ID: 1181614263

View in Genome Browser
Species Human (GRCh38)
Location 22:24041566-24041588
Sequence CTAGGTCTACACCAATATAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 56}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181614263 Original CRISPR CTAGGTCTACACCAATATAG TGG Intronic
906229014 1:44144664-44144686 CTACTTCTACACCAATAGAAAGG + Intergenic
911479945 1:98425852-98425874 ATAGCTCTAAACCAATATTGAGG + Intergenic
1068091461 10:52437741-52437763 TTAGGTCTGAACCAATTTAGTGG - Intergenic
1079699795 11:23530298-23530320 CTAGATCTATACCATTATTGGGG + Intergenic
1080088303 11:28313981-28314003 CTATTTCTACAGCAATTTAGTGG + Intronic
1089437350 11:118481595-118481617 CTAGGTATATACCAAAATAAAGG - Intronic
1091910401 12:4226214-4226236 CTAGTTCTGCAACAATAGAGTGG + Intergenic
1093145094 12:15555495-15555517 CTAAGTATCCACTAATATAGGGG - Intronic
1093283982 12:17234598-17234620 CCAGGTTTTCAACAATATAGCGG - Intergenic
1098003439 12:65969703-65969725 GTGGGTGTACACCAGTATAGAGG - Intergenic
1098862150 12:75722222-75722244 TTAGGTCCACAGCAATATCGAGG + Intergenic
1109077513 13:57856149-57856171 CTAGGTCTATAAAAATATATAGG - Intergenic
1117137906 14:52755936-52755958 CTAGGTCCACTCTAATCTAGAGG + Intronic
1120826034 14:88956446-88956468 CAAGGTCTCCACCTATATATAGG + Intergenic
1129003199 15:72351015-72351037 CCAGTTTTAGACCAATATAGGGG - Intronic
1143200595 17:5110754-5110776 ATAGGTCTCAACCAATTTAGGGG + Intronic
1146938818 17:36829390-36829412 CTACGTCCACACCAATACATGGG - Intergenic
1152928278 17:83097807-83097829 CTAGGTCATCACCAATGCAGGGG + Intergenic
1156278652 18:35610480-35610502 CTAGATCTACAGCAATAAACAGG - Intronic
1165466485 19:35977887-35977909 CGAGGTCCACACCAAAGTAGTGG - Intergenic
1165850454 19:38847495-38847517 CTGGGTCTACAACAGTACAGAGG - Intronic
940519121 2:154720375-154720397 CTATGTCTAGACCATTTTAGAGG + Intronic
944506702 2:200419687-200419709 CTAGCTCTACACCAAGTCAGAGG + Intronic
1180693669 22:17738555-17738577 CTAGGTCTGCACCAATAAAATGG - Intronic
1181614263 22:24041566-24041588 CTAGGTCTACACCAATATAGTGG + Intronic
958186234 3:90122844-90122866 CTGAGTCTATATCAATATAGTGG + Intergenic
965053745 3:163687272-163687294 CTAGGACTACTGAAATATAGTGG + Intergenic
966836840 3:184055927-184055949 TTAGGACCACACCAATATATTGG - Intronic
967551689 3:190802387-190802409 ATAGGTCTACATCAAAAAAGAGG + Intergenic
969954556 4:10875135-10875157 CTAGCCCCACACCCATATAGTGG - Intergenic
977071615 4:92396838-92396860 CTAGGTCAACACTACTATATTGG - Intronic
979167238 4:117550393-117550415 ATAGGTCTACACAAAAATCGAGG + Intergenic
981932263 4:150203394-150203416 CTTGGTATACACCAAGATAGTGG + Intronic
983455717 4:167961423-167961445 ATATGTCTACATCAAAATAGTGG + Intergenic
983894776 4:173070550-173070572 CTAGGCCTACCCCAGTACAGGGG - Intergenic
988060550 5:26162529-26162551 CTAAATATTCACCAATATAGAGG - Intergenic
988271918 5:29028029-29028051 CTATGTCTACACCACTCTAGTGG - Intergenic
992096742 5:73369910-73369932 CTAGGTCTACACAGGTTTAGGGG - Intergenic
992355357 5:75976863-75976885 CTAGCTCTATTCCAACATAGCGG + Intergenic
995607957 5:113878660-113878682 CTAAGTCTACAGAAATATAAAGG - Intergenic
996192183 5:120558643-120558665 CTAGGTATACACCAAGAGATAGG - Intronic
997415566 5:133725678-133725700 GAAGCTCTACACCAATATAAGGG + Intergenic
1000826087 5:166045606-166045628 CTAGGAATACACAAATATTGAGG - Intergenic
1004894446 6:20133737-20133759 TTAGGTCTAACCCAAGATAGAGG - Intronic
1004929868 6:20452513-20452535 TTAGGGCTGCACCAATAGAGTGG + Intronic
1011334204 6:86242302-86242324 CTGGGTATACACCCATATACTGG + Intergenic
1011334212 6:86242339-86242361 CTGGGTATACACCCATATACTGG + Intergenic
1011334220 6:86242376-86242398 CTGGGTATACACCCATATACTGG + Intergenic
1011334228 6:86242413-86242435 CTGGGTATACACCCATATACTGG + Intergenic
1011334236 6:86242450-86242472 CTGGGTATACACCCATATACTGG + Intergenic
1011334244 6:86242487-86242509 CTGGGTATACACCCATATACTGG + Intergenic
1011334252 6:86242524-86242546 CTGGGTATACACCCATATACTGG + Intergenic
1011334260 6:86242561-86242583 CTGGGTATACACCCATATACTGG + Intergenic
1011334268 6:86242598-86242620 CTGGGTATACACCCATATACTGG + Intergenic
1028168491 7:87567138-87567160 CTATGTTTGCACCAATATGGTGG + Intronic
1033832247 7:145268769-145268791 CTAAGTCAACAGCAATATATGGG - Intergenic
1041036292 8:53794095-53794117 ATAGCTCTACACCAACACAGCGG + Intronic
1186612838 X:11155207-11155229 CAAGTTCAACACCAATATACAGG + Intronic
1199246329 X:145609277-145609299 AAAGGACTTCACCAATATAGGGG + Intergenic
1201234266 Y:11894747-11894769 CTAGGTGTACAATAATAGAGAGG - Intergenic