ID: 1181608860

View in Genome Browser
Species Human (GRCh38)
Location 22:23999365-23999387
Sequence TCATATCAGCCAGAGATCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181608857_1181608860 6 Left 1181608857 22:23999336-23999358 CCCTGCAAACAGACCAAGGAGAC No data
Right 1181608860 22:23999365-23999387 TCATATCAGCCAGAGATCTCTGG No data
1181608858_1181608860 5 Left 1181608858 22:23999337-23999359 CCTGCAAACAGACCAAGGAGACT No data
Right 1181608860 22:23999365-23999387 TCATATCAGCCAGAGATCTCTGG No data
1181608859_1181608860 -7 Left 1181608859 22:23999349-23999371 CCAAGGAGACTAATTTTCATATC No data
Right 1181608860 22:23999365-23999387 TCATATCAGCCAGAGATCTCTGG No data
1181608855_1181608860 21 Left 1181608855 22:23999321-23999343 CCTGGTGCTGGTCTGCCCTGCAA No data
Right 1181608860 22:23999365-23999387 TCATATCAGCCAGAGATCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181608860 Original CRISPR TCATATCAGCCAGAGATCTC TGG Intergenic
No off target data available for this crispr