ID: 1181597804

View in Genome Browser
Species Human (GRCh38)
Location 22:23928482-23928504
Sequence TCTACTCCTAGGAGCACAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 3, 3: 8, 4: 154}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181597800_1181597804 13 Left 1181597800 22:23928446-23928468 CCTCAGGCTCGCCAGTGGAATTT No data
Right 1181597804 22:23928482-23928504 TCTACTCCTAGGAGCACAGTTGG 0: 1
1: 0
2: 3
3: 8
4: 154
1181597801_1181597804 2 Left 1181597801 22:23928457-23928479 CCAGTGGAATTTTGTTGCCACTG 0: 1
1: 1
2: 1
3: 17
4: 174
Right 1181597804 22:23928482-23928504 TCTACTCCTAGGAGCACAGTTGG 0: 1
1: 0
2: 3
3: 8
4: 154
1181597799_1181597804 14 Left 1181597799 22:23928445-23928467 CCCTCAGGCTCGCCAGTGGAATT No data
Right 1181597804 22:23928482-23928504 TCTACTCCTAGGAGCACAGTTGG 0: 1
1: 0
2: 3
3: 8
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181597804 Original CRISPR TCTACTCCTAGGAGCACAGT TGG Intergenic
903152759 1:21424081-21424103 TCTACTCAAAGGAGCCTAGTGGG + Intergenic
903160371 1:21483903-21483925 TCTACTCAAAGGAGCCTAGTGGG - Exonic
907388684 1:54142191-54142213 TCCACTCCTACGAGGCCAGTGGG + Intronic
909592729 1:77370115-77370137 TCTACTCCCAGGCTCACAGCAGG - Intronic
914823911 1:151127301-151127323 TCTACTCCAAGGAGATCAATAGG + Intergenic
915605789 1:156949413-156949435 TCTGCTTCTAGGACCACAGGAGG + Intronic
917402140 1:174661880-174661902 TATACACCTGGCAGCACAGTAGG - Intronic
919849092 1:201660402-201660424 GGTGCTCCTAGGAGCCCAGTGGG - Intronic
1063090519 10:2862498-2862520 TCTACTAGTAGAAGCACAGACGG + Intergenic
1064630290 10:17304440-17304462 ACTACTCCTAATATCACAGTGGG + Intergenic
1073460680 10:103664076-103664098 TGTTCCCCTAGGGGCACAGTGGG - Intronic
1077771816 11:5227121-5227143 TCTACTCCCAGGAGCAGGGAGGG - Intronic
1079993062 11:27266823-27266845 GCTACTGCTCAGAGCACAGTAGG - Intergenic
1080479999 11:32637851-32637873 TCTACTCCTAGGAGAGAGGTTGG - Intronic
1080530266 11:33168080-33168102 TCTTCTCTTAGGAGGACAATAGG - Intergenic
1080724795 11:34885936-34885958 TATACAGCTAGCAGCACAGTAGG - Intronic
1082209588 11:49482449-49482471 TTTTCTCATAGGAGCACTGTTGG + Intergenic
1083668678 11:64288685-64288707 GCTGCTCCTGGGAGCACAGCCGG + Exonic
1084093595 11:66895244-66895266 TCAACACCTGGGAGCTCAGTTGG - Intronic
1086640089 11:89143085-89143107 TTTTCTCATAGGAGCACTGTTGG - Intergenic
1087048935 11:93867290-93867312 TCTCTGCCTAGGAGCAGAGTTGG + Intergenic
1088661836 11:112054933-112054955 TCTTCTCTTAAGAGGACAGTTGG + Intronic
1092758804 12:11790543-11790565 CAACCTCCTAGGAGCACAGTGGG + Intronic
1093383409 12:18521792-18521814 TCTCCTCCCAGGAGCTCAGCAGG + Intronic
1096603616 12:52748319-52748341 TATACTCCTACAAGCACAGAGGG + Intergenic
1096669737 12:53191507-53191529 TCTTCTCCTTGGAGGACAGTGGG - Exonic
1099179462 12:79460434-79460456 TCTACTCCTAATCTCACAGTGGG + Intergenic
1099179628 12:79461932-79461954 ACTACTCCTAATATCACAGTGGG + Intergenic
1099179757 12:79463259-79463281 ACTACTCCTAATATCACAGTGGG + Intergenic
1099182081 12:79480566-79480588 TCTACTCCTAATGTCACAGTGGG + Intergenic
1108385978 13:49899661-49899683 TTTACTCCTAATATCACAGTGGG + Intergenic
1108385984 13:49899726-49899748 ACTACTCCTAATATCACAGTGGG + Intergenic
1109969026 13:69740415-69740437 TCAATTGCTCGGAGCACAGTTGG - Exonic
1110293936 13:73840510-73840532 TCTACTAAGATGAGCACAGTGGG - Intronic
1113717414 13:112521802-112521824 TCTAGACCTAGAAGCACAGCAGG + Intronic
1113826807 13:113261721-113261743 TCTACCCCTGAGAGCAGAGTGGG - Intronic
1114436731 14:22713097-22713119 ATTACTCCTAAGATCACAGTTGG + Intergenic
1115313483 14:32003182-32003204 TATACTCCTAGGAACATGGTGGG - Intergenic
1116202572 14:41817434-41817456 TCTACTCCTAGGATTATAGAAGG - Intronic
1116499207 14:45599916-45599938 TCTTCACCTAGCAACACAGTTGG - Intergenic
1117039409 14:51755675-51755697 ATTACTCCTAATAGCACAGTAGG - Intergenic
1117040271 14:51762977-51762999 ATTACTCCTAGTATCACAGTGGG + Intergenic
1117212432 14:53514567-53514589 TCTATTCCTAGGTGCATAGGAGG + Intergenic
1117291895 14:54342546-54342568 TTTACTGCAATGAGCACAGTGGG + Intergenic
1118540059 14:66813726-66813748 TTTAGTCCTAGGAGAACTGTTGG + Intronic
1120108985 14:80530565-80530587 TGTACTACTAGAAGCTCAGTTGG - Intronic
1121644327 14:95507491-95507513 TCTGCTCAAAGGAGCACATTAGG + Intergenic
1121827465 14:97022162-97022184 TCCATTCCAATGAGCACAGTGGG - Intergenic
1121996730 14:98608528-98608550 TCTCCTCCTCAGAGCACAGTGGG + Intergenic
1122703337 14:103605021-103605043 TCTATTCCTAGGGGTACAGCAGG - Intronic
1125610855 15:40969197-40969219 TATACTCTTAGGAGAAAAGTAGG - Intergenic
1126698178 15:51342746-51342768 TGTACTCCCTGGAGCCCAGTGGG - Intronic
1128824640 15:70701872-70701894 TGTACTCCTAAGAACAGAGTAGG - Intronic
1129877816 15:78988311-78988333 TCGACTCCTGGGCACACAGTGGG + Intronic
1133991815 16:10713414-10713436 TATACTCCTACTATCACAGTGGG - Intergenic
1133991906 16:10714543-10714565 ATTACTCCTAATAGCACAGTTGG - Intergenic
1134508405 16:14825833-14825855 TTTACTCCTAATATCACAGTGGG + Intronic
1134508410 16:14825896-14825918 TTTACTCCTAATATCACAGTAGG + Intronic
1134508565 16:14827498-14827520 ATTACTCCTAATAGCACAGTGGG + Intronic
1134696101 16:16224598-16224620 TTTACTCCTAATATCACAGTGGG + Intergenic
1134696106 16:16224661-16224683 TTTACTCCTAATATCACAGTAGG + Intergenic
1134696261 16:16226263-16226285 ATTACTCCTAATAGCACAGTGGG + Intergenic
1134975413 16:18567026-18567048 ATTACTCCTAGTATCACAGTGGG - Intergenic
1134975566 16:18568434-18568456 ATTACTCCTAATAGCACAGTGGG - Intergenic
1134975725 16:18570090-18570112 TTTACTCCTAATATCACAGTGGG - Intergenic
1136646579 16:31624374-31624396 TCTACACCCAGGGGCACAGATGG - Intergenic
1137538846 16:49348245-49348267 TGTATTCCAAGGAGCACACTTGG - Intergenic
1141377676 16:83546994-83547016 TCAACTTCAAGGACCACAGTTGG + Intronic
1142746775 17:1963331-1963353 TCTCCTCCTGGGAGCTCAGCTGG - Intronic
1144223460 17:13121302-13121324 TCTACTACAAGCAGCACTGTAGG - Intergenic
1146442476 17:32909217-32909239 TCAACTCAGTGGAGCACAGTGGG + Intergenic
1148854331 17:50570458-50570480 CCCACTCCTAGGACCACAGCAGG - Intronic
1151683289 17:75633110-75633132 TTTACTCATTGGAGCAGAGTGGG - Intronic
1156235522 18:35199898-35199920 TCTACTCCTAGGCAAACAGGGGG + Intergenic
1157579684 18:48766297-48766319 TCTAGTCCAGGGACCACAGTGGG + Intronic
1158271583 18:55722162-55722184 TCTAGTCCTCGGCACACAGTGGG - Intergenic
1159974763 18:74697260-74697282 TCTCCTCATAGGAGCACAGGAGG - Intronic
1163493590 19:17631564-17631586 TCTGCTCCCAGCAGCACAGGAGG - Intronic
1167981419 19:53279555-53279577 TTTACTCCTAGGGACACGGTGGG + Intergenic
1167984672 19:53304130-53304152 TTTACTCCTAGGGACACGGTGGG - Intergenic
928356287 2:30619136-30619158 CCTACTCCTAGCAGCTCACTAGG - Intronic
930693230 2:54385867-54385889 TCTACTCCAAGGAACACATACGG - Intergenic
932352734 2:71044989-71045011 ACTACTCCTAATACCACAGTGGG - Intergenic
932702163 2:73999626-73999648 CCTCCTGCTGGGAGCACAGTAGG + Intronic
935240661 2:101175282-101175304 TTTACTCCTAGGAAGACAGATGG + Intronic
939360687 2:141168964-141168986 TTTATTCCTAAGAGCAAAGTTGG + Intronic
940096086 2:149977689-149977711 TATACTCCTGGCAGCAAAGTAGG - Intergenic
940202862 2:151170538-151170560 TATACAACTAGCAGCACAGTAGG + Intergenic
942551876 2:177128143-177128165 TCCACTCCAATGAGCACAGGAGG - Intergenic
946985306 2:225265484-225265506 TCTAGTCTTTGGAGCACAGTAGG + Intergenic
948056523 2:235012806-235012828 CCTGCTCCTTGGACCACAGTGGG - Intronic
1170047868 20:12105770-12105792 TCTAGTCCTAGGATCTCTGTTGG - Intergenic
1173367892 20:42404124-42404146 TCTTCTCCTGGGCACACAGTTGG + Intronic
1173398580 20:42703827-42703849 TCTATTTCTTAGAGCACAGTAGG - Intronic
1175233606 20:57492744-57492766 TCTAATTTTGGGAGCACAGTGGG + Intergenic
1178267185 21:31154421-31154443 TGTACTCTTCGGAGCACAGGGGG + Exonic
1179287608 21:39991478-39991500 TCTACTCCGAGGAGAGCTGTGGG + Intergenic
1181150636 22:20880876-20880898 GCTTCTCCCAGGAGCACAGTGGG - Intronic
1181277239 22:21694739-21694761 TCTCCTCCTAGCAGCAAAGGGGG - Exonic
1181597804 22:23928482-23928504 TCTACTCCTAGGAGCACAGTTGG + Intergenic
1183378018 22:37476361-37476383 ATTACTCCTAATAGCACAGTGGG - Intronic
953787400 3:45921450-45921472 GCCTCTCCTGGGAGCACAGTTGG - Exonic
956056675 3:65305976-65305998 TATACTACTGGCAGCACAGTAGG + Intergenic
961167252 3:124772017-124772039 TCTAGTCCTTGGGGCACACTAGG - Intronic
962342425 3:134596703-134596725 TCTGCTCCTCGGCACACAGTAGG - Intergenic
963300616 3:143593207-143593229 GCTCCTCCTGGGAGCACAGGTGG + Intronic
967446607 3:189574242-189574264 TCTACTCCTACTGGCACTGTAGG - Intergenic
968761702 4:2445528-2445550 CCTACTTATAGGACCACAGTGGG - Intronic
972442433 4:39107688-39107710 TCTACCCCTAGGAGTACAGTAGG + Exonic
974832637 4:67208260-67208282 ACAACTCCTAGGTGCACAGTGGG - Intergenic
977529326 4:98181690-98181712 TCTACTCCTACCAGCAATGTTGG - Intergenic
982163462 4:152593038-152593060 ACTACTCCTAATAGCACAGTGGG - Intergenic
984111727 4:175625309-175625331 ACTTCTCCTAGGACCACAGAAGG + Intergenic
985852167 5:2396944-2396966 TCTAATCCTTGGACCACACTTGG + Intergenic
988797550 5:34666224-34666246 AATACTCCTAGGCTCACAGTAGG + Intronic
989337396 5:40334670-40334692 TATATTCCTGGCAGCACAGTAGG + Intergenic
992266045 5:75019099-75019121 TCTCCTCTTATGAGCACATTGGG - Intergenic
994391155 5:99194825-99194847 ATTACTCCTAGTATCACAGTAGG - Intergenic
994391222 5:99195460-99195482 ATTACTCCTAGTATCACAGTAGG - Intergenic
994391256 5:99195839-99195861 ATTACTCCTACTAGCACAGTTGG - Intergenic
994391262 5:99195915-99195937 ACTACTCCTAGTTTCACAGTGGG - Intergenic
995645413 5:114305692-114305714 TCTTCTGCTAGTTGCACAGTAGG + Intergenic
997446135 5:133941700-133941722 ACTACTGGTAGAAGCACAGTTGG + Intergenic
997688069 5:135802825-135802847 ATTACTCCTAGTATCACAGTAGG + Intergenic
1000380690 5:160626725-160626747 GCTGCTCCGAGGACCACAGTTGG + Intronic
1003563871 6:7205883-7205905 TCTACTCCTAGATTCAAAGTAGG + Intronic
1004543360 6:16573037-16573059 GCTACTGCTAGGAACAGAGTAGG + Intronic
1009046806 6:58244135-58244157 ACTACTCCGAGTATCACAGTTGG + Intergenic
1009222620 6:60998439-60998461 ACTACTCCGAGTATCACAGTTGG + Intergenic
1009319646 6:62271353-62271375 TATACTACTGGCAGCACAGTAGG - Intronic
1010892988 6:81337132-81337154 TCTGTTCCTGAGAGCACAGTGGG + Intergenic
1010894998 6:81351282-81351304 TCTGTTCCTGAGAGCACAGTGGG + Intergenic
1016292392 6:142539350-142539372 TCTCTGCCTAGGAGCAGAGTTGG - Intergenic
1017443424 6:154485835-154485857 TCTGCTCCTATAAGCACTGTTGG - Intronic
1019713816 7:2529427-2529449 TCGTCTCCTTGGAGCAGAGTGGG - Intergenic
1022490935 7:30817118-30817140 TCATCTCCTGGGAGCTCAGTGGG - Intronic
1027450413 7:78325178-78325200 TATACTCTTAGGGGTACAGTGGG - Intronic
1029504097 7:100951630-100951652 TCTGCTCCTAGGGGAGCAGTGGG - Intronic
1032544108 7:132727657-132727679 TCTTCTCCAAGGAGCACAGTGGG - Exonic
1035039160 7:155914857-155914879 TCTACTTCAATTAGCACAGTGGG - Intergenic
1036548687 8:9797929-9797951 GCTACTCCTAATATCACAGTGGG + Intergenic
1038189849 8:25310108-25310130 TTTACCCCTAGGATCACAGATGG + Intronic
1038637234 8:29297307-29297329 ACTACTCCTAATATCACAGTGGG + Intergenic
1038637337 8:29298522-29298544 ATTACTCCTAATAGCACAGTGGG + Intergenic
1038738392 8:30193446-30193468 TATACAACTAGCAGCACAGTAGG - Intergenic
1040615852 8:49037657-49037679 TTTTCTCCTTGGAGCACAGCTGG + Intergenic
1040826526 8:51627151-51627173 TGTACTCCTAAAAGTACAGTTGG - Intronic
1041370502 8:57154717-57154739 TCTCTTCCTAGGATCACAGGTGG - Intergenic
1042158107 8:65866036-65866058 TCTCTGCCTAGGAGCAAAGTTGG - Intergenic
1044055554 8:87565786-87565808 TCTGCTCCTTGGAGTACGGTGGG + Intronic
1045810550 8:106215667-106215689 TCTACACCTAGCAGCTCAGGGGG + Intergenic
1046791329 8:118325320-118325342 CCTAATCCTAGAAGCAGAGTTGG + Intronic
1049115847 8:140686957-140686979 TCTATTCCAAGTAGCACAGATGG + Intronic
1058281233 9:103117408-103117430 TATACAACTGGGAGCACAGTAGG - Intergenic
1059958715 9:119544642-119544664 TCTCCTCCAAGGAGCAGAGCTGG + Intergenic
1060129715 9:121083738-121083760 TGTACACCTTGTAGCACAGTAGG + Intronic
1060472426 9:123959369-123959391 CCTCCTCCTAGGCTCACAGTAGG + Intergenic
1188568845 X:31557874-31557896 TCCACTCCTCGTAGCCCAGTGGG - Intronic
1189248614 X:39582406-39582428 TCCACTCCAAGGATCCCAGTGGG + Intergenic
1189534887 X:41925302-41925324 TCTGCTCATAGGATCACAGTTGG + Intergenic
1191762791 X:64663082-64663104 TCTAAGTCTAGAAGCACAGTTGG - Intergenic
1192656094 X:72996590-72996612 TCTACTCTGGGAAGCACAGTTGG + Intergenic
1192666026 X:73086411-73086433 TCTACTCTGGGAAGCACAGTTGG - Intergenic
1193359929 X:80569983-80570005 GCTCCTCCTGGGAGCACAGAGGG - Intergenic
1193936858 X:87633868-87633890 TCAACTCCTAGAAGCACAGTTGG + Exonic
1199810703 X:151345703-151345725 TCTAATCCCAGGAGCAGAGACGG - Intergenic