ID: 1181594984

View in Genome Browser
Species Human (GRCh38)
Location 22:23908294-23908316
Sequence ATGACCCATGTGGCCAAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181594984_1181594990 -2 Left 1181594984 22:23908294-23908316 CCCACTTTGGCCACATGGGTCAT No data
Right 1181594990 22:23908315-23908337 ATGAGGGGTTTCTGTGTGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181594984 Original CRISPR ATGACCCATGTGGCCAAAGT GGG (reversed) Intergenic
No off target data available for this crispr