ID: 1181595015

View in Genome Browser
Species Human (GRCh38)
Location 22:23908464-23908486
Sequence TGCCAGAGGCTGGCCCTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181595015_1181595020 -10 Left 1181595015 22:23908464-23908486 CCTGGCAGGGCCAGCCTCTGGCA No data
Right 1181595020 22:23908477-23908499 GCCTCTGGCACAGCAACAGGGGG No data
1181595015_1181595022 -1 Left 1181595015 22:23908464-23908486 CCTGGCAGGGCCAGCCTCTGGCA No data
Right 1181595022 22:23908486-23908508 ACAGCAACAGGGGGACAGTGAGG No data
1181595015_1181595023 3 Left 1181595015 22:23908464-23908486 CCTGGCAGGGCCAGCCTCTGGCA No data
Right 1181595023 22:23908490-23908512 CAACAGGGGGACAGTGAGGATGG No data
1181595015_1181595025 14 Left 1181595015 22:23908464-23908486 CCTGGCAGGGCCAGCCTCTGGCA No data
Right 1181595025 22:23908501-23908523 CAGTGAGGATGGCCAGATCTGGG No data
1181595015_1181595024 13 Left 1181595015 22:23908464-23908486 CCTGGCAGGGCCAGCCTCTGGCA No data
Right 1181595024 22:23908500-23908522 ACAGTGAGGATGGCCAGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181595015 Original CRISPR TGCCAGAGGCTGGCCCTGCC AGG (reversed) Intergenic
No off target data available for this crispr