ID: 1181615463

View in Genome Browser
Species Human (GRCh38)
Location 22:24051340-24051362
Sequence CCAGACCCGGGACTGTCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 142}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181615463_1181615474 23 Left 1181615463 22:24051340-24051362 CCCAGAGACAGTCCCGGGTCTGG 0: 1
1: 0
2: 1
3: 7
4: 142
Right 1181615474 22:24051386-24051408 TTTTCTCTCTAGGGCCACGTGGG 0: 1
1: 0
2: 0
3: 9
4: 93
1181615463_1181615471 14 Left 1181615463 22:24051340-24051362 CCCAGAGACAGTCCCGGGTCTGG 0: 1
1: 0
2: 1
3: 7
4: 142
Right 1181615471 22:24051377-24051399 AAGTCCATGTTTTCTCTCTAGGG 0: 1
1: 0
2: 1
3: 16
4: 239
1181615463_1181615473 22 Left 1181615463 22:24051340-24051362 CCCAGAGACAGTCCCGGGTCTGG 0: 1
1: 0
2: 1
3: 7
4: 142
Right 1181615473 22:24051385-24051407 GTTTTCTCTCTAGGGCCACGTGG 0: 1
1: 0
2: 1
3: 4
4: 91
1181615463_1181615470 13 Left 1181615463 22:24051340-24051362 CCCAGAGACAGTCCCGGGTCTGG 0: 1
1: 0
2: 1
3: 7
4: 142
Right 1181615470 22:24051376-24051398 CAAGTCCATGTTTTCTCTCTAGG 0: 1
1: 0
2: 1
3: 29
4: 255
1181615463_1181615475 24 Left 1181615463 22:24051340-24051362 CCCAGAGACAGTCCCGGGTCTGG 0: 1
1: 0
2: 1
3: 7
4: 142
Right 1181615475 22:24051387-24051409 TTTCTCTCTAGGGCCACGTGGGG 0: 1
1: 0
2: 1
3: 15
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181615463 Original CRISPR CCAGACCCGGGACTGTCTCT GGG (reversed) Intronic
900676544 1:3890741-3890763 CCGGACCCGGCACTGTGTTTTGG + Exonic
900682327 1:3923890-3923912 CCAGACCCTGGCGTGTCACTGGG - Intergenic
900964447 1:5948056-5948078 CAAGACCAGGTATTGTCTCTTGG - Exonic
902761919 1:18586762-18586784 CCAGGCCCGTGCCTGGCTCTAGG - Intergenic
903295680 1:22341920-22341942 CCAGCTCCGGGGCTTTCTCTGGG + Intergenic
904034488 1:27551484-27551506 CCAGGCTGGGGACTGTCCCTAGG + Exonic
904096176 1:27979284-27979306 CTATACCCAGGACTGTTTCTGGG - Intronic
904305460 1:29585892-29585914 CCAGCCCCAGGATGGTCTCTGGG + Intergenic
905119851 1:35673207-35673229 CTAGCCCTGGGTCTGTCTCTAGG + Intergenic
905311417 1:37051670-37051692 CCCCACCCGGGGCTCTCTCTGGG + Intergenic
907308517 1:53526663-53526685 CCGGCCCCAGGACTGTCCCTTGG + Intronic
907785274 1:57605405-57605427 CCAGACCCTTGACAGTTTCTGGG - Intronic
908750031 1:67413212-67413234 CCAGAGCTGGGAATGCCTCTGGG + Exonic
909823164 1:80092108-80092130 CCAGAGCTGGGAATGCCTCTGGG + Intergenic
911316803 1:96365705-96365727 CCAGTCCCAGTACTGTCTTTTGG - Intergenic
1063099226 10:2935018-2935040 CCAGACCCCAGACTGGCGCTGGG - Intergenic
1071799404 10:89042429-89042451 CCAGGCCTGGGACTCTCTTTAGG + Intergenic
1073025483 10:100484301-100484323 CCAGACCTGGGACTGTCCTAGGG - Intergenic
1074439001 10:113458707-113458729 TGAGACCCGGGTCTGGCTCTTGG - Intergenic
1075390617 10:122088473-122088495 CCAGGCCTGGGGCTCTCTCTGGG - Exonic
1077118503 11:896214-896236 CCAGACACGAAACTGTCTCAGGG + Intronic
1077118612 11:896644-896666 CCAGACACGAAACTGTCTCAGGG + Intronic
1078759635 11:14242007-14242029 CCTCACCCAGGACTGTCTGTAGG + Intronic
1078867062 11:15307702-15307724 CCAGCCAAGGGACTTTCTCTGGG + Intergenic
1081852321 11:46282253-46282275 GCAGACCCTGCACTGTCTCTGGG + Intronic
1082792881 11:57359372-57359394 CCAGACCAGAGACTGGCTCCTGG + Intronic
1083274477 11:61588825-61588847 CCATTCCCAGCACTGTCTCTGGG + Intergenic
1084711720 11:70847812-70847834 GCAGGCCCTGGACTGGCTCTTGG - Intronic
1086326025 11:85700509-85700531 ACATACCAGGGACTGGCTCTGGG + Exonic
1089682812 11:120128895-120128917 CCAGCCCAGGGAGTGTCTCGTGG + Intronic
1091564715 12:1639808-1639830 CCTGCCCCGGGACTGGCTGTGGG + Exonic
1092409419 12:8242697-8242719 CCAGACCCGGTTCCGTCCCTGGG - Intergenic
1097200273 12:57272539-57272561 GCAGAGCCGGGACTGGCTGTGGG + Intronic
1101863077 12:108498709-108498731 CCAGTCCCTGGACTCTCTCATGG + Intergenic
1102514650 12:113438115-113438137 CCAGACACAGGACTGTCCATGGG - Exonic
1103439839 12:120954965-120954987 CCAGACCAGGGACTGTAGATGGG + Intergenic
1104921852 12:132294701-132294723 GCAGACCCGGGGCAGCCTCTGGG + Intronic
1112343888 13:98575596-98575618 CCAGACCTGGGACTGCCTCTGGG - Intronic
1113697042 13:112354235-112354257 GCAGACCTGGCACAGTCTCTGGG - Intergenic
1114278539 14:21169481-21169503 CCAGGCCCGGGAGAGTCTGTGGG + Intergenic
1121080272 14:91102487-91102509 CCGGCCCCGGGACTGTCGATGGG + Intronic
1122178253 14:99936785-99936807 CCTGACCCTGGCCAGTCTCTGGG + Intronic
1126688272 15:51267055-51267077 CCAGAGCAGGGAATGTGTCTGGG - Intronic
1127304503 15:57691463-57691485 GCAGACCTGGGACTGACTCCAGG - Intronic
1127819661 15:62643899-62643921 GCTGTCCTGGGACTGTCTCTAGG + Intronic
1129016775 15:72475084-72475106 CCAGGCCCAGGCCTGTCCCTCGG - Intronic
1130951225 15:88590422-88590444 CCAGACATGGGTCTGTTTCTGGG + Intergenic
1131094898 15:89648835-89648857 CCAGACCTGGGACCGGCTCCTGG + Intronic
1132807339 16:1781207-1781229 CCAAACCTGGGCCTGTCTCCTGG - Intronic
1134257791 16:12626023-12626045 CCAGAGCCTGGACAGACTCTCGG + Intergenic
1135772688 16:25229229-25229251 CCAGACCCTGGACTCTGCCTGGG - Intergenic
1138497195 16:57415874-57415896 CCAGACTCCTGACTGTCTCCCGG + Exonic
1139435753 16:66935564-66935586 ACAGACCCGGGGCAGCCTCTGGG + Exonic
1141691270 16:85598061-85598083 CCTGACCCTGGACTGTTTCAGGG + Intergenic
1141996155 16:87637639-87637661 CCAGATCTGGGACTTTCTCGGGG + Intronic
1142029429 16:87831185-87831207 CCAGACCGTGGGCTGTCCCTTGG + Exonic
1142611000 17:1109194-1109216 CCCGACCCGGGACTGCATCCCGG + Intronic
1144702685 17:17349273-17349295 CCAGGCCCGGGGCTCTCCCTGGG - Intergenic
1147250379 17:39149700-39149722 CCAGACCCGGGCCTGGCTGAGGG - Intronic
1147847171 17:43412730-43412752 CCAGACCCGGAACTTTATCCTGG - Intergenic
1148687459 17:49508794-49508816 CCAGAGGCGGCACTGACTCTTGG - Intronic
1203183067 17_KI270729v1_random:83718-83740 CCAGACCAGGGAGTATCTCAGGG + Intergenic
1158479801 18:57811684-57811706 CCACAGCCGGGAATGTCTCATGG - Intergenic
1159274035 18:66192549-66192571 CCAGAAGCTGGAGTGTCTCTGGG - Intergenic
1161669181 19:5595245-5595267 CCAGCCCAGGCACTGGCTCTCGG + Intronic
1161925152 19:7294187-7294209 CTGCGCCCGGGACTGTCTCTCGG + Intergenic
1161993980 19:7701315-7701337 CCAGTCCCAGGATGGTCTCTGGG - Intronic
1164627930 19:29741654-29741676 CCAGACCAGGGACTGTCCTTAGG - Intergenic
1165994894 19:39836955-39836977 CCAGACCTGGGAGCGTCTCGAGG - Intronic
1166328633 19:42066188-42066210 CCAGTCCCGCCCCTGTCTCTGGG + Intronic
1166376005 19:42327405-42327427 CCAGATCAGGCACTTTCTCTGGG - Intronic
1166766435 19:45254177-45254199 CAACACCCGGGACTGTTGCTAGG - Intronic
1167463434 19:49638254-49638276 CCAGCTCTGGGACTGCCTCTGGG + Intronic
1168125992 19:54283181-54283203 TGGGATCCGGGACTGTCTCTGGG + Intergenic
1168237767 19:55074364-55074386 CCAGACCCGGTCCTGCCTCAGGG - Intronic
926086585 2:10023768-10023790 CCAGGCCCGGCTCTGTCCCTGGG + Intergenic
927276427 2:21266219-21266241 CCAGACCAGGAACTGTGTCCTGG + Intergenic
929572645 2:43032323-43032345 CCAGGCCCGGGGGTGTCCCTGGG - Intergenic
929959881 2:46488371-46488393 ACAGTCCCCTGACTGTCTCTGGG - Intergenic
932495546 2:72144223-72144245 CCACACCCGGGTCTCTCTCAGGG + Intronic
932800868 2:74741301-74741323 CCAGAGAAGGGACTGTCCCTGGG + Intergenic
946308220 2:218868181-218868203 CCAGACCAGGAACTGGCTCTGGG + Intronic
948772860 2:240260430-240260452 CCTGACCTGGGATTGTCTCTGGG + Intergenic
948990449 2:241551349-241551371 CCAGGCCCCGGCCTCTCTCTGGG - Intergenic
1172304409 20:33871094-33871116 CCAGGCCAGGGGCTGCCTCTGGG + Intergenic
1172445524 20:34991197-34991219 CCAGACAGGGGACCGTCTGTTGG - Intronic
1173423672 20:42925086-42925108 ACAGACCCGGGAATGCTTCTGGG - Intronic
1173815279 20:45983541-45983563 CCAGACTCAGGACTGGCTTTGGG - Intergenic
1174063254 20:47846901-47846923 CCAGACCAGGGACGGGGTCTTGG + Intergenic
1175263171 20:57687460-57687482 CCAGACCAGGGAGTGGCTGTAGG - Intronic
1176246649 20:64100566-64100588 CCAGCCCTGGGTCTGTCTCTGGG + Exonic
1180052134 21:45336055-45336077 CCGGACCCTGGGCTCTCTCTGGG - Intergenic
1180965176 22:19784457-19784479 CCAGACCCAGGGCCGTCTGTTGG + Exonic
1181103172 22:20555007-20555029 CGGGGCCCGGGACAGTCTCTGGG + Exonic
1181615463 22:24051340-24051362 CCAGACCCGGGACTGTCTCTGGG - Intronic
1184361859 22:44023903-44023925 CCTGCCCCGGGCCTGGCTCTTGG + Intronic
1184562858 22:45273491-45273513 CCCGACCCAGGACTGGCTCAGGG + Intergenic
1184849730 22:47113277-47113299 CCAGCCCAGTGACTGACTCTCGG - Intronic
1185110924 22:48899730-48899752 CCAGAGCAGGGCCTGCCTCTCGG + Intergenic
1185266263 22:49905964-49905986 CCACCCCCAGGACTGTCTCAAGG + Intronic
949944433 3:9178832-9178854 CTAGACCCGGAGATGTCTCTGGG + Intronic
950427960 3:12934858-12934880 CCAGACCCAGGGCTGTGTCTGGG - Intronic
952951313 3:38527740-38527762 TCAGACCAGGGACTGTCTGAGGG - Intronic
953325695 3:42010770-42010792 CCAGAACTGGGGCTGTCACTGGG + Intergenic
955058180 3:55474483-55474505 CCTGCCGCGGGACTGGCTCTGGG - Exonic
955364269 3:58298263-58298285 CCAGCCCCAGGACTGTCACCTGG - Intergenic
956671857 3:71698676-71698698 CCAGACCTGGGATTTTATCTGGG + Intronic
958041433 3:88230902-88230924 CCAGGCCCTTGACTGTCTCAGGG - Intergenic
964072924 3:152656808-152656830 CCAGAGCCGGGATTCTGTCTTGG - Intergenic
967637433 3:191819818-191819840 TCTGACCCAGGGCTGTCTCTGGG + Intergenic
968090661 3:195896363-195896385 CCAGACCCTGGAAGGTCACTAGG + Intronic
968963877 4:3759663-3759685 CCAGGCCAGAGTCTGTCTCTTGG + Intergenic
970462792 4:16292357-16292379 CCAGAGCTGGAAGTGTCTCTGGG + Intergenic
973201891 4:47513116-47513138 GCAGACCAGGGGCTGCCTCTGGG + Intronic
973643337 4:52925454-52925476 GAAGACCTGGGCCTGTCTCTAGG + Intronic
975812140 4:78180871-78180893 CCAGAACTGGGAATGCCTCTGGG + Intronic
977045584 4:92064903-92064925 CCAGAGCTGGGACTGACTTTGGG - Intergenic
978051858 4:104210850-104210872 CCAGACTCTGAGCTGTCTCTGGG + Intergenic
978706642 4:111721017-111721039 TCAGACCCAGCTCTGTCTCTGGG - Intergenic
986308803 5:6536012-6536034 CCTGACCAGGGACTTTCTATTGG + Intergenic
994180833 5:96764583-96764605 CCTGACCCCAGATTGTCTCTGGG + Intronic
998726901 5:145028050-145028072 AAAGACCGGGGAGTGTCTCTAGG + Intergenic
1006354779 6:33548793-33548815 CCAGCCCTGGGACTGACTGTAGG - Intergenic
1011222979 6:85077041-85077063 CCAGATCCTCCACTGTCTCTGGG - Intergenic
1015836836 6:137429573-137429595 CCAGTCCCTGGCCTGTCTCCAGG + Intergenic
1015842293 6:137488724-137488746 CCTGACCCCGGACTGTCTCGGGG - Intergenic
1017306942 6:152929464-152929486 CCAGTTCCGGGAGTGTCTCCAGG - Intergenic
1017680935 6:156863019-156863041 CATGACCCGGCACTGTCTCCAGG - Intronic
1024806053 7:53141460-53141482 CCAGACAAGGGAGTGTCTCAGGG - Intergenic
1026944561 7:74307319-74307341 CCAGACCCGGGTCTGATTCCAGG + Intronic
1030014119 7:105201397-105201419 CCACAGCCGGGGCTGTTTCTAGG - Intronic
1031369164 7:120943180-120943202 CAAGAACAGGGACTGTGTCTTGG + Intergenic
1034089790 7:148353085-148353107 CAGGACCCAGGGCTGTCTCTAGG - Intronic
1035249386 7:157587037-157587059 CCACACCATGCACTGTCTCTGGG - Intronic
1036062619 8:5341176-5341198 ACACACCGGGGACTGTCTTTGGG - Intergenic
1036750836 8:11443030-11443052 CCAGAGCCGGCAGTGGCTCTTGG - Intronic
1037902052 8:22694167-22694189 CCTGACCCGGCGCTGACTCTAGG + Intergenic
1037991024 8:23321289-23321311 CCAGGCCCGGGATGGCCTCTAGG + Intronic
1044360701 8:91280322-91280344 CGAGACCTGGATCTGTCTCTTGG + Intronic
1047185178 8:122626613-122626635 CAAGACTCAGGACTATCTCTAGG + Intergenic
1048311122 8:133323268-133323290 CCAGACTTGGGACTGACTCCTGG - Intergenic
1049618649 8:143588049-143588071 CCTGACCCAGGACACTCTCTCGG + Intronic
1049813373 8:144586374-144586396 CCAGAGCCGGGAGTGATTCTGGG - Intronic
1055761873 9:79617623-79617645 CCAGACCCAGGACTAAATCTTGG + Intronic
1057896536 9:98913313-98913335 CCAGACCCAGGAGAATCTCTGGG - Intergenic
1185498512 X:578681-578703 CCAGACCCAGGTCTTTCTCGGGG - Intergenic
1190212903 X:48461618-48461640 GCAGTCCTGGGACTGTCACTTGG - Intronic
1190445209 X:50517055-50517077 CAAAACCAGGGACTGTGTCTTGG + Intergenic
1195351101 X:103997572-103997594 CCAGACCCACAACTGTCTTTCGG + Intergenic
1196542143 X:116922423-116922445 CAAGTCCCGGGACTGGCTTTTGG - Intergenic
1199721278 X:150544333-150544355 CCAGTCCCGGGAGCCTCTCTTGG - Intergenic