ID: 1181606324

View in Genome Browser
Species Human (GRCh38)
Location 22:23982092-23982114
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 497
Summary {0: 2, 1: 0, 2: 3, 3: 35, 4: 457}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181606316_1181606324 14 Left 1181606316 22:23982055-23982077 CCAAGGGCACAGCTCATGGTGAG 0: 2
1: 0
2: 2
3: 26
4: 220
Right 1181606324 22:23982092-23982114 CAGGAAAAGGACAAGAGGTCAGG 0: 2
1: 0
2: 3
3: 35
4: 457
1181606312_1181606324 27 Left 1181606312 22:23982042-23982064 CCAATGCCATGGCCCAAGGGCAC 0: 2
1: 0
2: 1
3: 20
4: 158
Right 1181606324 22:23982092-23982114 CAGGAAAAGGACAAGAGGTCAGG 0: 2
1: 0
2: 3
3: 35
4: 457
1181606315_1181606324 15 Left 1181606315 22:23982054-23982076 CCCAAGGGCACAGCTCATGGTGA 0: 2
1: 0
2: 1
3: 10
4: 152
Right 1181606324 22:23982092-23982114 CAGGAAAAGGACAAGAGGTCAGG 0: 2
1: 0
2: 3
3: 35
4: 457
1181606313_1181606324 21 Left 1181606313 22:23982048-23982070 CCATGGCCCAAGGGCACAGCTCA 0: 2
1: 1
2: 0
3: 21
4: 267
Right 1181606324 22:23982092-23982114 CAGGAAAAGGACAAGAGGTCAGG 0: 2
1: 0
2: 3
3: 35
4: 457

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900359721 1:2282716-2282738 CAGGAAAAGGTCAGGAGGCTGGG + Intronic
900511061 1:3061439-3061461 CAGGACAAGGTCAGGAGGGCAGG + Intergenic
900937645 1:5776687-5776709 CTGGAAAAGGATCAGAGGTGTGG - Intergenic
901205728 1:7494819-7494841 AAATAAAAGGCCAAGAGGTCTGG + Intronic
901283183 1:8055740-8055762 GAAGAAAAGAAAAAGAGGTCGGG - Intergenic
901738173 1:11325424-11325446 CAGGAAAATGCCAATAGGACAGG - Intergenic
902417157 1:16246800-16246822 AAAGAAAAAGAAAAGAGGTCTGG - Intergenic
902713435 1:18256157-18256179 CAGGCAAAGACCCAGAGGTCAGG - Intronic
903252270 1:22063945-22063967 CAGGAAGATCATAAGAGGTCAGG - Intronic
903467309 1:23560539-23560561 CAGGAAAGGAACCAGAGGGCCGG + Intergenic
904781424 1:32952024-32952046 CAGGCAAATCACCAGAGGTCAGG - Intronic
905135031 1:35792502-35792524 AAGGAAAAGAAAAAGAGGCCAGG - Intergenic
906692525 1:47802021-47802043 CAGGACAAGAACAAAAGGCCCGG + Intronic
907378796 1:54067551-54067573 CAGGAAAAGGAAAAGAGGAAAGG - Intronic
908429077 1:64038215-64038237 CAGCAAGAGGACAGGAAGTCTGG + Intronic
908800308 1:67873169-67873191 CAGGAAGAGGACAAGATGAATGG - Intergenic
910490962 1:87770065-87770087 CAGGAAACTGACAAGATGCCAGG + Intergenic
910724273 1:90322266-90322288 GATGAAAAGGAGAAGAGCTCTGG - Intergenic
911273166 1:95828186-95828208 CATGAGAAGGCCAAGAGGTAAGG - Intergenic
911591460 1:99752897-99752919 CAGGAACAGGACAAGGGGGCTGG + Intronic
912915561 1:113811742-113811764 CAGGAAAACGGCGAGAGGACTGG - Exonic
913074575 1:115331015-115331037 CAGGAAAAGCACAGGAGGTCTGG - Intronic
913256129 1:116955526-116955548 CAGTAAAATGACATGATGTCTGG - Intronic
913503869 1:119497846-119497868 CAGGAAGCGCACAAGGGGTCAGG + Intergenic
914249327 1:145908614-145908636 CATGGGAAGGACAAGAGGCCTGG - Intronic
915968834 1:160337490-160337512 CAGGAAGACGACCCGAGGTCGGG + Intronic
916255132 1:162779438-162779460 CAGGAAAAGGATAATAGCTGGGG + Intronic
916591746 1:166197808-166197830 CAGAAAAGGGCCAAGAGTTCAGG - Intergenic
916754593 1:167756890-167756912 CAAGGAAAGGACAGGATGTCGGG + Intronic
917054451 1:170964430-170964452 CAAGAAAAGGTGAAGAGGTTTGG + Intronic
918129295 1:181611158-181611180 AAGGGAAAGGACAAAAGGGCTGG - Intronic
918189893 1:182163964-182163986 CAGCAGCAGGACAAGAGGTCAGG + Intergenic
918977257 1:191505759-191505781 GAGGGAAAGGAAAAGAGGTCTGG + Intergenic
919029658 1:192225275-192225297 CAGGAAAGGGAAAATAGCTCTGG - Intergenic
919260501 1:195187625-195187647 CAGGGAAAGGAAAAGAGGGATGG - Intergenic
919474962 1:198021539-198021561 CAAAAAGAGGACAAGAGGCCGGG - Intergenic
920170286 1:204067799-204067821 CAGGAAAAATACAAGAGGCCAGG + Intergenic
920309697 1:205041860-205041882 CTGGAAAAGGAGAAGGAGTCGGG - Intergenic
920460412 1:206135327-206135349 CAGGAAAGGGAGATGAGGTAGGG + Intergenic
921627327 1:217391393-217391415 CTGGAAAAGTACTAGTGGTCAGG + Intergenic
922898593 1:229119273-229119295 CAGGAGAAGGTCACGTGGTCAGG + Intergenic
923932428 1:238717186-238717208 CAGGAAAGGGAAATGAGATCTGG + Intergenic
924419145 1:243891132-243891154 CAGGGAAAGTAAAAGATGTCAGG + Intergenic
1063985077 10:11493765-11493787 CAGGAACAGGCCCAGAGGTCCGG - Intronic
1063985086 10:11493797-11493819 CAGGAGCAGGCCCAGAGGTCCGG - Intronic
1063985094 10:11493829-11493851 CAGGAGAAGGCCCAGAGATCAGG - Intronic
1063985100 10:11493861-11493883 CAGGAGCAGGCCCAGAGGTCAGG - Intronic
1064180581 10:13111173-13111195 GAGGAAAAGGGCAGGAGGTTGGG + Intronic
1064470506 10:15630540-15630562 CAGGGGAAGGACAACAGTTCAGG + Intronic
1064769151 10:18706117-18706139 CAGGCAAATGACCTGAGGTCAGG - Intergenic
1064773997 10:18755367-18755389 CAGGAGAATCACATGAGGTCAGG - Intergenic
1064938747 10:20709421-20709443 CGGGAAAATCACTAGAGGTCAGG + Intergenic
1065269832 10:24017285-24017307 CAGGAGAAGTCCTAGAGGTCAGG - Intronic
1066053446 10:31659059-31659081 CAGAAAAAGGACAGGCGGACTGG + Intergenic
1066442695 10:35454090-35454112 CAGGAAAAGTAAAAGCAGTCAGG - Intronic
1066561183 10:36671501-36671523 CAGGAAAATCACCTGAGGTCAGG + Intergenic
1067290211 10:44934633-44934655 CTGGAAAAGAGCCAGAGGTCAGG - Intronic
1067786976 10:49257569-49257591 AAGGAAAAAGACAAAGGGTCAGG - Intergenic
1067894640 10:50165773-50165795 CAGAACAAGGACAAGAATTCAGG + Intergenic
1068213253 10:53950585-53950607 CATGAAAAGGTCAACACGTCTGG - Intronic
1068420742 10:56788994-56789016 CAGAAAAAAGAAAAGAGGCCAGG - Intergenic
1068588812 10:58832431-58832453 CAGGCAGAGCACATGAGGTCAGG + Intergenic
1068630166 10:59289898-59289920 CAGGAAAAGCACTAGCAGTCTGG - Intronic
1068913716 10:62406155-62406177 CTGGAAAGGAGCAAGAGGTCTGG - Intronic
1068934705 10:62624384-62624406 CAGGAAAATCACTTGAGGTCAGG + Intronic
1070245970 10:74731405-74731427 CATGAGAAGGACATGAGATCTGG + Intergenic
1070280562 10:75045127-75045149 CAGGCAAATCACATGAGGTCAGG + Intronic
1070688896 10:78510341-78510363 TAGGAAAAGGATAGGAGGTGGGG - Intergenic
1071137357 10:82467627-82467649 CAGGAAGGGAACAAGAGGACAGG + Intronic
1071470352 10:85979806-85979828 CAGGAAGAGGCCAGGAGGACAGG + Intronic
1071731581 10:88253767-88253789 CAGGAAAATGCCAAGGGCTCTGG - Intergenic
1072133787 10:92523474-92523496 CAGGCAAATGACCTGAGGTCAGG + Intronic
1072196699 10:93122153-93122175 CACGAAACAGACAAGAAGTCAGG - Intergenic
1072972534 10:100029539-100029561 CAGGAAGATCACCAGAGGTCAGG + Intergenic
1074187991 10:111113569-111113591 TAGGAAGAGGAAAAGAGGGCTGG + Intergenic
1074508047 10:114088483-114088505 TAGGAAATGGACAGAAGGTCTGG - Intergenic
1075042986 10:119123390-119123412 CAGGAAGAGGAGAAGGGGGCAGG + Intronic
1075578180 10:123596205-123596227 GAGGAAGAGGACAAAGGGTCTGG + Intergenic
1075595705 10:123727672-123727694 CAGGAAAAGGACTAAAGGCTGGG - Intronic
1076006827 10:126954530-126954552 CAGGAAGAAGAAAAGAGTTCTGG - Intronic
1077379305 11:2221448-2221470 CTGGAAATGGTCAAGGGGTCAGG - Intergenic
1078249415 11:9604767-9604789 CAGGTAAATCACATGAGGTCAGG - Intergenic
1078397181 11:10991569-10991591 CAGGAAAAGGAGCATATGTCAGG + Intergenic
1078399977 11:11017629-11017651 CAGGAAAAGCACAAGGGATGGGG + Intergenic
1078605161 11:12768796-12768818 CAGGAAACTGACCTGAGGTCAGG + Intronic
1079730362 11:23933356-23933378 CAGGAAAAAGACAAAAGGGATGG - Intergenic
1080062747 11:27974314-27974336 GAGGAGTAGGACAAAAGGTCAGG - Intergenic
1080301988 11:30794810-30794832 CAGGACAAGGAAAAGAGATGGGG - Intergenic
1080309611 11:30874485-30874507 CGGGAAAAGGCCAAGAGGCAGGG + Intronic
1080321516 11:31015241-31015263 CAAGAAAAGGAGAATAGGCCTGG - Intronic
1081932066 11:46878499-46878521 CAGGCAAATCACTAGAGGTCAGG - Intronic
1081999156 11:47383509-47383531 GAGAAACAGGACAAGAGGTGAGG + Intergenic
1082556880 11:54573823-54573845 AAGAAAAAGCACAAGGGGTCAGG + Intergenic
1082937691 11:58671483-58671505 CATGACAGGGACAAGAGGTCAGG + Intronic
1082962274 11:58929811-58929833 GAGGAAAAGGAAATGAGTTCAGG - Intronic
1083472648 11:62894459-62894481 CAAAAAAAGAACAAGAGGCCGGG + Intergenic
1083549749 11:63578423-63578445 CAGGAAATGGAGAAAAGATCAGG + Intronic
1084195369 11:67521525-67521547 CAGGAAAGGGACAAATGGGCCGG - Intronic
1085259629 11:75196900-75196922 CAGGCAAATGACTTGAGGTCAGG + Intronic
1086912877 11:92493304-92493326 CAGCCAAAGGGCAAGAGCTCTGG - Intronic
1088078373 11:105879151-105879173 CTTGGAAAGCACAAGAGGTCAGG - Intronic
1088650090 11:111949850-111949872 CAGGAAAAGGTCAACAGGGAAGG - Intronic
1088675513 11:112188689-112188711 CAGGGAAAGGTCAAGAGGGAAGG - Intronic
1088748358 11:112823113-112823135 CAGGATATGGTCAGGAGGTCTGG + Intergenic
1088858296 11:113776508-113776530 CAGGAAAAGGCAAGGAAGTCAGG + Intergenic
1090112864 11:123934325-123934347 CTGGAAAAGGACAGGATTTCAGG + Intergenic
1090605722 11:128421414-128421436 CAGGCAGAGGACCAGAGCTCAGG - Intergenic
1090646892 11:128773553-128773575 CAAGAAAAGGAAAAGAGCTTTGG + Intronic
1091361392 11:134981084-134981106 CAGGACAAGGAAGTGAGGTCAGG - Intergenic
1091543889 12:1487625-1487647 CAGGAAGATCACATGAGGTCAGG + Intronic
1091848221 12:3674037-3674059 CAGGAAGAAGACAGGAGGACAGG + Intronic
1092259756 12:6946519-6946541 CAGGAAAAGGACAGGTGGGGCGG - Intronic
1092566509 12:9671695-9671717 CAGGAGAAGCACTAGAGGTATGG - Intronic
1092850308 12:12620104-12620126 CAGGAAAAGCAGAAAATGTCTGG - Intronic
1093422481 12:18990726-18990748 CTTGTAAAGGACCAGAGGTCAGG - Intergenic
1095326779 12:40904311-40904333 AAGGAAAAAGAGAAGAGGGCTGG - Intronic
1095979725 12:47964629-47964651 CAGGAAAAGAACAAGAGTGGCGG - Intronic
1096077933 12:48816418-48816440 CATGAAAAAGAAAAGAGGTTAGG + Intronic
1096231443 12:49898953-49898975 CAGGACAAGGGCAAGAAGTGGGG + Intronic
1097296243 12:57965960-57965982 CAGAAAAAGGAAAAGAGGAGGGG + Intergenic
1097637013 12:62134927-62134949 CAGGTAAAGGAGATGAGATCAGG - Intronic
1097697174 12:62786231-62786253 CAGGAACTGAACAAGAGGCCAGG + Intronic
1098499533 12:71174843-71174865 AAGGAAAAGCACAAGGTGTCAGG + Intronic
1098609731 12:72441503-72441525 AGGGAAAAGGACAGGAGGTGTGG + Intronic
1100282415 12:93130542-93130564 CAGGAAGAGGGAAAGGGGTCAGG - Intergenic
1102865935 12:116373990-116374012 CTGGAAAGGGACAGGAGGCCAGG + Intergenic
1103499156 12:121387405-121387427 CAGGAAGATCACATGAGGTCAGG + Intronic
1103512764 12:121486557-121486579 CAGGCAGAGCACATGAGGTCAGG + Intronic
1103539987 12:121659329-121659351 CAGGGAAAGGAACACAGGTCTGG - Exonic
1103643286 12:122370241-122370263 TGTGAGAAGGACAAGAGGTCGGG + Intronic
1103718308 12:122959504-122959526 TATGAAAAGGAAAAGAGGCCAGG - Intronic
1104041666 12:125134771-125134793 CTGGAAAGAGAGAAGAGGTCAGG - Intronic
1104106393 12:125663886-125663908 CAGGAAGATGACTTGAGGTCAGG + Intergenic
1105258448 13:18760713-18760735 TATGAAAAAGACAAGAGATCTGG - Intergenic
1105490771 13:20885709-20885731 CAGGAAGATCACATGAGGTCAGG + Intronic
1106816253 13:33410565-33410587 CAGGGAAGGGGCAAGAGGTCAGG - Intergenic
1108679047 13:52763624-52763646 CAGGAAAATCACTTGAGGTCAGG + Intergenic
1109610684 13:64761362-64761384 CAAAACAAAGACAAGAGGTCTGG + Intergenic
1111278139 13:85979840-85979862 CAGGAAAAGGTCAAGAGTTCAGG - Intergenic
1111738361 13:92171147-92171169 CAGCAAAAGGAAAAGAGGAAGGG - Intronic
1112167251 13:96932596-96932618 TAGGTAAAGGAAAAGAGGTCAGG + Intergenic
1112259543 13:97865384-97865406 CAGGAAAAGCACTTGAGGCCAGG - Intergenic
1114630649 14:24157498-24157520 TCTGCAAAGGACAAGAGGTCAGG - Exonic
1114693650 14:24607504-24607526 CAGGAACTGACCAAGAGGTCAGG + Intronic
1114804201 14:25815306-25815328 CAGGAAAAGCTCAGGAGGTCGGG - Intergenic
1115177540 14:30581409-30581431 CAGGAAAAGGAAAACTGGCCAGG + Intronic
1115614289 14:35078577-35078599 CAGGCAAATCACATGAGGTCAGG - Intronic
1116459009 14:45149593-45149615 CAGGAAAATCACTTGAGGTCAGG - Intronic
1116630367 14:47323396-47323418 CAGGAAGATCACTAGAGGTCAGG + Intronic
1116672412 14:47860509-47860531 CAGGACAAGGAGTAGTGGTCAGG + Intergenic
1116738773 14:48728736-48728758 AAGGCCAAGGACACGAGGTCAGG + Intergenic
1116852243 14:49919980-49920002 CTAGAAAAGGACAAGAAGTTTGG - Intergenic
1117386940 14:55224743-55224765 CAGGGAAATGACATGATGTCTGG - Intergenic
1117534905 14:56694510-56694532 GAGGAAAGGGACCAGAGGACAGG - Intronic
1118508725 14:66445901-66445923 CAGGTAAATGAGAAGAGGACGGG - Intergenic
1119264312 14:73255015-73255037 CAGGGTAAGGACAGGAGGGCAGG + Exonic
1119413782 14:74456122-74456144 CAAGAACAGGACAAGAAGCCAGG - Intergenic
1119446154 14:74665032-74665054 CAGGAAAAAGACAGAAGGTGAGG + Intronic
1120048280 14:79833966-79833988 CAGGCAGAGGAAAAGAGTTCTGG + Intronic
1120535812 14:85693220-85693242 AAGGAAAAGGAAAAGACGTATGG - Intergenic
1121584818 14:95055985-95056007 CAGGCAAATCACATGAGGTCAGG + Intergenic
1121888620 14:97568035-97568057 CAGGAACAGGACAAGGAGTAAGG - Intergenic
1122004710 14:98692636-98692658 CAGGGGAAGGACAAGAGGGAGGG - Intergenic
1122629457 14:103100645-103100667 AAGGAAACGGGCCAGAGGTCAGG + Intronic
1122881066 14:104690598-104690620 CAGGAACCGGGCCAGAGGTCAGG + Intronic
1122930166 14:104929495-104929517 CAGGACAAGGAAAAGAAGTGAGG + Intronic
1123141762 14:106086809-106086831 CAGGAAAAGGGCTTGAGGCCTGG + Intergenic
1123200222 14:106656457-106656479 CAAGAAAAGGGCTTGAGGTCTGG + Intergenic
1125178907 15:36859102-36859124 AAGGAAGAAGTCAAGAGGTCAGG + Intergenic
1125262155 15:37838920-37838942 CAGAAAGAGGACAAGAAGTCAGG + Intergenic
1125423281 15:39525759-39525781 CAGGAAAGGGACTAGAGGAAGGG + Intergenic
1126321495 15:47429028-47429050 AAGGAAAAGGACAGGAGGAAAGG + Intronic
1126672866 15:51132257-51132279 GAGGAAAAGGACAAGAAGCTGGG - Intergenic
1127476169 15:59335570-59335592 CTGGAAAAGTACAAGAGACCCGG + Intronic
1127604739 15:60574980-60575002 CAGGAGAAGAAGAGGAGGTCTGG + Intronic
1129003681 15:72354643-72354665 CATGAAAGGTACAAGAGGGCAGG + Intronic
1129505008 15:76073883-76073905 CAAGAACTGGACAAGAGGCCAGG - Intronic
1129545039 15:76386791-76386813 GAGTAATAGGACATGAGGTCAGG + Intronic
1129687038 15:77692354-77692376 CAGGAAGAGGACAAGGGGGCAGG + Intronic
1130236403 15:82138690-82138712 CAGGAAGAGGACAAGTGGCCTGG - Exonic
1130370309 15:83280698-83280720 CAGAAAAAGGACAACACTTCCGG + Intronic
1130686532 15:86042460-86042482 GAGAAAAAGGACAAGGTGTCTGG - Intergenic
1131514982 15:93071460-93071482 CTGGCCAAGGACAAGATGTCGGG - Intronic
1131851234 15:96545630-96545652 CAGGAAAAGGCCTAGAAGTTGGG - Intergenic
1131999452 15:98164071-98164093 CAGAAAAAGGACACGAATTCAGG - Intergenic
1133042697 16:3068902-3068924 CAGGAAAAGGCTGAGAGGCCTGG + Intronic
1133044741 16:3081545-3081567 CAGGAAAAGGCTGAGAGGCCGGG + Intronic
1133421091 16:5647564-5647586 AAGGGAAAGGAGAAGAGGTGGGG - Intergenic
1133440357 16:5816024-5816046 CAGTAAAAGGACAGCAGCTCTGG + Intergenic
1134855564 16:17515849-17515871 CTGGAAAAAGACAGGAAGTCTGG - Intergenic
1135119886 16:19756674-19756696 CAGGAGATGGTCACGAGGTCAGG + Intronic
1135353960 16:21754125-21754147 TAGGAAAATCACAAGAGGACAGG + Intronic
1135452449 16:22570264-22570286 TAGGAAAATCACAAGAGGACAGG + Intergenic
1135576783 16:23592181-23592203 CAAGAAAACGAAATGAGGTCAGG + Intronic
1135711385 16:24720391-24720413 CAAAAAAAGAAAAAGAGGTCAGG + Intergenic
1135934800 16:26770611-26770633 GAGGAAAAGGAGAAGAGGGAAGG + Intergenic
1137554766 16:49463592-49463614 GACGAAAGGGCCAAGAGGTCAGG + Intergenic
1137571770 16:49570986-49571008 CAGGAAAAGAGCAGGAGGGCTGG + Intronic
1138251189 16:55503053-55503075 CAGGCCAAGGAGCAGAGGTCAGG - Intronic
1139231805 16:65290619-65290641 CAAGAAGAGGAAAAGAGATCCGG + Intergenic
1140144289 16:72290366-72290388 CACCTAAAGGACAAGAGGTGGGG - Intergenic
1141891239 16:86928095-86928117 CAGCTAATGAACAAGAGGTCAGG - Intergenic
1143373925 17:6456401-6456423 CAGAAAAATGACAAGAGGCATGG - Intronic
1144748488 17:17632059-17632081 GAGGAAGAGGAGAAGAGGGCTGG + Intergenic
1144827446 17:18114102-18114124 AAGAAAAAGGACAAGAGGGAGGG - Intronic
1146759025 17:35460190-35460212 AAGGAAAAGGACTAGAAGGCTGG - Intergenic
1148743968 17:49908230-49908252 CAGGAGGAGGACAGGTGGTCAGG + Intergenic
1148906089 17:50913170-50913192 CAGGGAAAGGCAAAGGGGTCTGG - Intergenic
1149715504 17:58785535-58785557 CAGGAAAATCACTAGAGGCCAGG - Intronic
1150739205 17:67765934-67765956 AAGGCAAAGGAGAAGAGGTTGGG + Intergenic
1151917028 17:77125922-77125944 CAGGCAAATCACCAGAGGTCAGG + Intronic
1151993284 17:77592191-77592213 TTGCAAAAGGACAACAGGTCTGG - Intergenic
1152749565 17:82056430-82056452 CAGGACCAGGACAGGAGGCCAGG - Intronic
1153161651 18:2211994-2212016 CAGGAGAAGCACAACAGGCCTGG + Intergenic
1154406055 18:14092235-14092257 CAGGACCAGGATAAGGGGTCAGG + Intronic
1155371353 18:25104557-25104579 AAAGAAAAGGGCAAGAGGCCAGG - Intronic
1155574372 18:27228601-27228623 CAGGAAAAGGCCAACAGGCCAGG - Intergenic
1156488535 18:37482302-37482324 CAGGAAAAGAACAGGAAGTCAGG + Intronic
1156945420 18:42823866-42823888 CAGGAAAAGGATAAGATGATAGG - Intronic
1157199172 18:45644196-45644218 CAGGGAGAGGACATCAGGTCAGG - Intronic
1157556156 18:48614044-48614066 AAGGAAAAGGAAAAGAGGGAAGG - Intronic
1157919421 18:51699479-51699501 CATGTAAAGGAAAAGAGGTCTGG - Intergenic
1160527125 18:79544564-79544586 CAGGAAAAGGAAAAGCGGGGCGG - Intergenic
1160949726 19:1659690-1659712 CCTGAAAAGGACAAGGGGGCTGG - Intergenic
1161277039 19:3424253-3424275 CAGGAAAATCACTTGAGGTCAGG - Intronic
1162956816 19:14103306-14103328 CAGGAGAAGCCCAAGAGGTGGGG + Intronic
1163147907 19:15394404-15394426 CTGGAGGAGGACAAGAGGTTGGG + Intronic
1163812087 19:19439550-19439572 TAGCAAAAGGACAAGTGGTCAGG + Intronic
1163877838 19:19889865-19889887 TAGGAAAATCACATGAGGTCAGG - Intronic
1163921184 19:20290393-20290415 GAGAAAAAGGAGAAGAGGCCGGG - Intergenic
1164770583 19:30805638-30805660 GAGGAAAAGGGCATGAGGACCGG + Intergenic
1166395053 19:42433530-42433552 CAGGAAAAGGATAAGGGGCAGGG + Intronic
1166870583 19:45867986-45868008 CAGGAAGAGCAAAAGAGGTTAGG + Intronic
1166931851 19:46305738-46305760 GAGGCAAAGGCCAAGAGGTGAGG + Intronic
1167459712 19:49618369-49618391 AAAGAAAAGGAAAAGAGGTGAGG - Intronic
1167785544 19:51632805-51632827 CAGGGAAATGACCTGAGGTCAGG - Intronic
1167899035 19:52604666-52604688 CAGGAAAAACACCTGAGGTCAGG - Intronic
1168287023 19:55340214-55340236 CTGGAGAGTGACAAGAGGTCAGG - Intronic
926336872 2:11870230-11870252 CAGGAAAGGGACAGCAGGACTGG - Intergenic
927760163 2:25745438-25745460 CAGGTATATCACAAGAGGTCAGG - Intronic
927935568 2:27074138-27074160 CAAGGAAAGGACATGAGGCCAGG + Intergenic
928823822 2:35394574-35394596 CAGGAAAAGAACAAGTGCTGGGG - Intergenic
928962070 2:36937371-36937393 AAGAAAAAGAAAAAGAGGTCGGG + Intronic
929495253 2:42435733-42435755 AAGGAAAATGACAAGAGTTGGGG + Intergenic
930194622 2:48496836-48496858 CATGAAAAGCCCAAGAGGGCAGG + Intronic
930660871 2:54051815-54051837 CAGGAAAATCACCTGAGGTCAGG + Intronic
931590857 2:63881769-63881791 GAGGGAAAGGGCAAGAGGTGGGG - Intronic
932106692 2:68949713-68949735 CAGAAAAAGAACAATTGGTCAGG - Intronic
932864010 2:75322673-75322695 CAGGCAGAGGACTTGAGGTCAGG + Intergenic
933016529 2:77135178-77135200 CAGGAAATGGCCAAGATGTGAGG + Intronic
933946724 2:87293039-87293061 CAGGAAAATCACTTGAGGTCAGG - Intergenic
934274997 2:91567742-91567764 CAGGATCAGGACAAGAGGCAGGG + Intergenic
934554231 2:95278913-95278935 CAGGAACAAGACAAGCGGGCAGG - Intronic
934855974 2:97730518-97730540 CAGGAAAAGCAAGAGAGGGCAGG + Intronic
936538881 2:113334080-113334102 TAGGAGAAGGACAAGGGGTCAGG + Intergenic
938190394 2:129274288-129274310 CAGGAAAAGGAGCAGAGGACAGG - Intergenic
938553068 2:132398555-132398577 CAGGCAAAGCACTTGAGGTCAGG - Intergenic
938736339 2:134189893-134189915 AAAGAAAAGGAAAAGAGGCCAGG - Intronic
939610024 2:144298706-144298728 CAGGAAAGGGAGGAGAGGTCAGG + Intronic
939623617 2:144449758-144449780 CAGGAAAAGGACAAAAACTGGGG + Intronic
939690443 2:145253926-145253948 CAGGAAGAGGAGGAGAGGTTGGG - Intergenic
939882248 2:147643595-147643617 TGGGAAAAGGACAGGAGGCCAGG - Intergenic
940033584 2:149289991-149290013 CAGCAAAAGGAAGAGAGGTGTGG - Intergenic
940262879 2:151801371-151801393 CATAAAAAGGACAAAAGGTGTGG + Exonic
941145674 2:161841303-161841325 CAGGTAGAGGACTTGAGGTCAGG - Intronic
941771375 2:169349431-169349453 GAGGAGAAGGAAATGAGGTCAGG + Intronic
942787477 2:179716379-179716401 CAGAAAATGGAAAATAGGTCAGG - Intronic
942873276 2:180762184-180762206 CAGGATATGCACAAGAGGCCTGG + Intergenic
942944516 2:181657798-181657820 CTGGAAAAGGAGAAGAGCCCTGG + Intronic
943174804 2:184457097-184457119 CAGGAAAAGGAGTAGGGATCAGG + Intergenic
943426940 2:187749537-187749559 CAGGCACAGGACAAGAACTCGGG - Intergenic
943548771 2:189312543-189312565 CAGGAAGAGAGCAAGAGGACAGG + Intergenic
945880938 2:215324190-215324212 CAGAAACAAGACAAGAGGCCAGG - Intronic
946152381 2:217785301-217785323 CAGGAGACAGACAAGAGGCCAGG - Intergenic
946899868 2:224361917-224361939 TAAGAAAAGGACAAGAGACCAGG + Intergenic
948442352 2:238002462-238002484 CAGGAAGATCACCAGAGGTCAGG - Intronic
1169841638 20:9944361-9944383 AAGGAAAAAGAAAAGAGGACTGG + Intergenic
1170035722 20:11987571-11987593 GAGGAAAAGGAAAGGAGGGCAGG - Intergenic
1170082445 20:12491798-12491820 CCCGAAAAGCACAAGGGGTCAGG + Intergenic
1171077446 20:22142947-22142969 AAGGAAAAGGAGAAGAGGATGGG - Intergenic
1171725352 20:28613989-28614011 CAGGAAAATCACTAGAGGCCAGG - Intergenic
1171938925 20:31305291-31305313 AAGGAAAAGTCCTAGAGGTCAGG - Intronic
1172609144 20:36236517-36236539 CAGGAAAGGAAAAAGAGGCCAGG - Exonic
1172785593 20:37466314-37466336 CAGGAAAGGGAGAGGAGGTCCGG - Intergenic
1173318718 20:41968441-41968463 CCTGAGAAGGGCAAGAGGTCGGG - Intergenic
1174586654 20:51613857-51613879 CATCAGAAGCACAAGAGGTCAGG + Intronic
1175372570 20:58501859-58501881 GAGTAAAGGGACAAGAGGACAGG - Intronic
1176968155 21:15235143-15235165 CAGGCAAAAGAGAAGAGGGCAGG - Intergenic
1177049949 21:16220534-16220556 TAGGAATAGGAAAAGAGGTTTGG + Intergenic
1177191637 21:17858222-17858244 CAGCAGAAGTACAAGAGGCCAGG - Intergenic
1177424982 21:20911101-20911123 AAGGAAAAGGAAAAGAGAACAGG - Intergenic
1177618101 21:23551279-23551301 AAGAAAAATAACAAGAGGTCAGG - Intergenic
1177839006 21:26216071-26216093 CAAGAAAAGGACAAGGGGAAAGG - Intergenic
1177886627 21:26754941-26754963 CAGCAAAGAGACAAGTGGTCTGG + Intergenic
1177960086 21:27653398-27653420 CAGGAAATGGAATAGAGGACTGG + Intergenic
1178123793 21:29496033-29496055 CAGGAAAAGGATAAGAAGGAAGG - Intronic
1178691672 21:34755064-34755086 CAGGAAAAGGAGAAGAAGGAAGG + Intergenic
1180874890 22:19170614-19170636 CAGGAACAGGAGAAGGAGTCAGG - Intergenic
1181007096 22:20018850-20018872 CAGGCAAATCACCAGAGGTCAGG + Intronic
1181602185 22:23959215-23959237 CAGGAAAAGGACAAGAGGTCAGG - Intronic
1181606324 22:23982092-23982114 CAGGAAAAGGACAAGAGGTCAGG + Intronic
1181776221 22:25161751-25161773 CAGGAAAAGGAGAAGGGGAGGGG - Intronic
1182158465 22:28098258-28098280 GAGGAAATAGACAAGAGGCCAGG + Intronic
1182667995 22:31973023-31973045 CAGGAAAACCATGAGAGGTCAGG - Intergenic
1183063161 22:35347636-35347658 CAGGGAAGGGACAAGAGGCTCGG - Exonic
1183254602 22:36754220-36754242 ATGGAAGAGGACAAGAGGCCAGG + Intergenic
949835923 3:8269948-8269970 TAGGAAAAGGACAATAAGTTGGG - Intergenic
949894832 3:8761351-8761373 CAGGAAGAGCCCAAGATGTCAGG + Intronic
950055882 3:10024091-10024113 CAGGGAAAGAACAAGTGGGCTGG - Intergenic
951976454 3:28516011-28516033 CAGGAAGATGACTTGAGGTCAGG + Intronic
952869482 3:37885701-37885723 TAGCAAAGGGACAAGGGGTCTGG + Intronic
954057080 3:48035710-48035732 CAGGAGGAGCACATGAGGTCAGG + Intronic
954100309 3:48367384-48367406 CAGCAAAAGGCCAGGAGGCCTGG + Intergenic
954444117 3:50537443-50537465 CAGGAACTGGAGAAGAGGTGGGG + Intergenic
955675986 3:61449460-61449482 GAGGAAGAGGAAAGGAGGTCAGG + Intergenic
955760108 3:62271083-62271105 CAGGAAAAGTACAAGTGCTTTGG + Intronic
955803800 3:62713222-62713244 CAGGAGAAGGAGAAATGGTCTGG - Intronic
956642948 3:71431794-71431816 CAGGAAAAAGCCAGGAGGCCTGG - Intronic
957137763 3:76310944-76310966 CAGAAAAGGGAAAAGATGTCAGG - Intronic
957144528 3:76406512-76406534 AAGGAATAGGACAAGAGGGAAGG + Intronic
957853018 3:85835330-85835352 CAGGATAAGGCCAACAAGTCAGG - Intronic
959186185 3:103050619-103050641 AAGGAAAAGGAGGAGAGGTGAGG + Intergenic
959681256 3:109099168-109099190 CAGGAAAGGGTCAAGAGGACAGG + Intronic
959688130 3:109169926-109169948 CTGGAAAATCACAAGAGGTGAGG - Intergenic
960168884 3:114435542-114435564 CATGAAAAGCACATGAAGTCTGG - Intronic
960267806 3:115640737-115640759 CAGTGAAGGGTCAAGAGGTCAGG + Intronic
961183293 3:124893178-124893200 CAGGAAGATCACCAGAGGTCAGG + Intronic
961647843 3:128401896-128401918 AAGGACAGGGACAAGAGGTAAGG - Intronic
961717612 3:128869506-128869528 CAGGGAAAGAACAAGTGGGCTGG - Intergenic
962062361 3:131943657-131943679 CAGGAGAAGGACTAGAGGCTGGG - Intronic
962118339 3:132535593-132535615 CAGGAAAAGGAACAGAGGCCAGG + Intronic
962547919 3:136455985-136456007 CAAGAAAAAAACAAGAGGCCAGG + Intronic
962632060 3:137287828-137287850 CAGAAAGAGGGCGAGAGGTCAGG - Intergenic
963121167 3:141778240-141778262 CAGGGAAAGCACAAGAGGGCTGG - Exonic
963367359 3:144353468-144353490 AAAGAAAAGGACAGGAGGGCAGG - Intergenic
964168811 3:153742022-153742044 CAGGAAAATGGAAAGAGCTCAGG + Intergenic
964762523 3:160147740-160147762 CAGGAGAAGGGCTTGAGGTCAGG - Intergenic
965062146 3:163797566-163797588 CAGGAAAATCACTTGAGGTCAGG - Intergenic
965283809 3:166789651-166789673 CTGTAAAAGGACAAAAAGTCAGG + Intergenic
965540739 3:169869141-169869163 CAGGAAAATCACCTGAGGTCAGG + Intronic
966413242 3:179664544-179664566 CAGGGAGATGACAAGAGGACTGG + Intronic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
966983919 3:185162596-185162618 AATGAAAAGGACAAGAGCTTTGG + Intergenic
967345558 3:188451648-188451670 AAGGGAAAGGAGAAGAGCTCTGG + Intronic
967694899 3:192519175-192519197 CAGAAAAAGGACATGAGGGTGGG - Intronic
969381548 4:6802287-6802309 CTGGAAGAGGGCAAGATGTCGGG + Intronic
970137639 4:12943342-12943364 GAGGCAAAGGACAAAAGGTATGG + Intergenic
971394164 4:26213418-26213440 TAGGAAAATGAGAAGGGGTCAGG + Intronic
974359980 4:60865053-60865075 CAGGGAAAGGACAAGAAGAAGGG - Intergenic
975596810 4:76055068-76055090 TAGAAAAATGACAAGAGGCCAGG - Intronic
976235692 4:82894226-82894248 CAGTTAAAGCACAAGAGGACTGG - Intronic
977750413 4:100603195-100603217 CTGGAAAAGGAGAGGAAGTCAGG - Intronic
978130274 4:105187444-105187466 CAGGTGAAGTACAGGAGGTCAGG - Intronic
979641870 4:123017752-123017774 CAGTGTAAGGACAAGAAGTCAGG - Intronic
981490214 4:145331489-145331511 AGGGAAAAGGTCAAGAGGGCTGG - Intergenic
981891043 4:149737693-149737715 CACGGAAAGGGCAAGAGTTCTGG + Intergenic
981915951 4:150033417-150033439 CAAGAAAAGGACAAGAGAGCTGG - Intergenic
982042585 4:151409824-151409846 CAGGAAAAGGCAAAGAGATGTGG + Intronic
983772750 4:171571260-171571282 CAGGAAAAGGACAAGAGATGGGG + Intergenic
984091785 4:175384353-175384375 CAAGAAAAGGGCAAGAGGCCAGG + Intergenic
984792567 4:183628018-183628040 AAGGTAAAGGACAAGAGGAGCGG + Intergenic
985196286 4:187433263-187433285 AAGGAGAAGAACAAGAGGGCTGG - Intergenic
985707711 5:1411111-1411133 CAAGTCAAGGACAGGAGGTCTGG + Intronic
986110271 5:4709513-4709535 CCTGAGAAGGACAAGGGGTCAGG + Intergenic
986432232 5:7692682-7692704 GAGGACAAGGCCAAGGGGTCAGG - Intronic
987123949 5:14793584-14793606 CAGGCAAAGGACAAGCAGCCAGG + Intronic
987288066 5:16479564-16479586 GAGGTAAAGGAGAAGAGGACTGG - Intronic
987678217 5:21103463-21103485 CAAGAAAAAGACAATAGGACAGG + Intergenic
987769699 5:22284866-22284888 CAGGAAAAGGGAAAGAAGCCAGG + Intronic
988151776 5:27392130-27392152 AAGGTAAAGGATAAGAGGTAAGG - Intergenic
989405430 5:41056173-41056195 CAGGAAAAGGAGAAGAGACATGG + Intronic
992057589 5:73007072-73007094 AAGGAAAAGGACAAGAAGCAGGG - Intronic
995470106 5:112492314-112492336 GAGGACAAGGACAGCAGGTCTGG + Intergenic
995481477 5:112597416-112597438 CAGGAAGAAGACCAGAGGGCTGG - Intergenic
995485224 5:112633507-112633529 TAGACAAAGGACAAGAGCTCAGG + Intergenic
995647649 5:114330621-114330643 CAGGAAGAGGACAGGAGGCTTGG - Intergenic
995693699 5:114856637-114856659 AAGGAAAAGGAAAAGATGTGGGG + Intergenic
995714495 5:115068784-115068806 CAGAAAAAGGAGAAGAGGAGGGG - Intergenic
996337809 5:122403878-122403900 CAGGATAAGGAGAAGAGGGGAGG - Intronic
996494581 5:124139076-124139098 CATGAAAAGTACCAGAGGTCAGG + Intergenic
997702758 5:135915528-135915550 CAGAAAATGGACAATAGATCAGG - Intergenic
998055101 5:139068353-139068375 GTGGACAAGGACAAGAAGTCTGG + Intronic
999592046 5:153158838-153158860 CAGGAAAAGGAAAAGCAGGCGGG - Intergenic
999790254 5:154933168-154933190 GAAGAAAAGGAGAAGAGATCTGG - Intronic
1000225910 5:159261876-159261898 CAGGCAGATGACTAGAGGTCAGG - Intergenic
1000606288 5:163331048-163331070 AAGGATAAGGACAAGAGGGAGGG + Intergenic
1001045841 5:168370998-168371020 CAGGATAAGGATTAGAGGTGGGG + Intronic
1001233715 5:170011827-170011849 CTGGAAAAGGACAATATGGCTGG + Intronic
1001247443 5:170115302-170115324 CTGGAAAAGGGCATGAGGTAGGG + Intergenic
1002661437 5:180793175-180793197 CAGGAAAAGGCCAAGAGTGAGGG + Intronic
1002693328 5:181066143-181066165 CAGGAAAAGAACAAGAATTTGGG - Intergenic
1003071283 6:2947390-2947412 CAGGTAAAGGAGGAGAGGCCAGG + Intergenic
1004174264 6:13325433-13325455 CAGGCAAATCACTAGAGGTCAGG + Intronic
1005446562 6:25930112-25930134 CAGGAAAAGGAGAACATGGCCGG - Intronic
1005721607 6:28607802-28607824 CAGCAAAAGGACAGTAGTTCTGG - Intronic
1006104232 6:31706956-31706978 CAGGTAAGGGGCAAGAGGTACGG + Exonic
1006332000 6:33398284-33398306 CCAGAAACGGACAAGAGGCCTGG + Exonic
1006575030 6:35038779-35038801 CAGAAAAAGGAAAAGTGGCCAGG - Intronic
1007265629 6:40593714-40593736 CAGAAGAAGGCCTAGAGGTCAGG + Intergenic
1007586341 6:42992353-42992375 CAAGAAAAGGGCAAGGGGGCCGG - Intronic
1007689201 6:43687794-43687816 GCGGAAATGGACGAGAGGTCAGG - Intergenic
1008969900 6:57355423-57355445 CAGGAAACAGACAACAGGTATGG + Intronic
1009158865 6:60257233-60257255 CAGGAAACAGACAACAGGTATGG + Intergenic
1009480625 6:64154211-64154233 CAGGCAGATCACAAGAGGTCAGG + Intronic
1011209131 6:84936106-84936128 CTGGGGAAGCACAAGAGGTCAGG + Intergenic
1012847868 6:104412790-104412812 CAAGAGAAGGCCAAGAGGTGTGG + Intergenic
1013089672 6:106888766-106888788 CAGGCAGAGGACAGGAGGACAGG - Intergenic
1014271387 6:119340384-119340406 CAGAAATAGGACAGGAGGCCAGG - Intronic
1014747175 6:125213920-125213942 CAGAAAAATGACAAGAGTTAAGG + Intronic
1014897942 6:126926759-126926781 CAGGAAATTGAGAAGCGGTCGGG - Intergenic
1016038171 6:139404262-139404284 CAGGAGAATGGCAAGAGGCCGGG + Intergenic
1016332281 6:142966002-142966024 CAGGAGGAGGACAAGAGGTATGG + Intergenic
1016986710 6:149900814-149900836 CAGCAAAAGGAGAAGCAGTCTGG - Intergenic
1017451088 6:154555008-154555030 CATGAGAAAGACAAGAAGTCAGG - Intergenic
1017927763 6:158924819-158924841 AAGGAAAGGGACAAGAGGGAAGG + Intergenic
1022614769 7:31918032-31918054 CAGGAGATTTACAAGAGGTCGGG + Intronic
1023032744 7:36104960-36104982 CAGGAAAAAGAAATGAGCTCCGG - Intergenic
1023266802 7:38414889-38414911 CAGGCAAATCACATGAGGTCAGG - Intronic
1023504279 7:40884111-40884133 CAGGAAAAGAACCAAATGTCAGG - Intergenic
1023719288 7:43076653-43076675 CAGAAAAAGGAAAAGAGGAGGGG + Intergenic
1023807319 7:43882209-43882231 CAGGAAAATCACTTGAGGTCAGG + Intronic
1024442212 7:49433448-49433470 GCAGAAAAGGACCAGAGGTCTGG - Intergenic
1025260820 7:57416340-57416362 CACCAAAAGGACAACAGGCCTGG - Intergenic
1027027346 7:74863203-74863225 AAGAAAAAAGACAAGAGGCCAGG + Intergenic
1027060407 7:75080898-75080920 AAGAAAAAAGACAAGAGGCCAGG - Intergenic
1027475757 7:78629437-78629459 CAGGGAAATTACAAGAGATCAGG - Intronic
1028159032 7:87465087-87465109 CCCGAGAAGCACAAGAGGTCAGG + Intronic
1028790435 7:94847870-94847892 CAGGCAGATGACATGAGGTCAGG + Intergenic
1029380960 7:100214226-100214248 CAGGAAAAAGGCAAGGGGACTGG - Exonic
1029400336 7:100341173-100341195 CAGGAAAAAGGCAAGGGGACTGG - Intronic
1029654567 7:101915684-101915706 CAGCAGAAGGACTAGAGCTCAGG + Intronic
1030629843 7:111883711-111883733 CAGGAAAAGGTGATGTGGTCAGG + Intronic
1031305638 7:120123179-120123201 CAGGCAGATGACCAGAGGTCAGG - Intergenic
1031891020 7:127293704-127293726 AGGGAAAAGGACAAGATGGCTGG + Intergenic
1032160198 7:129503652-129503674 CAGGCAAAGCACCAGAGGTGAGG - Intronic
1032507064 7:132443536-132443558 CAGGAAATGGACAACAGGCCCGG - Intronic
1033507054 7:142014123-142014145 CAGGAAAAGTATAAAAGCTCAGG - Intronic
1036220815 8:6920610-6920632 CAGGACAAGGCAAAGACGTCAGG - Intergenic
1036456989 8:8918304-8918326 CAGGCAAATCACAGGAGGTCAGG + Intergenic
1036969118 8:13334328-13334350 GAAGAGAGGGACAAGAGGTCAGG + Intronic
1037456310 8:19067817-19067839 CAGAAAAAGGTCCAGAGGGCTGG - Intronic
1038139434 8:24827125-24827147 AAGAGAAATGACAAGAGGTCAGG + Intergenic
1038142595 8:24862987-24863009 CAGGACAAGGACATGTGCTCCGG - Intergenic
1039350512 8:36759029-36759051 CAGGAAGGGGACAAGAGTGCAGG - Intergenic
1040616376 8:49042060-49042082 CAGGCAAATCACTAGAGGTCAGG + Intergenic
1041309733 8:56503162-56503184 CAGGGAAAGGAGATGGGGTCTGG + Intergenic
1042070847 8:64931503-64931525 CAAGAGAAGCACAAGGGGTCAGG - Intergenic
1042240044 8:66654635-66654657 GAGGAAAAGGATTAGAGATCAGG + Intronic
1043427760 8:80165529-80165551 CAGGAAAAAGAGAGGAGGTTTGG - Intronic
1045648481 8:104321819-104321841 CAGGAAAAGGGCAAGGGGCATGG + Intergenic
1046304552 8:112346928-112346950 GAGGAAAAGGATAGGAGGCCTGG - Intronic
1046673428 8:117082843-117082865 CAAGACAAGGACAAGAGCTCAGG + Intronic
1047283042 8:123462273-123462295 CAGGCAGATCACAAGAGGTCAGG - Intronic
1047773303 8:128048385-128048407 AAGGAAAAGGACGGGAGGCCAGG - Intergenic
1047807766 8:128377542-128377564 CAGAAAAAGGAAAAGAGGAGGGG - Intergenic
1048138549 8:131770496-131770518 CAGGAAGAGGACAAGAGACCTGG - Intergenic
1048347522 8:133587769-133587791 AAAGAAAAAGAAAAGAGGTCTGG + Intergenic
1050013683 9:1210904-1210926 CAGAAGGAGAACAAGAGGTCAGG - Intergenic
1050527088 9:6555471-6555493 TAGGAAAAAAAAAAGAGGTCGGG + Intronic
1050998694 9:12252984-12253006 AAGGAATAGGATAAGAAGTCAGG + Intergenic
1051272746 9:15371325-15371347 GAGGAAGAGGACAAGAGGAAGGG - Intergenic
1051422815 9:16905486-16905508 TAAGAAAAGGGCAAGAGGTCGGG - Intergenic
1051444286 9:17124096-17124118 CAGCAAGAGGAGAAGAGGTCTGG + Intergenic
1051548659 9:18305087-18305109 CCGGGAAAGTACAAGTGGTCAGG + Intergenic
1052254438 9:26437603-26437625 AAGCAATAGGACAAGAGGGCTGG + Intergenic
1052857177 9:33414766-33414788 CAGGAGAAGGACAGGAGGTGTGG - Intergenic
1054718578 9:68581550-68581572 CAGGTAAATCACATGAGGTCAGG + Intergenic
1054910740 9:70453004-70453026 CAGGCAAATCACATGAGGTCAGG - Intergenic
1056935964 9:90914880-90914902 AAGGGAAAGGACAAGAAGTGGGG + Intergenic
1057863262 9:98658870-98658892 AAGGAAATAGACAAGAGCTCTGG + Intronic
1059238935 9:112786414-112786436 CAGAAAAGAGACAAGAGGCCAGG - Intronic
1059497107 9:114718982-114719004 CAAGAAAAACACAAGAGGTGGGG - Intergenic
1059841010 9:118216369-118216391 CAGGAAAGAGACAAGTGGACTGG + Intergenic
1059962504 9:119579133-119579155 CAGGAAAAGGACAGGAAGAGAGG - Intergenic
1060490473 9:124080441-124080463 AAGGAAAAGGAAAAGAAGTTAGG + Intergenic
1060776030 9:126375527-126375549 CAGGGAAAGGAAGAGACGTCAGG - Intronic
1062197575 9:135282786-135282808 CAGGAACAGCACAGGTGGTCAGG + Intergenic
1062444134 9:136586297-136586319 TAGGAAAAGGACAGGGGGTGGGG + Intergenic
1186430133 X:9498029-9498051 CAGGAAAGGGAAAATAGGCCTGG - Intronic
1186648187 X:11529962-11529984 CAGGAAAACTACAATAGGTATGG + Intronic
1188294279 X:28428269-28428291 CAGGAATAGAACATGAGCTCTGG - Intergenic
1189236719 X:39492646-39492668 CAGGAAAAGGAAAACTGATCTGG - Intergenic
1189489166 X:41456315-41456337 CAGGAAAAGGAGGAGAGGCCAGG + Intronic
1190189511 X:48265462-48265484 CAAGAAAAGGAAAAGAGATGGGG + Intronic
1190296323 X:49029903-49029925 CTGGAGAAGGACATGAGATCAGG - Exonic
1190785955 X:53649092-53649114 CTGGGAATGGACCAGAGGTCTGG + Intronic
1191011051 X:55759709-55759731 TAGGAAAATGAAAAGAGTTCAGG + Intergenic
1193086294 X:77449917-77449939 CAGGAAAGTGACAGGAAGTCAGG - Intronic
1193285090 X:79703774-79703796 CAGAAAAAGGCCAAGAAGTTAGG + Intergenic
1195681459 X:107550015-107550037 CAGGGAAAGGACAAGGAGACCGG - Intronic
1196327882 X:114429454-114429476 TATCAAAAGGACAAGAGGCCGGG - Intergenic
1196456252 X:115893400-115893422 CAGGAAAAAGACAAGAGACTGGG + Intergenic
1196859756 X:120015819-120015841 CAGGAAAAGGCTGAGCGGTCTGG + Intergenic
1198581295 X:138067625-138067647 CAGGAAAGGAAGAAAAGGTCAGG + Intergenic
1200134486 X:153868231-153868253 AAGGACGAGGCCAAGAGGTCTGG + Intronic
1201303599 Y:12531739-12531761 CAGGCAAACCACATGAGGTCAGG + Intergenic
1201705032 Y:16927888-16927910 CCTGAGAAGCACAAGAGGTCGGG + Intergenic