381138 TGGAAGGAAGGGATAGGGAAAGG - Intergenic
1155281096 18:24240827-24240849 GGGAGGGAAGGGAAAGTGAAAGG - Intronic
1156089318 18:33446068-33446090 GGGAAAAAAGGAAAAGTCAAAGG - Intergenic
1156554247 18:38049222-38049244 GGGAATAGTGGGATAATGAAAGG - Intergenic
1157106075 18:44775964-44775986 GGCAATTAAGGGATAGAGACAGG - Intronic
1157606706 18:48930405-48930427 GGGAATAAAAGAAGAATGAAAGG + Intronic
1158431911 18:57396772-57396794 GGGAAGAAGGGTATAGTTAATGG + Intergenic
1158758522 18:60355898-60355920 GGGAATGAAGGGAAAGGGAAAGG - Intergenic
1159770626 18:72542743-72542765 GGGAAACAAGGGATAGGAAAAGG - Intronic
1160299744 18:77668909-77668931 GGGAAGAAAGGGGAAGGGAAGGG + Intergenic
1162273409 19:9634527-9634549 TGGATTACAGTGATAGTGAAGGG - Exonic
1162830626 19:13282178-13282200 GGGAAGGAAGGGAAAGTGCATGG + Intronic
1164772008 19:30816511-30816533 GGGAAGAAAGGGAGAGAGGAAGG - Intergenic
1164932929 19:32189093-32189115 GGGAAGGAAGGGGAAGTGAAGGG + Intergenic
1165205386 19:34180642-34180664 GGGAATGAGAGGACAGTGAAAGG - Intronic
1165265882 19:34663759-34663781 AGGGAGAAAGGGAAAGTGAAGGG + Intronic
1165703749 19:37959729-37959751 GGCAATAAAGGGAGAATAAAAGG - Intronic
1166867436 19:45848534-45848556 GTGAATAAACGGATGGTCAATGG + Intronic
1167798197 19:51724338-51724360 GGAAATACAGGGATAGGGGATGG - Intergenic
1168064819 19:53913173-53913195 AGGAATAAAGGGCTAGTCACTGG - Intronic
1168470192 19:56633587-56633609 GGGATGAAATGGAGAGTGAAGGG + Intergenic
925770409 2:7276853-7276875 GGGAAAAAAAGGACAGTTAATGG - Intergenic
925840260 2:7985377-7985399 GGGAATGAAGAGAAAGAGAAAGG - Intergenic
925959365 2:9001657-9001679 GAGAATCAAGGGAAAGTGACAGG - Intronic
928689017 2:33779690-33779712 GGGAATAAAGAAAAAGGGAAGGG - Intergenic
928713019 2:34028768-34028790 GGAAACAAAGGGATTGTGCAAGG + Intergenic
929340552 2:40811181-40811203 GGGTATATAGGTAAAGTGAATGG + Intergenic
929706557 2:44218946-44218968 GGGCATACAGGGGTACTGAAAGG - Intronic
931130740 2:59332578-59332600 TGGCTTAAAGGGATAGTGATGGG - Intergenic
934035960 2:88088694-88088716 GGGCAGGAAGGGATAGTGATTGG - Intronic
934046892 2:88179792-88179814 GGGAACAAAGGCACAGAGAAAGG + Intronic
935415403 2:102811625-102811647 GTGAATAAATGAATAGGGAAAGG - Intronic
935431235 2:102978025-102978047 AGGAATAAAGGGAAAGAGTAAGG - Intergenic
935782255 2:106518670-106518692 AGGAATGAATGGATGGTGAATGG - Intergenic
935817519 2:106860461-106860483 GGGAACAAATGGCTAGTGAGGGG + Intronic
935989877 2:108709560-108709582 GAAAATAAAGGGATTGGGAAAGG + Intergenic
936175324 2:110214733-110214755 TGGAATAGATGGATAGTGTAAGG + Intergenic
936913405 2:117615457-117615479 GGCAATAAAGAGATACTGACTGG + Intergenic
937941558 2:127290145-127290167 AGGAATAAAGGGATATGGGAAGG - Intronic
938182626 2:129196727-129196749 GGGAATAAAAGGAAAGAGATTGG + Intergenic
938532950 2:132208301-132208323 TGGAAGGAAGGGATAGGGAAAGG - Intronic
939964758 2:148599393-148599415 GGGGAGAAAGGGATAGAAAAAGG - Intergenic
940690157 2:156907064-156907086 GAAAATCAAGGGATAGTCAAAGG + Intergenic
941298183 2:163767003-163767025 GTGAATAATTGGATAGAGAAAGG - Intergenic
941855681 2:170228029-170228051 GGGCAGCAAGGGAGAGTGAAGGG + Intronic
941946170 2:171100303-171100325 GGGAAGTAAGGTCTAGTGAAAGG + Intronic
942516935 2:176764165-176764187 GGGAAGAAAGGGATAGGAGAAGG + Intergenic
943173225 2:184431758-184431780 AGGAATGAGGAGATAGTGAAGGG + Intergenic
943216445 2:185043545-185043567 GGGAGTGAAGAGATATTGAATGG + Intergenic
944289108 2:197984835-197984857 GAAAATAAAAGGATAGTGAATGG + Intronic
945441981 2:209890403-209890425 AGGAATCAAGTGATAGTGAGGGG - Intronic
945956828 2:216094038-216094060 GGAAATAAAGGGATGGCAAATGG + Intronic
946056617 2:216908348-216908370 GGAAATAAATGGAAATTGAATGG - Intergenic
946504749 2:220286900-220286922 GTTATCAAAGGGATAGTGAAAGG + Intergenic
946554680 2:220842402-220842424 GGGATTCAATGGGTAGTGAATGG + Intergenic
946677650 2:222179183-222179205 GGTAGAAAAGGGATAGTGAAGGG - Intergenic
947076397 2:226350237-226350259 GAGAAGAAAGGAAGAGTGAAAGG + Intergenic
947833020 2:233155146-233155168 GGGAAGAAGGGGAAAGGGAAAGG + Intronic
948090612 2:235291422-235291444 GGGATGAAAAGGATAGGGAAGGG + Intergenic
1169458568 20:5774894-5774916 GGGAAAAAAGGGAAGGTTAAAGG - Intronic
1170273111 20:14550284-14550306 GGGAAGGAAGGGACAGGGAAAGG - Intronic
1170448698 20:16458689-16458711 GGGAACAGAGGGAAAGAGAAAGG + Intronic
1171372225 20:24669280-24669302 GGCTATAAAGGGACAGTTAATGG - Intergenic
1172907899 20:38382878-38382900 GGGTATACAGGGATGTTGAAGGG + Intergenic
1172935540 20:38617431-38617453 GGGAAGACAGGGGTAGAGAAGGG - Intronic
1174198516 20:48790642-48790664 GAGAAGAAAGGGAAGGTGAAGGG + Intronic
1174723303 20:52836282-52836304 AGGAAGAAAGGGAAAGGGAAGGG + Intergenic
1174885942 20:54334635-54334657 GAGAAGAAAGGGCTAGTGCAAGG + Intergenic
1175817960 20:61893389-61893411 GTGAATAGAGGGATGGTGGATGG + Intronic
1175818038 20:61893710-61893732 GTGAATAGAGGGATGGTGGATGG + Intronic
1175818052 20:61893761-61893783 GTGAATAGAGGGATGGTGGATGG + Intronic
1177343296 21:19834157-19834179 TGGAATATAGAGATAGAGAAGGG + Intergenic
1177543519 21:22527251-22527273 GAGAAAAAAGGGATCCTGAAAGG - Intergenic
1177728738 21:25000548-25000570 GGGAATGAGAGCATAGTGAAAGG - Intergenic
1177907838 21:26993676-26993698 GGGAATCAAGGGTTGGTGCAGGG + Intergenic
1178190567 21:30274839-30274861 GTGAATAAAGGGTTAGAGAGAGG + Intergenic
1178424551 21:32468973-32468995 TGGATTAAAGGGAAAGTCAAGGG + Intronic
1180510696 22:16085935-16085957 TGGAAGGAAGGGATAGGGAAAGG + Intergenic
1181592312 22:23893069-23893091 GGGAATAAAGGGATAGTGAAAGG + Intronic
1182410445 22:30180877-30180899 GGGAAGGAAGGGAAAGGGAAAGG - Intergenic
1182420606 22:30246883-30246905 TGGAAGAAAGTGAGAGTGAAGGG + Intergenic
1182731611 22:32500516-32500538 GGGAATAAGGGGCTACAGAAAGG - Intergenic
1183176126 22:36225965-36225987 GGGAAGAAAGGAAAAATGAAAGG - Intergenic
1183182200 22:36267747-36267769 GGGAAGAAAGGAAAAATGAAAGG + Intergenic
1183226234 22:36551768-36551790 GGGGATGAAGGGAAAGAGAAGGG + Intergenic
1184109731 22:42387708-42387730 GGGAATGAAAGGAAAGTGACAGG - Intronic
1184328599 22:43811354-43811376 GGGAAGAAAGGGGAAGGGAAGGG + Intronic
1184803736 22:46778158-46778180 GTGAATGAAGGGTGAGTGAATGG + Intronic
1185059326 22:48597852-48597874 GGGAGTTAAGGGATGGAGAAGGG + Intronic
949093787 3:61729-61751 GGGAATAAATGGATTGAGGAAGG + Intergenic
949284383 3:2383773-2383795 GGAAAGAAAGGGAGAGGGAAGGG - Intronic
952263590 3:31764433-31764455 GGGAAGACAGGGCAAGTGAAAGG + Intronic
953483165 3:43269892-43269914 AGAAATAAAGGAAGAGTGAATGG + Intergenic
954170133 3:48794935-48794957 AGGAAAGAAGGGATAGGGAAAGG + Intronic
959563117 3:107805181-107805203 GGGAAAAAAAGGATAAGGAAGGG + Intronic
961322396 3:126084551-126084573 GGGAAAAAAGGGAAAACGAAAGG - Intronic
961722612 3:128906729-128906751 GTGAATGAAGAGAGAGTGAAGGG + Intronic
962371677 3:134825791-134825813 AGGAAGAAAAGGATCGTGAAAGG - Intronic
962679983 3:137789034-137789056 TGGAATGGAGGGATAGTGGAAGG - Intergenic
963269991 3:143277071-143277093 GGCAATCAAGGGACAGAGAAAGG + Intronic
964163219 3:153670950-153670972 GGGGAAAAATGGAAAGTGAAGGG + Intergenic
964920757 3:161892603-161892625 GGGAATAAGAGGATAGGCAAGGG + Intergenic
965233837 3:166090294-166090316 GGCAGGAAAGGGAGAGTGAAGGG + Intergenic
965251112 3:166345201-166345223 GAAAATAAAGGGATAGACAAAGG + Intergenic
965905690 3:173702300-173702322 GCGGATGAAGGGATAGAGAAAGG + Intronic
967221182 3:187249398-187249420 GGGAAGGAAGGGAGAGAGAAGGG - Intronic
968924797 4:3541562-3541584 GGGAATAGATGGATGCTGAATGG + Intergenic
969510293 4:7613866-7613888 GTGAATGAATGGATGGTGAATGG - Intronic
971185197 4:24368829-24368851 CGGAAGAAACGGAGAGTGAACGG + Intergenic
972144767 4:36009519-36009541 GGGGATAAAGGGAGAGGGTAAGG + Intronic
973093010 4:46161764-46161786 TGGACCAAAGGGATAGTGAGGGG + Intergenic
974811248 4:66949066-66949088 GGGAATAGGGGAATAGTGAATGG - Intergenic
975388021 4:73781354-73781376 GGGAAAAGAGGAAAAGTGAAGGG + Intergenic
976533266 4:86180863-86180885 GGGAAAAAAGAGATTGTTAAAGG + Intronic
976688717 4:87845232-87845254 GGGAATAAAGGGTTTGAGGATGG + Exonic
976753891 4:88477689-88477711 GGAAATACAGGGATAGGAAACGG - Intronic
977330833 4:95635314-95635336 GGGAATAAAGGAATAAATAACGG - Intergenic
977505422 4:97896602-97896624 AGGAATAAATAGATAGTGATGGG - Intronic
978554495 4:109964306-109964328 GGGTAAAAAGGTACAGTGAAAGG + Intronic
979730584 4:124018485-124018507 GGGAAAAAAAGGAAAGGGAAGGG - Intergenic
980443337 4:132875456-132875478 GGGAAGATGGGGATAGTTAATGG + Intergenic
983065549 4:163206123-163206145 AGGAATAAGGGGACAGAGAAAGG + Intergenic
983553189 4:169036806-169036828 GGGAAGAAAGAGATAGAAAAAGG - Intergenic
986456716 5:7927367-7927389 GGGAAGTAAGGGATGGGGAAGGG + Intergenic
986517741 5:8581284-8581306 GGGAATAAAAGGAGAGGGAGAGG - Intergenic
986600321 5:9466459-9466481 GGGAAAGAAGGGCTATTGAAGGG + Intronic
988135235 5:27161666-27161688 GAGAAAAAAGGTATAGTTAATGG + Intergenic
989256242 5:39368629-39368651 GGGAACAAAGGGCAACTGAATGG - Intronic
991672369 5:69061422-69061444 GAAAATAAAGGGATAGAAAAAGG - Intergenic
992648385 5:78833395-78833417 GGGAACAAAGGAAAAGAGAAGGG + Intronic
993918694 5:93773067-93773089 GGGAATAAAGGCATAGATATGGG + Intronic
995609465 5:113893576-113893598 GGGAGTAATGGGAGAGAGAATGG - Intergenic
995730427 5:115234387-115234409 GGGAATACAGGGAGGGTGAGGGG + Intronic
996914265 5:128693600-128693622 GGCAAGACAGGGAGAGTGAAGGG + Intronic
996956802 5:129192984-129193006 GGGAAAGTAGGGATAGTTAATGG + Intergenic
998178341 5:139915987-139916009 GGGAATGAAAGGATATTGAAGGG + Intronic
999467349 5:151820386-151820408 GTGAATAAAGTGCTAGTGAGAGG + Intergenic
999580340 5:153031439-153031461 GTGAATAAAGGGATGGAGATAGG - Intergenic
999656801 5:153818503-153818525 GGGAATAAAGGCAAAGTGCCTGG + Intergenic
1000920334 5:167130022-167130044 GGGAATAAAGGGAAAGCTATGGG + Intergenic
1001337073 5:170807838-170807860 GGGAAAAACAGGATGGTGAATGG - Intronic
1003009842 6:2416416-2416438 AGGAAGAAAGGAATAGAGAAAGG - Intergenic
1003561323 6:7183196-7183218 GGGAAAAAAGAGAGAGAGAAAGG - Intronic
1004202775 6:13564992-13565014 GGGGATGAAGAGATAGAGAATGG - Intergenic
1004585412 6:16994932-16994954 GGGAATGAAGGGTGAGTGAAAGG - Intergenic
1006149638 6:31979844-31979866 GGGACTAAGAGGATAGAGAATGG + Intronic
1006804198 6:36777876-36777898 AAGAATAAAGGGCTAGAGAAGGG - Intronic
1006875046 6:37288272-37288294 GAGGATAAAGGGATCATGAATGG - Intronic
1007927024 6:45658049-45658071 GGGAATTGAGGGAAAGAGAAGGG + Intronic
1008839349 6:55881395-55881417 AGGAAGAAAGGGGTGGTGAAAGG - Intergenic
1009427697 6:63532585-63532607 TTTAATAAGGGGATAGTGAATGG - Intronic
1011003413 6:82617107-82617129 GGGAATAAAGTGATACAGCATGG - Intergenic
1012214565 6:96566134-96566156 GGGAAGAAAGAGATAGCCAAAGG - Intronic
1013272164 6:108555475-108555497 GGGAAGAAAGGGAAAGAGAGAGG + Intergenic
1014047932 6:116914707-116914729 GGGAATAAAGGGAAATGCAAAGG + Intronic
1015019237 6:128452218-128452240 GGAAATACAGAGAAAGTGAAAGG - Intronic
1015638623 6:135305993-135306015 AGCAATAAAAGGATAGTGAAGGG - Intronic
1016190006 6:141253516-141253538 TGGAATAAAGGGAGATAGAAAGG + Intergenic
1016430014 6:143973551-143973573 AGGAAGAAAGGGAGAGTGAGAGG - Intronic
1017552896 6:155529053-155529075 GGAAATGAAGGGATTGGGAAAGG - Intergenic
1018101171 6:160441787-160441809 GGATATAAAGGGAAAATGAAAGG + Intronic
1020343038 7:7133259-7133281 GGGAAGAAAGGGATAGAATAAGG + Intergenic
1020648710 7:10848144-10848166 GGCAAGAAAGGGAAGGTGAAAGG + Intergenic
1021489231 7:21200683-21200705 GGTAATGAAGGGAGAGTGCACGG + Intergenic
1022258349 7:28681128-28681150 GGGAGAAAAGGTATAGTGTAGGG + Intronic
1023350721 7:39317970-39317992 GCGAAGAAAGGGAAAATGAAGGG - Intronic
1024140462 7:46457971-46457993 GGGAATAAAGGAAAAGTGTAGGG + Intergenic
1025121373 7:56306842-56306864 TGGAAAAAAGGGATAAGGAAGGG + Intergenic
1025585695 7:62783426-62783448 GTGAAAAAAGGAATATTGAAAGG + Intergenic
1026073189 7:67141480-67141502 GGGAATAAATGGAGTATGAAAGG - Intronic
1026326795 7:69317569-69317591 GGAAATAAAGGGATGGATAAAGG + Intergenic
1026703698 7:72670742-72670764 GGGAATAAATGGAGTATGAAAGG + Intronic
1026823912 7:73569251-73569273 GGGACAGAAGGGATAATGAATGG + Exonic
1027651403 7:80873056-80873078 GGGAACAAAGGGCAGGTGAAGGG + Intronic
1028067628 7:86407018-86407040 GGGAAAAAAGGGAATGTGATTGG + Intergenic
1028339551 7:89701661-89701683 GGGAAGATGGGGATAGTTAATGG + Intergenic
1028782036 7:94748415-94748437 CAGAGTAAAGGGATGGTGAAAGG + Intergenic
1031931084 7:127686581-127686603 GGGAAGAAAGAGAAAATGAATGG - Intronic
1032563854 7:132920060-132920082 TATAATAAAGGGATAGAGAAGGG - Intronic
1033174487 7:139111951-139111973 GGGAAGAGAGGGAAAGGGAAAGG + Intergenic
1033379440 7:140799591-140799613 GGGAATAGAAGCATGGTGAAAGG - Intronic
1033762023 7:144446001-144446023 GGAACTAAAGGTAGAGTGAAAGG + Intergenic
1034691027 7:153013751-153013773 GGGAAGGAAGGGAAAGTGGAGGG + Intergenic
1034879611 7:154753214-154753236 GGGAATAAACGGGTGGTGCATGG + Intronic
1035537784 8:405846-405868 AGGAATAAAGAGAGAGGGAAAGG + Intergenic
1035779215 8:2214617-2214639 GGGAATCAATGGAAAGTGTACGG + Intergenic
1038693407 8:29783309-29783331 GGGAATAAAGAGAAAGTGAGTGG - Intergenic
1038873818 8:31525726-31525748 GGGAAAAATGGGATGGTGACAGG - Intergenic
1039223755 8:35364771-35364793 AGAAATAAAGAAATAGTGAAGGG - Intronic
1039447847 8:37646844-37646866 GGCAATGAAGGGAGAGTGGAAGG + Intergenic
1039550489 8:38439682-38439704 GGGAAGAAAAGGAAAATGAAAGG - Intronic
1041706817 8:60855255-60855277 GGAACTAAAGGGATAGAGAGAGG - Intronic
1044134803 8:88573197-88573219 GCCAATAAAGGTATATTGAAGGG + Intergenic
1044852209 8:96440238-96440260 GGAAATAAGGGGAGAGTGTAGGG - Intergenic
1045759805 8:105590953-105590975 GGGATTAAAGGGCTAATGTAAGG + Intronic
1046741775 8:117836782-117836804 ACGAATAAAGGGAAAGTGTAGGG + Intronic
1047023613 8:120804227-120804249 AGGAATAAAGGGAGGGAGAAAGG - Intronic
1047728328 8:127703994-127704016 GGGATTAAAGCCATAGTGCATGG - Intergenic
1047983081 8:130203647-130203669 GGAAATCAAGGAATAGTGGAAGG + Intronic
1050697676 9:8297473-8297495 GGGCACAAAGGGACAATGAAGGG - Intergenic
1051091135 9:13409655-13409677 GGGCATAAATGGAAAGTGAGTGG - Intergenic
1051788494 9:20772693-20772715 TGGAATTAAGGGAGTGTGAATGG + Intronic
1052230870 9:26150923-26150945 ATGAATAAAGGTATAGAGAAGGG - Intergenic
1052830930 9:33214812-33214834 AGGGATAAAGGGATAGAGAGAGG + Intergenic
1052833847 9:33235961-33235983 GGGAGTAGGGGGATAGAGAAGGG + Intronic
1053711500 9:40814331-40814353 TGGAAGGAAGGGATAGGGAAAGG - Intergenic
1053799975 9:41758006-41758028 AGGAATGAATGGATAATGAATGG + Intergenic
1053936037 9:43152571-43152593 TGGAAGGAAGGGATAGGGAAAGG - Intergenic
1054145341 9:61557396-61557418 GGGAATAGATGGATGCTGAATGG - Intergenic
1054188275 9:61969583-61969605 GGGAATAGATGGATGCTGAATGG + Intergenic
1054188404 9:61970154-61970176 AGGAATGAATGGATAATGAATGG + Intergenic
1054277649 9:63100671-63100693 TGGAAGGAAGGGATAGGGAAAGG + Intergenic
1054299167 9:63359751-63359773 TGGAAGGAAGGGATAGGGAAAGG - Intergenic
1054397188 9:64664259-64664281 TGGAAGGAAGGGATAGGGAAAGG - Intergenic
1054421411 9:64935148-64935170 TGGAAGGAAGGGATAGGGAAAGG - Intergenic
1054431830 9:65169451-65169473 TGGAAGGAAGGGATAGGGAAAGG - Intergenic
1054465097 9:65488549-65488571 GGGAATAGATGGATGCTGAATGG - Intergenic
1054498548 9:65852056-65852078 TGGAAGGAAGGGATAGGGAAAGG + Intergenic
1054650121 9:67618467-67618489 AGGAATGAATGGATAATGAATGG - Intergenic
1054650239 9:67618993-67619015 GGGAATAGATGGATGCTGAATGG - Intergenic
1056072344 9:83000705-83000727 GGGAATAGAGTGACACTGAATGG + Intronic
1056128551 9:83562046-83562068 GAGAATAAAGGAATAATGAGTGG + Intergenic
1057908715 9:99002114-99002136 GGGAATAAAAGGAGAGAGGAGGG - Intronic
1059071881 9:111146602-111146624 GGGAAAAAAGGAACAGAGAAAGG + Intergenic
1059932053 9:119270561-119270583 GGGAATCAAGGAAGAGTAAAAGG + Intronic
1061143512 9:128783005-128783027 GGGACTACAGAGATAGAGAATGG - Intergenic
1061280912 9:129597336-129597358 GGGAGAAAGGGGAGAGTGAAGGG - Intergenic
1062247979 9:135579411-135579433 GTGAATAAATGGATGGTGTATGG - Intergenic
1186968871 X:14818243-14818265 GGGAATGGAGGGATAGGAAATGG + Intergenic
1187349338 X:18497803-18497825 AGGAAGAAAGGGAAAGAGAAAGG - Intronic
1187576232 X:20559207-20559229 GGGAAGGAAGGGAAAGGGAAGGG - Intergenic
1188027816 X:25229174-25229196 GGGAAGGTAGGGATGGTGAAAGG + Intergenic
1188847362 X:35089742-35089764 AAGAATAAAGGCATAGAGAAGGG + Intergenic
1188976910 X:36686796-36686818 GGGAATGAAAGTATATTGAATGG - Intergenic
1189291792 X:39891262-39891284 GAAAATAAAGGGAGAGTAAAAGG - Intergenic
1190137921 X:47813993-47814015 GAAAATAAAGGGATAAAGAATGG + Intergenic
1190158731 X:48015184-48015206 GTGAATCAAGAGATAGTGATTGG + Intronic
1190174429 X:48137472-48137494 GTGAATCAAGAGATAGTGATTGG + Intergenic
1190222643 X:48522165-48522187 GGGAAGAGACGGATATTGAAAGG - Intronic
1190635852 X:52433064-52433086 TTGAATAAAGGAAGAGTGAAGGG - Intergenic
1190904170 X:54709731-54709753 GAGAATAAAGAGATAATGAAGGG - Intergenic
1191744672 X:64473459-64473481 GGGAAGGCAGGGATAGTTAATGG - Intergenic
1193191440 X:78575491-78575513 TGGAATAATGGTACAGTGAAAGG - Intergenic
1193212398 X:78822526-78822548 AGGAAAAAAGGGATACTGGATGG + Intergenic
1193469333 X:81879739-81879761 GGGAGTTAAGGAAAAGTGAAAGG + Intergenic
1193529224 X:82635363-82635385 GGGAAAATAGGGATGGTTAATGG - Intergenic
1193742807 X:85238581-85238603 GGGGAAATGGGGATAGTGAATGG + Intergenic
1194457277 X:94120644-94120666 GAAAATAAAGGGATGGTAAAAGG - Intergenic
1195892723 X:109713025-109713047 GGGAAGAAAGGGAGAGAGGAAGG + Intronic
1196903920 X:120413242-120413264 AGGCATAAGGGGAGAGTGAAGGG - Intergenic
1198015711 X:132608460-132608482 GGAAAGAAAGGGAAAGGGAAAGG + Intergenic
1200743018 Y:6875756-6875778 GGGAGTAAAAGGAGAGAGAAGGG + Intergenic