ID: 1181599647

View in Genome Browser
Species Human (GRCh38)
Location 22:23941941-23941963
Sequence TCATATCAGCCAGAGATCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181599647_1181599648 -7 Left 1181599647 22:23941941-23941963 CCAGAGATCTCTGGCTGATATGA No data
Right 1181599648 22:23941957-23941979 GATATGAAAATTAGTCTCCTTGG No data
1181599647_1181599649 5 Left 1181599647 22:23941941-23941963 CCAGAGATCTCTGGCTGATATGA No data
Right 1181599649 22:23941969-23941991 AGTCTCCTTGGTCTGTTTGCAGG No data
1181599647_1181599650 6 Left 1181599647 22:23941941-23941963 CCAGAGATCTCTGGCTGATATGA No data
Right 1181599650 22:23941970-23941992 GTCTCCTTGGTCTGTTTGCAGGG No data
1181599647_1181599652 21 Left 1181599647 22:23941941-23941963 CCAGAGATCTCTGGCTGATATGA No data
Right 1181599652 22:23941985-23942007 TTGCAGGGCAGACCAGCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181599647 Original CRISPR TCATATCAGCCAGAGATCTC TGG (reversed) Intergenic
No off target data available for this crispr