ID: 1181598045

View in Genome Browser
Species Human (GRCh38)
Location 22:23930408-23930430
Sequence CAGGCCCGCCTGCAGTTATC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181598042_1181598045 3 Left 1181598042 22:23930382-23930404 CCTCTTGTGGAGGGCCTGACATC 0: 115
1: 129
2: 63
3: 41
4: 120
Right 1181598045 22:23930408-23930430 CAGGCCCGCCTGCAGTTATCCGG No data
1181598040_1181598045 9 Left 1181598040 22:23930376-23930398 CCTCCACCTCTTGTGGAGGGCCT 0: 178
1: 123
2: 43
3: 46
4: 138
Right 1181598045 22:23930408-23930430 CAGGCCCGCCTGCAGTTATCCGG No data
1181598041_1181598045 6 Left 1181598041 22:23930379-23930401 CCACCTCTTGTGGAGGGCCTGAC 0: 177
1: 128
2: 50
3: 45
4: 117
Right 1181598045 22:23930408-23930430 CAGGCCCGCCTGCAGTTATCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181598045 Original CRISPR CAGGCCCGCCTGCAGTTATC CGG Intergenic
No off target data available for this crispr