ID: 1181618579

View in Genome Browser
Species Human (GRCh38)
Location 22:24071877-24071899
Sequence CACCCAGGGAGGGCAAGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 784
Summary {0: 1, 1: 0, 2: 10, 3: 67, 4: 706}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181618579_1181618589 21 Left 1181618579 22:24071877-24071899 CCACTCCTTGCCCTCCCTGGGTG 0: 1
1: 0
2: 10
3: 67
4: 706
Right 1181618589 22:24071921-24071943 ACTTGGAAACTTTCTTAATAAGG 0: 1
1: 0
2: 2
3: 15
4: 267
1181618579_1181618586 4 Left 1181618579 22:24071877-24071899 CCACTCCTTGCCCTCCCTGGGTG 0: 1
1: 0
2: 10
3: 67
4: 706
Right 1181618586 22:24071904-24071926 ACACACCACAGCCACTCACTTGG 0: 1
1: 0
2: 0
3: 16
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181618579 Original CRISPR CACCCAGGGAGGGCAAGGAG TGG (reversed) Intronic
900131645 1:1089725-1089747 CACCAAGGGCCGCCAAGGAGTGG + Intronic
900150695 1:1178079-1178101 CACTCAGGCGGGGCAGGGAGGGG + Intronic
900313084 1:2043810-2043832 CACCCAGGGGAGGCAGGGAAGGG - Intergenic
900379144 1:2375284-2375306 CACCCAGGGAGGGCCGGGCAGGG - Intronic
900427603 1:2587595-2587617 CACCCCCGCAGGGCAGGGAGGGG - Intronic
900510389 1:3056798-3056820 CGCTCAGGGAGGATAAGGAGGGG - Intergenic
900639559 1:3682190-3682212 GGCACAGGGAGGGCAAGGCGGGG + Intronic
900757916 1:4450139-4450161 GAGCCAGGGAAGGCCAGGAGGGG + Intergenic
901187531 1:7384805-7384827 GACCCTGGGTTGGCAAGGAGTGG + Intronic
901374313 1:8826600-8826622 CACTCTGGGAGGCCGAGGAGTGG + Intergenic
901480350 1:9520734-9520756 AGCACAGGGAGGGGAAGGAGGGG - Intergenic
901860628 1:12072309-12072331 CCCCCATCGAGGGCAAGGACTGG - Intronic
902206114 1:14869299-14869321 CACACAGGGAAGGCAATGAAAGG - Intronic
902371270 1:16008545-16008567 CACTTTGGGAGGCCAAGGAGGGG + Exonic
902891438 1:19447108-19447130 CACCCAGTGAGGGCTGGGATGGG - Intronic
903355428 1:22743716-22743738 CACTTAGGGAGGCCAAGGTGAGG - Intronic
903360683 1:22775211-22775233 CACACAGGCAGGGCTAGGACTGG - Intronic
903365975 1:22805626-22805648 GACCCAGGGTCAGCAAGGAGCGG + Intronic
903657768 1:24959495-24959517 CTCCCAGGGATGGCGGGGAGGGG + Intronic
903743725 1:25573150-25573172 CACCCAGGGTAGCCAAGGTGGGG + Intergenic
903868092 1:26412626-26412648 CACCCAGGCCGGGCAGGGAGGGG + Intronic
904081029 1:27872683-27872705 CACCAAGGGAGTGCTCGGAGGGG - Intronic
904330945 1:29757506-29757528 CACGCAGGGAGGGGAGGGACAGG - Intergenic
904341463 1:29837538-29837560 GTTCCAGGGAGGGCAAGGTGAGG + Intergenic
904454778 1:30641000-30641022 CAGCCAGGGAGGGACAGGAAGGG + Intergenic
904523238 1:31112408-31112430 CACTTTGGGAGGCCAAGGAGGGG - Intergenic
904558451 1:31380802-31380824 CACTTTGGGAGGCCAAGGAGGGG + Intergenic
904750295 1:32737631-32737653 CACCCAGGGAGGGCTAGCCTAGG - Intergenic
904772383 1:32887416-32887438 CACCCACTTAGGGCAAGGAGGGG - Intronic
904946295 1:34201044-34201066 TACCCAGGGAGGGATTGGAGGGG + Intronic
905104911 1:35558460-35558482 ACCCGAGGGAGGGAAAGGAGAGG + Intronic
905194513 1:36264965-36264987 GACACAGGGAAGCCAAGGAGAGG - Intronic
905222968 1:36461541-36461563 ATCACAGGGAGGGCAAGGAGAGG + Intronic
905378653 1:37543893-37543915 CACTTTGGGAGGGCAAGGGGGGG + Intronic
905395011 1:37661283-37661305 CACCCATGGAGGGAGAGGTGAGG - Intergenic
905825391 1:41022613-41022635 CTGCCCGGGCGGGCAAGGAGAGG - Exonic
906282799 1:44565757-44565779 CACCCAGGGAGGGGCAGGGAAGG - Intronic
906482096 1:46205825-46205847 CACCCAGGAAGGACAAGGGGTGG + Intronic
906792810 1:48673735-48673757 CAGCCAAGGAAGGCAAGGAAGGG + Intronic
907046849 1:51304867-51304889 CACCCTGGGAGGGCCAGGCAGGG + Intronic
907293365 1:53433035-53433057 CACCGAGTGAGGGCAAGGATGGG - Intergenic
907299439 1:53477373-53477395 CATCCACGGAGGTCAGGGAGAGG - Intergenic
907542509 1:55228774-55228796 CACCTTGGGAGGCCAAGGAGCGG - Intergenic
907672885 1:56492388-56492410 CACCCAGGGAGTGGAGGGACTGG - Intergenic
907999717 1:59668345-59668367 CACCAGGGCAGGGCAAGGGGAGG + Intronic
908477673 1:64505618-64505640 CGCCCAGGGAGGGGGAGGAACGG - Intronic
910116276 1:83735814-83735836 CACCCAGGCAGCCTAAGGAGAGG - Intergenic
910626857 1:89316510-89316532 TACCCAGGAAGTGTAAGGAGTGG + Intergenic
912536293 1:110375075-110375097 CACTCTGGGAGGCCAAGGCGGGG - Intronic
912572005 1:110631579-110631601 CAGCCAGGGAGTGCAAGAACGGG + Intergenic
912626860 1:111212682-111212704 CAGCCAGGGAGGCCAGGGAACGG - Intronic
912727331 1:112069756-112069778 CACCCAGGGAGGGGATGCTGGGG - Intergenic
912761470 1:112371181-112371203 AACTCAGCGAGGCCAAGGAGTGG - Intergenic
912799184 1:112710707-112710729 CTCCCAGAGAAGGCAAGGTGTGG + Intronic
913075428 1:115337695-115337717 CCCCCAGGTAGGGGGAGGAGCGG - Intronic
913088035 1:115457112-115457134 CACCAAGAGAGGGGAAGGGGAGG + Intergenic
913957531 1:143318920-143318942 GACCAAGGAAGGGCCAGGAGAGG + Intergenic
914051842 1:144144284-144144306 GACCAAGGAAGGGCCAGGAGAGG + Intergenic
914127355 1:144822257-144822279 GACCAAGGAAGGGCCAGGAGAGG - Intergenic
915339093 1:155166710-155166732 CGCCCAGGGCAGGCAGGGAGGGG - Intergenic
915477726 1:156162795-156162817 AACACAGTGAGGGGAAGGAGTGG + Intronic
915950780 1:160188660-160188682 GAGCCAGAGAGGGCAACGAGAGG + Intergenic
916181335 1:162086426-162086448 TACTCAGGGTGGGCAAGGAAGGG - Intronic
916260229 1:162834533-162834555 CATACAGGGAGGTCCAGGAGTGG + Intronic
916694245 1:167220771-167220793 CGCCCGGGGAGAGGAAGGAGCGG + Intergenic
916699377 1:167275269-167275291 CACTTTGGGAGGGCAAGGTGGGG - Intronic
916731673 1:167572163-167572185 CACCCAAGAAGTGCAAGGAGTGG - Intergenic
916878798 1:168998830-168998852 CACCCAGGAAGTGCAAGGGGTGG - Intergenic
917096812 1:171406472-171406494 CACTTTGGGAGGCCAAGGAGGGG - Intergenic
917111805 1:171556362-171556384 CACCCAGGAAGCACAAGGGGTGG - Intronic
917976958 1:180245873-180245895 CACCCAGTGAGGGCATGGGCAGG - Intronic
919082862 1:192887499-192887521 CTTCCAGGGAGGACAAGGTGTGG - Intergenic
919231362 1:194779204-194779226 CACCCAGGGGAGGCAATGAGTGG + Intergenic
919753886 1:201054576-201054598 GACGAAGGGAGGGGAAGGAGAGG + Intronic
919976639 1:202617086-202617108 AACCCAGGGAGGGAAAGCTGAGG - Intronic
920259206 1:204677566-204677588 CACCCAGGCAGTGAAAGGAAGGG + Intronic
920562447 1:206948356-206948378 CCCACAAGGTGGGCAAGGAGAGG - Intergenic
920924837 1:210331069-210331091 CACTTTGGGAGGCCAAGGAGAGG - Intronic
921926129 1:220711312-220711334 CCCCCAGGGAGGACAAGGTCAGG - Intergenic
921952734 1:220947956-220947978 TTCCCAGGGATGGCAAGGATGGG - Intergenic
922035671 1:221845766-221845788 CACTCAGAGGGGACAAGGAGGGG + Intergenic
922564382 1:226591966-226591988 GACACAGGGATGGGAAGGAGTGG + Intronic
922768087 1:228166270-228166292 CACCCGGGGAGGGCCGGGATGGG + Intronic
922933876 1:229409496-229409518 CACCCAGGGACGGCTCAGAGAGG - Intergenic
923239819 1:232072240-232072262 CACTCAGGGAGGCCAAGGCGGGG - Intergenic
923788560 1:237091668-237091690 CACTTAGGGAGGCCAAGGCGGGG - Intronic
923818168 1:237403669-237403691 CACTTTGGGAGGCCAAGGAGGGG - Intronic
924031511 1:239890067-239890089 CACTTTGGGAGGCCAAGGAGAGG + Intronic
1062769348 10:87028-87050 CACTTTGGGAGGCCAAGGAGGGG - Intergenic
1062801491 10:384658-384680 CACGCAGGGTGAGCATGGAGGGG + Intronic
1063045442 10:2387477-2387499 CATCCAGGGAGGGCAAGGCCTGG - Intergenic
1063071989 10:2675958-2675980 CACAAAGGGAGAGCCAGGAGTGG - Intergenic
1063373555 10:5537949-5537971 CACTTTGGGAGGCCAAGGAGGGG - Intergenic
1063454269 10:6172224-6172246 CACGTCGGGAGGGCAAGGTGTGG + Intronic
1064195041 10:13237531-13237553 CACTTCGGGAGGCCAAGGAGGGG - Intergenic
1064638034 10:17388434-17388456 CCCCCAGGGAAGGGAAGGAATGG + Intronic
1065286456 10:24191987-24192009 CACTTTGGGAGGCCAAGGAGGGG - Intronic
1065921010 10:30392735-30392757 CACCCAGGCAGGGCGAGGTAGGG + Intergenic
1065988928 10:30987713-30987735 CACCCAGGAAGGGCCATGTGAGG + Intronic
1066018748 10:31275190-31275212 CACACTGGGAGGCAAAGGAGGGG - Intergenic
1066204402 10:33173390-33173412 CACTTTGGGAGGCCAAGGAGGGG + Intergenic
1066615465 10:37289024-37289046 CACCCAGGAAGTGCAAGAAGTGG - Intronic
1066713014 10:38256274-38256296 GACCCAGGGAAGGGAAGGGGAGG - Intergenic
1067350899 10:45474749-45474771 CACCTAGAGCAGGCAAGGAGAGG + Intronic
1067568447 10:47354453-47354475 CTCCCAGGGAGGAGAAGCAGTGG - Intronic
1068866801 10:61903256-61903278 CTCCCGGGGAGGGCGGGGAGGGG + Intronic
1068924139 10:62517252-62517274 CACAAAGGGAGGTCAGGGAGGGG + Intronic
1069631080 10:69897362-69897384 TCCCCAGGGAGGGAGAGGAGAGG + Intronic
1069743805 10:70702287-70702309 GAACCAGGGACGGCAAGCAGCGG - Intronic
1069900635 10:71704894-71704916 CACCACCTGAGGGCAAGGAGGGG - Intronic
1069944227 10:71974849-71974871 GACCCAGGCAGGGAAGGGAGTGG - Intronic
1070308030 10:75251396-75251418 CACCTTGGGAGGCCAAGGAGGGG + Intergenic
1070605907 10:77898450-77898472 CACACAGGGAGCAAAAGGAGAGG + Intronic
1070749810 10:78957333-78957355 GACTCAGAGAGGACAAGGAGAGG - Intergenic
1070799165 10:79235077-79235099 CGCCAGGGCAGGGCAAGGAGTGG - Intronic
1070804637 10:79263920-79263942 CACCTGGGAAGGGTAAGGAGGGG + Intronic
1070813347 10:79309366-79309388 CACCCTGGGAGAGCAGGGAGGGG - Intronic
1071290516 10:84185612-84185634 CCCCCAGGATGGGGAAGGAGAGG - Intergenic
1071758861 10:88577347-88577369 CTCTCATGGAGGGCAATGAGAGG - Intronic
1072068270 10:91891445-91891467 CACTTTGGGAGGCCAAGGAGTGG - Intergenic
1072204967 10:93195532-93195554 CACCTTGGGAGGCCAAGGTGGGG + Intergenic
1072682489 10:97517116-97517138 CAGCAAGGGAGGGTCAGGAGTGG + Intronic
1072934656 10:99700602-99700624 CACCGAGGGAGGCCAATGACAGG + Intronic
1072956922 10:99895371-99895393 CACTCTGGGAGGCCAAGGCGGGG - Intronic
1073096799 10:100984820-100984842 CACACAGGAAGGGAGAGGAGGGG - Exonic
1073342149 10:102753418-102753440 CAACCTGGGAGGTCAAGAAGGGG + Intronic
1074165795 10:110872454-110872476 TTCCCAGGGAGGGCAGGGGGCGG - Intronic
1074517475 10:114183852-114183874 CACTTTGGGAGGCCAAGGAGTGG - Intronic
1074858201 10:117489110-117489132 CAGCCAGGGAGGCCAAGGAGAGG + Intergenic
1075371204 10:121936628-121936650 CACTTTGGGAGGCCAAGGAGGGG + Intergenic
1075442735 10:122492827-122492849 GACCCAGTTAGGGCAAGCAGAGG + Intronic
1076291781 10:129350968-129350990 GACCGAGAGAGGGCAAAGAGAGG + Intergenic
1076497332 10:130905607-130905629 CATCCAGGGAGGGGAGGGGGAGG - Intergenic
1076567499 10:131408929-131408951 CACTTTGGGAGGTCAAGGAGGGG - Intergenic
1076632117 10:131857582-131857604 GAGCCAGGGAGGGCAATGTGAGG - Intergenic
1076979024 11:195575-195597 CACCCAGGGTGGCCAAGGATGGG - Intronic
1077099824 11:817544-817566 CACTCTGGGAGGCCAAGGTGGGG - Intergenic
1077407004 11:2387138-2387160 CAGCCAGGGAGGGCTGGGGGTGG + Intronic
1077796258 11:5496067-5496089 CAATCAGGGAAGGCAAGAAGAGG - Intronic
1078121615 11:8516541-8516563 CACCCGGGAAGTGCAAGGGGCGG + Intronic
1078469133 11:11573083-11573105 AACCCAGGGCCAGCAAGGAGTGG + Intronic
1078792441 11:14558165-14558187 CACTCAGGGAGGCCACGGTGGGG + Intronic
1080642289 11:34165005-34165027 GACCCAGGGAGGGGGAGCAGGGG - Intronic
1080868422 11:36215212-36215234 CAGCCAGGGAGGAGCAGGAGTGG + Intronic
1081153941 11:39665663-39665685 CACTCTGGGAGGCCAAGGTGGGG - Intergenic
1081712389 11:45225729-45225751 CACACATGGAGGGCAAGGGCAGG + Intronic
1082002552 11:47401057-47401079 CAGCCAGAGCTGGCAAGGAGGGG + Intergenic
1082803791 11:57433594-57433616 CTCCCAGGGAGGGGTAGGGGAGG - Intergenic
1083479458 11:62934243-62934265 AGCCCAGGAAGGGCAGGGAGGGG + Intergenic
1083945247 11:65919656-65919678 GACGCGGGGAGGGCATGGAGGGG - Intronic
1084008740 11:66336275-66336297 CAGCCAGGTGGGGCAGGGAGGGG - Intronic
1084049755 11:66592067-66592089 CACGCAGGGAGGGCATGGATTGG + Exonic
1084312999 11:68327347-68327369 GACCCAGTGAAGGCCAGGAGGGG + Intronic
1084381641 11:68816604-68816626 CACCCCGGGGGGTCCAGGAGGGG - Intronic
1084438865 11:69159278-69159300 CCCCCAGGGTGGGCATGGAGTGG + Intergenic
1084742470 11:71148510-71148532 GACCCAGGGATGGCAGGGACTGG + Intronic
1084967571 11:72752460-72752482 CTCCCGGGGAGGGGAAGGTGGGG + Intronic
1085395884 11:76206871-76206893 CAACCTGGGACGGAAAGGAGAGG + Intronic
1085804198 11:79619469-79619491 CACCCAGGAAGAGCAAGGCAGGG - Intergenic
1086939749 11:92783112-92783134 CACTTAGGGAGGCCAAGGTGGGG + Intronic
1087139813 11:94754227-94754249 CAGTCATGGAGGTCAAGGAGAGG + Intronic
1088501913 11:110491563-110491585 CACTTTGGGAGGCCAAGGAGGGG - Intergenic
1088653288 11:111976980-111977002 CACCAAGGGAGGGCTCAGAGTGG + Intronic
1089127761 11:116189417-116189439 CAACCAGGGCTGGAAAGGAGAGG - Intergenic
1089269566 11:117292427-117292449 CACTCTGGGAGGCCAAGGCGGGG - Intronic
1089603029 11:119626732-119626754 CAGACAGGGAAGGCCAGGAGGGG + Intronic
1089603587 11:119629039-119629061 CTTCCAGGAAGGGCAAGAAGGGG + Intronic
1090043075 11:123307728-123307750 CACTCTGGGAGGCCAAGGGGAGG + Intergenic
1090393914 11:126406754-126406776 CACCCAGGGAGTGCAGGGGCAGG + Intronic
1090422993 11:126588514-126588536 GAGGCAGGGAGGGGAAGGAGAGG + Intronic
1090589214 11:128247082-128247104 GGCACAGGGAGGGAAAGGAGGGG - Intergenic
1091058840 11:132443269-132443291 CACACAGGGAGGACAAGGTGTGG + Intronic
1091848271 12:3674403-3674425 CACCCAGGGAGGGAATGAGGAGG + Intronic
1092458488 12:8665984-8666006 GAGGCAGGGAGGGCAGGGAGAGG + Intergenic
1092567770 12:9686110-9686132 CACCCAGGAAGCACAAGGGGTGG - Intronic
1093626914 12:21360596-21360618 CACCCAGGAAGCACAAGGGGTGG + Intronic
1095596129 12:43960272-43960294 GACCCAGGGAGGCCCTGGAGAGG + Intronic
1096185458 12:49577648-49577670 GAGACAGGGAGAGCAAGGAGAGG - Intronic
1096465559 12:51846461-51846483 GGCCCAGGCAGGGCAGGGAGGGG + Intergenic
1096652178 12:53067261-53067283 CACCCAGGGAGGGCAGGCAGGGG + Intronic
1097097555 12:56561764-56561786 CACTTTGGGAGGCCAAGGAGGGG - Intronic
1097117952 12:56712199-56712221 CACTTTGGGAGGCCAAGGAGGGG - Intergenic
1097666607 12:62484845-62484867 CACCAAGGAAGAGAAAGGAGTGG - Intronic
1097921341 12:65077812-65077834 TATCCAGGGAGCGCAAGGACAGG + Exonic
1097986603 12:65789033-65789055 GACCAAGAGAGAGCAAGGAGGGG - Intergenic
1098482497 12:70982029-70982051 CACCCTGGGTGGGCATGGCGGGG + Intergenic
1099513117 12:83562798-83562820 CACTCTGGGAGGCCAAGGTGGGG - Intergenic
1100296428 12:93266531-93266553 CACTCTGGGAGGCCAAGGTGGGG + Intergenic
1100365244 12:93914563-93914585 CAGAAGGGGAGGGCAAGGAGGGG + Intergenic
1100488946 12:95059459-95059481 CACTTTGGGAGGCCAAGGAGGGG + Intronic
1100594778 12:96062466-96062488 CACACAGAGAGAGGAAGGAGAGG + Intergenic
1100628441 12:96361260-96361282 CACCCTGGTAGGAAAAGGAGTGG - Intronic
1101120213 12:101571493-101571515 CACTTTGGGAGGCCAAGGAGGGG + Intronic
1101839335 12:108316626-108316648 CACCCGGTGTGGGCAGGGAGGGG + Intronic
1101940491 12:109096256-109096278 CACTTTGGGAGGCCAAGGAGGGG - Intergenic
1102257741 12:111425818-111425840 GCCCCAGGCAGGGCAAGGACAGG + Intronic
1102369795 12:112372988-112373010 CACTATGGGAGGGCAAGGAGTGG - Intronic
1103809943 12:123605311-123605333 AACCCAGGGTGGGCCAGGCGTGG - Intronic
1103870640 12:124088850-124088872 CAGAGAGGGAGGGCAAGAAGAGG - Intronic
1104436019 12:128757227-128757249 CCTCCAGAGAGGGGAAGGAGGGG + Intergenic
1105280031 13:18958020-18958042 CACCCAAGAAGGGCAAGGTAGGG - Intergenic
1105944172 13:25175648-25175670 GGCCCATGGAGGGCAAGGACAGG - Intergenic
1106336658 13:28789429-28789451 CACCCGGAAAGGGCAAGGATGGG - Intergenic
1106507596 13:30384833-30384855 CACTTTGGGAGGCCAAGGAGGGG - Intergenic
1106650789 13:31688107-31688129 CACCCACGAAGTGCAAGGAATGG + Intergenic
1107076940 13:36332244-36332266 CACTCTGGGAGGCCAAGGAGAGG + Intronic
1107140430 13:36992915-36992937 CTCCCAGGGAGGACAAGCAAGGG - Intronic
1107352654 13:39532088-39532110 CACCCAGGGAGAGGAACGAAGGG - Intronic
1108620270 13:52175974-52175996 CACTTTGGGAGGCCAAGGAGGGG + Intergenic
1108666728 13:52640185-52640207 CACTTTGGGAGGCCAAGGAGGGG - Intergenic
1110262344 13:73499724-73499746 CACTTTGGGAGGGCAAGGCGGGG - Intergenic
1111257243 13:85686535-85686557 CACTTTGGGAGGCCAAGGAGGGG - Intergenic
1111946636 13:94672134-94672156 CACTTTGGGAGGCCAAGGAGGGG + Intergenic
1112151837 13:96773043-96773065 CACCCAGGAAGTGCAAGAGGTGG + Intronic
1112317627 13:98377734-98377756 CACCATGAGAGGCCAAGGAGAGG - Intronic
1113034721 13:106036832-106036854 CACCCAAGGAAGGCAAGGGCAGG + Intergenic
1113539193 13:111093407-111093429 CCCCCATGGAGGGAGAGGAGGGG + Intergenic
1113841613 13:113364285-113364307 CACCCAGGGCGGGGGAGGGGCGG + Intergenic
1113841665 13:113364391-113364413 CACCCAGGGCGGGGGAGGGGCGG + Intergenic
1114225419 14:20733490-20733512 CATCCCTGGAGAGCAAGGAGAGG + Intronic
1114488961 14:23084190-23084212 CACTTTGGGAGGCCAAGGAGGGG - Intronic
1114695556 14:24623977-24623999 CACCCAGAAAGTGCAAGGAGTGG - Intergenic
1114771260 14:25430469-25430491 CACAGAGTGAGGGCAAGGACAGG + Intergenic
1115361154 14:32504523-32504545 CACCCTGGGAGGCCGAGGTGGGG - Intronic
1117173933 14:53129224-53129246 CACGGAGTGAGGGCAAGGACAGG - Intronic
1117195088 14:53331776-53331798 TACCCAGGGGGGCAAAGGAGGGG + Intergenic
1117617162 14:57545324-57545346 CACCCAGGAAGCTCAAGGGGTGG - Intergenic
1119662734 14:76463176-76463198 GACGCAGGGAGAGAAAGGAGAGG - Intronic
1119681090 14:76592787-76592809 CACTTTGGGAGGCCAAGGAGGGG + Intergenic
1119898736 14:78242641-78242663 CAGCCAGGGAGGCCAGGGACAGG - Intronic
1120271855 14:82322356-82322378 CACCCAGGAAGCACAAGGGGTGG - Intergenic
1121109395 14:91302441-91302463 GATCCAGGGAGGGCTAGGAGAGG - Intronic
1121193539 14:92049674-92049696 CACGGAGTGAGGGCAAGGACAGG + Exonic
1121597285 14:95174164-95174186 CACCATCGGAGGGCAAGGAAAGG - Intergenic
1122093406 14:99354392-99354414 CCCCTAGGGTGGGCAAAGAGGGG + Intergenic
1122507403 14:102240372-102240394 CACGGAGTGAGGGCAAGGACAGG - Intronic
1122625844 14:103085021-103085043 GGCCCAGGGAGGGCTAGGAGGGG - Intergenic
1123043994 14:105502673-105502695 CAGCCAGGCAGGGCAGCGAGAGG - Intergenic
1202930853 14_KI270725v1_random:31170-31192 GACCAAGGAAGGGCCAGGAGAGG - Intergenic
1123421506 15:20140242-20140264 GACCAAGGAAGGGCCAGGAGAGG + Intergenic
1123443549 15:20306273-20306295 GACCAAGGAAGGGCCAGGAGAGG - Intergenic
1123530732 15:21146782-21146804 GACCAAGGAAGGGCCAGGAGAGG + Intergenic
1124206257 15:27723596-27723618 CACCCAGGGAGGAGCAAGAGGGG + Intergenic
1124492292 15:30165459-30165481 AACCCAGGGAGGGAAAGCCGAGG - Intergenic
1124751243 15:32372858-32372880 AACCCAGGGAGGGAAAGCCGAGG + Intergenic
1125182032 15:36888528-36888550 CGCCCAGGGAAGGCCAGGTGAGG + Intergenic
1125494761 15:40181956-40181978 CACGCTGGGAGGCCAAGGCGGGG + Intronic
1125518287 15:40334994-40335016 GACCTTGTGAGGGCAAGGAGTGG - Exonic
1125730113 15:41888250-41888272 CATCCACGGTGGGCAAGGATTGG + Intronic
1127503293 15:59574789-59574811 CACTCTGGGAGGCCGAGGAGGGG - Intergenic
1127691254 15:61399578-61399600 CAACCAGAGAGGGCAGGGATCGG + Intergenic
1127862608 15:63006911-63006933 CACTGAGGGAGGGAAAAGAGAGG + Intergenic
1127865094 15:63026227-63026249 CACCCAGGTAGGGCCAGGGGTGG + Intergenic
1127867604 15:63044358-63044380 CCCCCAGGGAGGTAAAGGAAAGG - Intronic
1127891952 15:63260076-63260098 CACTTTGGGAGGCCAAGGAGAGG - Intronic
1127904449 15:63365891-63365913 CACTTTGGGAGGGCAAGGCGGGG + Intronic
1127961168 15:63891978-63892000 CCCCGAGGGAGGGCAGGGACTGG - Intergenic
1128389003 15:67170375-67170397 GGCCCAGGGAGGGAAAGTAGAGG + Intronic
1128435993 15:67648822-67648844 CACCTCGGGAGGCCAAGGCGGGG - Intronic
1128807259 15:70540208-70540230 CAAGCAGGGATGGCAATGAGAGG + Intergenic
1129373220 15:75110740-75110762 CACACAGGGAGGGCAGCGGGAGG + Intronic
1130017287 15:80197358-80197380 CACCCAGGGATGACAAGGCAAGG - Intergenic
1130262638 15:82369908-82369930 CACACAGAGTGGGGAAGGAGAGG - Intergenic
1130278589 15:82499039-82499061 CACACAGAGTGGGGAAGGAGAGG + Intergenic
1131068888 15:89451630-89451652 CACCAAGGGAAGGGAAGGATAGG - Intergenic
1131191957 15:90324053-90324075 CACTCTGGGAGGCCAAGGTGAGG + Intergenic
1131437977 15:92438175-92438197 CAGCCAGGGATGGCCAGAAGTGG - Intronic
1131953878 15:97710663-97710685 CAACCAGGGAGGGGCAGCAGAGG + Intergenic
1132250384 15:100331597-100331619 AACCCAGGCAGGGCCAGGGGAGG + Intronic
1132502653 16:291458-291480 CACCAAGGCAGGCCTAGGAGGGG - Intronic
1132552648 16:559854-559876 CGCCCAGGGAGGGCAAGGAAGGG + Intergenic
1132604035 16:786183-786205 CATCCAGGGAGGGCAGGAAGGGG + Exonic
1132635861 16:946202-946224 CAGCCAGGGAGGGCAAGGTGCGG + Intronic
1132746007 16:1436589-1436611 CACACAGGGAGAGGGAGGAGGGG + Intronic
1132877144 16:2144923-2144945 CAGCCAGCGAGGGCAAGGCGGGG - Intronic
1132894381 16:2221246-2221268 TACCCAGGGCTGGCAGGGAGGGG + Intergenic
1132908296 16:2295561-2295583 CTCCCAGGGAGGGCACGCACAGG - Intronic
1133002902 16:2860063-2860085 CACGCAGAGTGGCCAAGGAGGGG + Intergenic
1133117760 16:3587900-3587922 CCTCCGGGGAGGGCAAGGACAGG - Intronic
1133184302 16:4084478-4084500 CACTCTGGGAGGCCAAGGTGGGG + Intronic
1133236385 16:4389223-4389245 CACCTCGGGAGGGCCAGGAGAGG - Intronic
1133242861 16:4425967-4425989 CGCCCAGGGAGGGCGTGGTGGGG + Exonic
1133514510 16:6495374-6495396 CACTTAGGGAGGCCAAGGCGGGG - Intronic
1133771110 16:8867722-8867744 CACCCAGGGAGTGCAGAGGGCGG + Intronic
1134028177 16:10970647-10970669 CACTTTGGGAGGCCAAGGAGGGG - Intronic
1134447856 16:14344329-14344351 CACCCACGGAGGGAAGGGAATGG - Intergenic
1134480436 16:14614422-14614444 CACCCAGAGAGGGGCAGGAGTGG + Intronic
1134996979 16:18746996-18747018 CACTTTGGGAGGCCAAGGAGGGG + Intergenic
1135055186 16:19226265-19226287 CACCCAGGTAGGGCTAGAACTGG + Intronic
1135058296 16:19249373-19249395 GAGCCAGGGAGGGGATGGAGTGG + Intronic
1135989425 16:27208701-27208723 CACCCAGGGAGGCCAGGGATGGG + Intronic
1136100078 16:27987586-27987608 CACCCAGGGATGGCTATGAAAGG - Intronic
1136155566 16:28379938-28379960 CACCAGGAGTGGGCAAGGAGAGG + Intronic
1136207518 16:28735351-28735373 CACCAGGAGTGGGCAAGGAGAGG - Intronic
1136529721 16:30859927-30859949 CACGGAGTGAGGGCAAGGACAGG - Intronic
1136546052 16:30955457-30955479 CACTCAGGGAGGGCTGGGTGTGG - Intronic
1137444772 16:48525019-48525041 CACAGAGGGAGGGGCAGGAGTGG - Intergenic
1137494615 16:48960203-48960225 CACTTTGGGAGGCCAAGGAGGGG + Intergenic
1138475212 16:57266575-57266597 GACCCAGGGAGGTGAGGGAGGGG + Intronic
1138594109 16:58020381-58020403 CACTCAGGGAGGATGAGGAGTGG - Exonic
1139531158 16:67543291-67543313 CAACCAGGGAGGGCAGCCAGGGG + Intronic
1139835942 16:69838633-69838655 CTCCCAGGGATGGCAAGAGGTGG + Intronic
1141426920 16:83950060-83950082 CACCCAGGGAAGCAGAGGAGGGG + Intronic
1141498324 16:84425817-84425839 CACCCTGGCAAGGCAAGGGGCGG - Intronic
1141566303 16:84904337-84904359 CACTTTGGGAGGCCAAGGAGGGG + Intronic
1141732076 16:85829590-85829612 CACCCAGGGACAGGGAGGAGAGG + Intergenic
1141772264 16:86096493-86096515 CACCCAGGGAGGTGGCGGAGTGG - Intergenic
1141842427 16:86581823-86581845 CACAGATGGAGGGGAAGGAGTGG + Exonic
1142235515 16:88920776-88920798 CAAGCAGGCAGGGCAGGGAGGGG - Intronic
1142378788 16:89720684-89720706 CGCCCGGGGAGGGCGAGGACGGG - Intronic
1142466514 17:140393-140415 CACCCAGGGTGGCCAAGGATGGG - Intergenic
1142645042 17:1306051-1306073 CCGCCAGGGAGGGGTAGGAGTGG + Intergenic
1142800245 17:2340345-2340367 CACCTTGGGAGGCCAAGGCGAGG - Intronic
1143165945 17:4897357-4897379 AGCCCAGGGAGGGGAAAGAGGGG - Exonic
1143212156 17:5196391-5196413 CTCCAAGGGAGGGGAGGGAGAGG - Intergenic
1143498297 17:7324771-7324793 CTCCCAGGAAGGGCAGGGACAGG - Intronic
1143626290 17:8111989-8112011 CTCCCTGGGAGGGCTGGGAGAGG + Intronic
1143695470 17:8612603-8612625 CACTTTGGGAGGCCAAGGAGGGG + Intronic
1144435306 17:15234522-15234544 CAACAAGGGAGGGCAGGAAGGGG + Intronic
1144460872 17:15457757-15457779 CAGACAGGGAGGGCCAGGAGGGG + Intronic
1144633869 17:16891362-16891384 CACCCAAGGAAGGCACAGAGGGG - Intergenic
1144732632 17:17537379-17537401 CACCCATGGAGGGCAGGGGTTGG - Intronic
1144777165 17:17790789-17790811 CGCCTGGGGAGGGCAGGGAGCGG + Intronic
1145080893 17:19893420-19893442 CACGGAGTGAGGGCAAGGACAGG + Intergenic
1145267666 17:21388253-21388275 CACCCAGGGATGGGGAGCAGCGG + Intronic
1145296879 17:21599345-21599367 CACCCATGAAGGACCAGGAGAGG - Intergenic
1146169185 17:30620159-30620181 CACTTTGGGAGGCCAAGGAGAGG - Intergenic
1146170377 17:30627290-30627312 CACTTTGGGAGGCCAAGGAGAGG + Intergenic
1146293620 17:31631023-31631045 CACGGAGTGAGGGCAAGGACAGG + Intergenic
1146343829 17:32043313-32043335 CACTTTGGGAGGCCAAGGAGAGG + Intronic
1147007269 17:37413655-37413677 CACACTGGGAGGCCAAGGTGGGG - Intronic
1147322125 17:39652894-39652916 GACCTAGGCAGGGCAAGGGGTGG + Intronic
1147881978 17:43660186-43660208 CAACCAGGGAGGGCCTGGTGGGG + Intronic
1148793951 17:50188419-50188441 CACCCAGGCAGGGGGAGGAAAGG - Intronic
1148803830 17:50253328-50253350 GACACAGGGAGGTCAAAGAGAGG + Intergenic
1148911694 17:50946452-50946474 GGCCCAGAGAAGGCAAGGAGTGG - Intergenic
1150490195 17:65569025-65569047 CGGCCAGGGAGGAAAAGGAGAGG - Intronic
1150758450 17:67937681-67937703 GACCCAAGGAGGACAAGAAGTGG + Intronic
1150921896 17:69492678-69492700 CACCCAGAGAGGAGAAGGAGAGG - Intronic
1150936829 17:69644846-69644868 CACTTTGGGAGGCCAAGGAGGGG - Intergenic
1151552867 17:74832046-74832068 CAGCCAGGGGAGGCAGGGAGGGG + Intronic
1151675842 17:75596924-75596946 CACCCAGTGTCGGGAAGGAGTGG + Intergenic
1152277937 17:79369026-79369048 CACACAAGGAGAGCGAGGAGGGG + Intronic
1152285721 17:79411556-79411578 CACAGAGGGAGGGCATGGAAGGG - Intronic
1152738308 17:82008160-82008182 CACCCAGTGTGGGCATGGTGGGG + Intronic
1152900990 17:82941096-82941118 GACCAAGCGAGGCCAAGGAGGGG - Intronic
1153550462 18:6257185-6257207 CACACAGTGAGGGGAAGCAGTGG + Intronic
1153761043 18:8332703-8332725 CAACCAGAGAGGGCCAGGTGAGG + Intronic
1154234122 18:12587182-12587204 CACCTGTGGAGGTCAAGGAGTGG + Intronic
1154329959 18:13421529-13421551 CTCCCAGGCAGGGCAGGGATGGG - Intronic
1154330908 18:13428408-13428430 AACCTCGGGAGGGCAAGGGGAGG + Intronic
1154990708 18:21595716-21595738 CACTTTGGGAGGCCAAGGAGGGG + Intronic
1155341873 18:24821275-24821297 TTCCTTGGGAGGGCAAGGAGGGG + Intergenic
1155449952 18:25953146-25953168 CACTTTGGGAGGCCAAGGAGGGG - Intergenic
1155845049 18:30695380-30695402 CACACTGGCAGGGCAAGGAAGGG + Intergenic
1156376796 18:36521859-36521881 CTCCCTGGGATGGCAGGGAGTGG - Intronic
1157619552 18:49008479-49008501 GACCCAGGTGGGGCAGGGAGAGG - Intergenic
1157905156 18:51563228-51563250 CATCTAGGGAGGGTAGGGAGAGG + Intergenic
1158359076 18:56651497-56651519 CAGCCAAGGAGGACAAGGATAGG - Exonic
1158706283 18:59795255-59795277 CACCCAGGAAATGCCAGGAGAGG - Intergenic
1159560033 18:69983986-69984008 CTCCCAGGGGAGGGAAGGAGGGG + Intergenic
1159800341 18:72891019-72891041 AAGCCTGGGATGGCAAGGAGTGG + Intergenic
1159912980 18:74164084-74164106 AAGCCTGGGAGGGCAAGCAGTGG - Intergenic
1159915214 18:74182437-74182459 AACCCAGGGTGGGAAAGCAGGGG + Intergenic
1160568589 18:79801474-79801496 CACCCAGGCCCGGCAAGGAGGGG + Intergenic
1161174037 19:2829401-2829423 CACTCTGGGAGGCCAAGGCGGGG + Intronic
1161260975 19:3337552-3337574 CACCCAGAGAGGGCAACCAGGGG + Intergenic
1161346523 19:3771162-3771184 GGCCAAGGGAGGCCAAGGAGGGG - Intronic
1161677120 19:5657982-5658004 GACCCAGCGAGGGCACTGAGAGG + Intronic
1161835241 19:6641545-6641567 GACACAGGGAGGGCAGGGCGTGG - Intergenic
1161983566 19:7642680-7642702 CACTCAGGGGGGACAGGGAGAGG - Intronic
1162201789 19:9025655-9025677 CACTTTGGGAGGCCAAGGAGAGG + Intergenic
1162344336 19:10110855-10110877 CGCCCAGTGAGGGTATGGAGTGG + Exonic
1162741747 19:12777647-12777669 CATCTGGGGAGGGCAAGGCGCGG - Intronic
1162757882 19:12871151-12871173 CCGCCAAGGAGGGCCAGGAGAGG + Exonic
1162831122 19:13285276-13285298 CTCCCAGGGCAGGCAAGAAGCGG + Intronic
1162832944 19:13298561-13298583 CGCGGAGGGAGGACAAGGAGCGG - Exonic
1163128232 19:15255967-15255989 CACCCAATGAGGACAGGGAGGGG + Intronic
1163190068 19:15670874-15670896 GATCTAGGGAGGGCCAGGAGGGG + Intergenic
1163312285 19:16521708-16521730 CACCCAGGGTCTGCAAGGAGTGG + Intronic
1163390588 19:17027549-17027571 CACACGGGGAGGGGCAGGAGGGG - Intergenic
1163755785 19:19105505-19105527 CCCGCAGGGAGGGCAGGCAGAGG + Intronic
1163868565 19:19797197-19797219 CACACTGGGAGGCCAAGGTGGGG + Intronic
1164788581 19:30957293-30957315 CACCCTTGGAGGGCAAAGAGTGG + Intergenic
1164844868 19:31423417-31423439 GACCCAGGCAGGGCAATGATTGG + Intergenic
1166219157 19:41353969-41353991 CACCCAGGAAGCGCACGGGGCGG + Intronic
1166288765 19:41848517-41848539 CCCCCCGGGAAGGTAAGGAGAGG + Exonic
1166563291 19:43747706-43747728 CACCCAAGGGGGAGAAGGAGGGG - Exonic
1167041798 19:47027175-47027197 CACCCAGGGAAGTCGGGGAGAGG - Intronic
1167056274 19:47113049-47113071 CACCCAGGGCGGGCAGAGAAGGG - Intronic
1167614803 19:50526471-50526493 CCTCCAGGGAGGGCAGGGACTGG + Intronic
1167685409 19:50952846-50952868 CCTCCAGACAGGGCAAGGAGGGG + Exonic
1167694858 19:51009378-51009400 CAGGCTGGGAGGGCAGGGAGAGG + Intronic
1168283702 19:55320220-55320242 GACCCAGGGAGGGAAGTGAGGGG + Intronic
1168677822 19:58291719-58291741 CACCTGGGGAGGGCAAGATGGGG + Intronic
1202691240 1_KI270712v1_random:96708-96730 GACCAAGGAAGGGCCAGGAGAGG + Intergenic
925326983 2:3030738-3030760 CACCCGGGAAGTGCAAGGAAGGG + Intergenic
925469171 2:4140455-4140477 CTCCCAGGGAGGGCAGGGAGAGG - Intergenic
926055132 2:9769899-9769921 CTATCAGGGAGGGCAAGCAGAGG + Intergenic
926086468 2:10023303-10023325 CAGCCAGGGAGAGCCAGGTGGGG - Intergenic
926387804 2:12354604-12354626 GACAAAGAGAGGGCAAGGAGTGG - Intergenic
926483525 2:13428051-13428073 CACCCAGGAAGTGCAAGGAGCGG - Intergenic
926635122 2:15170317-15170339 CTGGCAGGGAGGGCAAGGGGTGG + Intronic
926773759 2:16401994-16402016 CACCAAGAGAGGCCAAGAAGAGG - Intergenic
926812183 2:16765073-16765095 AGCACAGGGAGGGCCAGGAGAGG - Intergenic
927617903 2:24618684-24618706 CACCCAGCAAGGGCAAGGTATGG - Intronic
927638682 2:24833521-24833543 GACACAGGGAAGGCAAGGAAGGG - Intronic
928259531 2:29754401-29754423 AACTCAGTGAGGGCAAGCAGGGG - Intronic
928399962 2:30970748-30970770 GGCCCAGGGAGGGCAGGTAGTGG + Intronic
928414462 2:31079896-31079918 CTCCCAGGGAAGGCAAGGGCTGG + Intronic
928462616 2:31489266-31489288 CACCCAGGAAGCACAAGGGGTGG + Intergenic
928519599 2:32075797-32075819 CACTTTGGGAGGCCAAGGAGGGG - Intronic
929220657 2:39461890-39461912 CACTTTGGGAGGCCAAGGAGTGG + Intergenic
929453931 2:42053455-42053477 CACCCAGGGAGAGGGAGGGGAGG + Intronic
929635062 2:43511337-43511359 CACTCAGGGAGGCCCAGGGGAGG - Intronic
929958371 2:46477908-46477930 CACCCGGGAAGTGCAAGGGGTGG - Intronic
930199619 2:48540528-48540550 CACCCAGGCAGAGCATGGAAGGG + Intronic
931028112 2:58136628-58136650 CACTTTGGGAGGGCAAGGTGGGG - Intronic
931551928 2:63456169-63456191 CACTCTGGGAGGGCAAGGCAGGG + Intronic
932704453 2:74012206-74012228 CACTTTGGGAGGCCAAGGAGGGG - Intronic
932868738 2:75374840-75374862 CACCCAGGAAGTGCAAGGGTTGG - Intergenic
933709769 2:85316349-85316371 CACCCAGGCAGGCCCAGGGGAGG - Intergenic
933713293 2:85343414-85343436 CACCCAGGCAGGCCCAGGGGAGG + Intronic
933777406 2:85779382-85779404 CACACAGGCAGAGCATGGAGAGG + Intronic
933843825 2:86309160-86309182 CACCCAGGGAGTGACAGGAGCGG - Intronic
933955149 2:87357242-87357264 GACCAAGGAAGGGCCAGGAGAGG - Intergenic
934239340 2:90253457-90253479 GACCAAGGAAGGGCCAGGAGAGG - Intergenic
934273846 2:91563242-91563264 GACCAAGGAAGGGCCAGGAGAGG + Intergenic
934461782 2:94216810-94216832 GACCAAGGAAGGGCCAGGAGAGG - Intergenic
934764915 2:96875284-96875306 AACCCAGGAAGGGTCAGGAGGGG + Intergenic
934917266 2:98310310-98310332 GACCCCAGGAGGGCATGGAGTGG + Intronic
935057045 2:99576896-99576918 CCCCCAGGGAGGGCATGGAGTGG - Intronic
935281170 2:101519040-101519062 CGCCCAGGGAGGGGAGGGAGGGG - Intergenic
935561633 2:104565857-104565879 CACTTTGGGAGGCCAAGGAGAGG + Intergenic
935565917 2:104607516-104607538 TACCCAGGAAGTGCAAGGGGTGG + Intergenic
937111396 2:119369209-119369231 CTTCCAGGGAGGGGAAGGAAAGG + Intronic
937249271 2:120512905-120512927 CACTTTGGGAGGCCAAGGAGGGG + Intergenic
937274290 2:120674114-120674136 CAACCAGGAAGGACAGGGAGTGG + Intergenic
937702628 2:124881369-124881391 TACCCAGGGAAGGAATGGAGAGG + Intronic
938115710 2:128601948-128601970 CACACAGTGCTGGCAAGGAGGGG - Intergenic
938125107 2:128665462-128665484 GACCCAGGAAGGGCAGGGACAGG - Intergenic
938368887 2:130756435-130756457 CCCCCGGGGAGGGCAAGGATTGG + Intronic
938723124 2:134084070-134084092 CACCCAGGGGAGGCAAGAATGGG + Intergenic
938949587 2:136244251-136244273 CCCCCAGGGAGGGCCGGGGGTGG + Intergenic
940030838 2:149259576-149259598 CACCCAAGGAAGCCAAGGTGGGG + Intergenic
942322984 2:174752116-174752138 CACCCCGGGAGGCCAAGGCAGGG + Intronic
942584971 2:177465843-177465865 GCCCCATGGAGGGCAACGAGAGG - Intronic
943097012 2:183441494-183441516 CAGTCAATGAGGGCAAGGAGAGG - Intergenic
943240458 2:185377282-185377304 TACCCGGGAAGTGCAAGGAGCGG - Intergenic
943729902 2:191291498-191291520 CACCCAGGAAGGGAAAAGAAAGG - Intronic
944156634 2:196613906-196613928 CACTTTGGGAGGCCAAGGAGGGG - Intergenic
945046566 2:205787153-205787175 GACCCAGGGAGGTCAATGACTGG + Intronic
946400954 2:219468277-219468299 CATCCAGGGTGGGCAGGGTGAGG + Intronic
946427074 2:219605073-219605095 CACTCTGGGAGGCCAAAGAGGGG - Intronic
946865509 2:224038824-224038846 GACCCGGGCAGGGCAAGGCGGGG - Intronic
947181089 2:227412069-227412091 CACCCAGGGAGTGCAATGCAAGG - Intergenic
947483542 2:230525616-230525638 CACCCAGGAAGCACAAGGGGTGG + Intronic
947623045 2:231603309-231603331 CTCCCAGAAAGGGGAAGGAGGGG + Intergenic
947643852 2:231723139-231723161 CACCTTGGGAGGCCAAGGTGGGG + Intergenic
948007900 2:234625627-234625649 CTCCCAGGGATGGCAAGGTCAGG + Intergenic
948425743 2:237885795-237885817 CACCCAGGGGGGGCAGAGGGTGG - Intronic
948755896 2:240159415-240159437 CTCCCAGGGTGGGCATGGGGTGG - Intergenic
948804352 2:240447047-240447069 CACCCAGGGATGCCCAGAAGGGG + Intronic
1169111561 20:3037402-3037424 CACCTTGGGAGGGCAAGGGCAGG - Intronic
1169249049 20:4046292-4046314 TACCCAGGGAGGGCAAGGGGAGG + Intergenic
1170470569 20:16664246-16664268 CACCCAGAGAGAGGAAGGTGGGG + Intergenic
1170644973 20:18189896-18189918 CACCCAAGCAGGGAATGGAGTGG - Intergenic
1170646818 20:18203845-18203867 CACTTTGGGAGGCCAAGGAGGGG - Intergenic
1171196137 20:23201052-23201074 CTCCCAGGGAGGCTGAGGAGTGG + Intergenic
1172013999 20:31862290-31862312 CAGCCAGGTAGGGCAGGCAGTGG + Intronic
1172119887 20:32592026-32592048 CACCCAGGCAGGGAGGGGAGGGG + Intronic
1173826792 20:46052936-46052958 CTCTGAGGGAGGCCAAGGAGAGG - Exonic
1174254789 20:49246465-49246487 TGCCCAAGGAGGGCAGGGAGGGG + Exonic
1175501340 20:59453186-59453208 GACCCAGGGAAGACAAGGAGGGG - Intergenic
1175537592 20:59725657-59725679 GGCACAGGGAGGCCAAGGAGGGG + Intronic
1175607625 20:60323892-60323914 CACTTAGGGAGGCCAAGGGGGGG - Intergenic
1176124472 20:63469364-63469386 CACCCAGGCAGTGCGAGCAGAGG + Intronic
1176592873 21:8659793-8659815 GACCAAGGAAGGGCCAGGAGAGG - Intergenic
1177218239 21:18156951-18156973 CACTCAGAGAGGGCAAGGATAGG - Intronic
1179788872 21:43744155-43744177 CACCCAGGCAGGGCCAGGCTAGG + Intronic
1179908576 21:44436455-44436477 CACCTGGGCAGGCCAAGGAGAGG - Intronic
1180225644 21:46390541-46390563 CACCCAGGCAGGGCCAGGCCAGG - Intronic
1180275726 22:10636935-10636957 GACCAAGGAAGGGCCAGGAGAGG - Intergenic
1181100946 22:20538493-20538515 CATTTAGGGAGGGCAAGGCGTGG - Intronic
1181403468 22:22665793-22665815 TAACCAGGGTGGGGAAGGAGGGG - Intergenic
1181408473 22:22701777-22701799 TAACCAGGGTGGGGAAGGAGTGG - Intergenic
1181452517 22:23033468-23033490 TTCCCAGGGAGAGCAAAGAGAGG - Intergenic
1181546434 22:23605242-23605264 CACACACAGAGGGCAAGGACTGG + Intergenic
1181618579 22:24071877-24071899 CACCCAGGGAGGGCAAGGAGTGG - Intronic
1181808557 22:25390178-25390200 GACCCAGTGAAGGCCAGGAGGGG - Intronic
1182586296 22:31345992-31346014 CACGCGGGGAGGAGAAGGAGGGG + Exonic
1182648075 22:31826612-31826634 CACCCCGGGAGGGCATGGGAAGG - Intronic
1183077840 22:35438019-35438041 CACCAAGCGAGGGCAAGGAAGGG + Intergenic
1183668894 22:39260550-39260572 GGCCCAGGAAGGGAAAGGAGGGG + Intergenic
1184176874 22:42793775-42793797 CCAGCAGGGAGGGCCAGGAGGGG + Intergenic
1184343571 22:43899487-43899509 CACCCAAGACAGGCAAGGAGAGG - Intergenic
1184770913 22:46595891-46595913 TACCCAGGGAGGCTGAGGAGTGG + Intronic
1184774796 22:46617763-46617785 CACCCAGGGGGGCCAGGGAGCGG - Intronic
1184850220 22:47115573-47115595 GACCCACAGAGGGCAAGGACGGG - Intronic
1185072277 22:48662864-48662886 CTCATAGGGAGGGCAAGGATTGG - Intronic
1185299150 22:50070451-50070473 CACCAAGGGAGGGCTAGGCCAGG + Intronic
950216288 3:11162095-11162117 CTCCCAGGAAGGACAGGGAGGGG - Intronic
950680259 3:14580274-14580296 CACTCAGGGAAGGGCAGGAGAGG - Intergenic
950707596 3:14792729-14792751 CACCCCGGGCCGGCAAGGAGGGG - Intergenic
951712710 3:25601370-25601392 CACTCTGGGAGGCCAAGGCGGGG + Intronic
952336101 3:32404404-32404426 CACTTTGGGAGGCCAAGGAGGGG - Intronic
953571430 3:44074769-44074791 GACTGAGGGAGGGTAAGGAGAGG + Intergenic
953875340 3:46663474-46663496 CACCCAGGGAGGGTGAGAGGAGG + Intergenic
954179895 3:48873363-48873385 CACTTTGGGAGGCCAAGGAGGGG + Intronic
954318644 3:49815622-49815644 CACTCTGGGAGGCCAAGGCGGGG - Intergenic
954840815 3:53509684-53509706 CAGCCAGGGAAGGCAGGAAGAGG + Intronic
955512173 3:59692233-59692255 GACCAAGGGAGGGAGAGGAGAGG + Intergenic
956158046 3:66318476-66318498 GACCCATGGAGAGCAAGGAAAGG - Intronic
956938065 3:74126490-74126512 CACCCAGCGATTTCAAGGAGGGG - Intergenic
957236025 3:77592795-77592817 CACTTTGGGAGGCCAAGGAGGGG - Intronic
959604039 3:108222514-108222536 CACAGAGGCAGGGCAAGAAGAGG - Exonic
959612736 3:108313423-108313445 CACTCAACAAGGGCAAGGAGTGG + Intronic
960095758 3:113688361-113688383 CACTTAGGGAGGCCAAGGTGGGG - Intronic
960575547 3:119226069-119226091 CATCCAAGGAGGCCAAGAAGAGG - Intronic
960752189 3:120967237-120967259 CACCCAGGAAGTGCAAGGGGAGG - Intronic
960874200 3:122280589-122280611 GACCCAGGGAAGGGAAGGGGAGG - Intronic
960964368 3:123094644-123094666 CACCCAGGGATGGGCAGAAGTGG + Intronic
961343778 3:126247822-126247844 CACGGAGAGAGGGCAAGGACAGG - Intergenic
961819289 3:129567050-129567072 GACCCTGGAAGGGCAAGGGGAGG + Intronic
962356453 3:134698437-134698459 CTGCCAGTGAGGGCATGGAGGGG + Intronic
962382678 3:134910229-134910251 GAGGAAGGGAGGGCAAGGAGGGG - Intronic
962640219 3:137377594-137377616 AGCCCATGGAGGGCAAGCAGAGG - Intergenic
963846144 3:150159841-150159863 CCCCCAGGGAAGGCAGGGAAGGG + Intergenic
964049971 3:152378959-152378981 CACTTTGGGAGGTCAAGGAGGGG - Intronic
964703624 3:159595371-159595393 CAGCCAGGGAAGGGAAGGGGAGG + Intronic
965607630 3:170512420-170512442 CACACAGGGAGGGGAAGAACAGG + Intronic
966251002 3:177865603-177865625 CACCCAGGAAGTGCAAGAAGTGG + Intergenic
966533375 3:181004770-181004792 CACCCGGGAAGTGCAAGGGGTGG - Intergenic
967877574 3:194277418-194277440 CCACTGGGGAGGGCAAGGAGGGG + Intergenic
967954705 3:194869278-194869300 CACTGAGGGAGGGGAAGGAAAGG + Intergenic
967960462 3:194917788-194917810 CACTTTGGGAGGCCAAGGAGGGG + Intergenic
968074991 3:195811504-195811526 GACCCAGAGAGGGAAAGAAGAGG - Intronic
968153369 3:196357526-196357548 CACTTTGGGAGGCCAAGGAGGGG + Intronic
968188541 3:196650524-196650546 CACTTTGGGAGGCCAAGGAGTGG - Intronic
968196346 3:196710590-196710612 CACTTTGGGAGGCCAAGGAGAGG + Intronic
968271091 3:197404296-197404318 CACCTGGGGAGAGCAGGGAGTGG + Intergenic
968292170 3:197547321-197547343 CAGCCAGGTAGGCAAAGGAGAGG - Intronic
968517248 4:1020597-1020619 CACCCAGGCAGGGGATGGGGTGG + Intronic
968517302 4:1020711-1020733 GACCCAGGCAGGGGAAGGGGCGG + Intronic
968517332 4:1020769-1020791 GACCCAGGCAGGGGAAGGGGTGG + Intronic
968517365 4:1020833-1020855 GACCCAGGCAGGGGAAGGGGCGG + Intronic
968517426 4:1020954-1020976 GACCCAGGCAGGGGAAGGGGCGG + Intronic
968517456 4:1021012-1021034 GACCCAGGCAGGGGAAGGGGCGG + Intronic
968659610 4:1793636-1793658 CAGCCAGGGAGGGAAGGGGGAGG + Intronic
969250536 4:5965385-5965407 CAGCCAGGTAGGGGAAGGTGAGG - Intronic
969445329 4:7241573-7241595 CACCCCAGAAGGGCAGGGAGGGG - Intronic
969487580 4:7480841-7480863 CACCCAGGGAGGCCACGCTGTGG - Intronic
971270710 4:25142029-25142051 CACCCTGGGAGGCCAAGGTGGGG + Intronic
973278626 4:48336033-48336055 CACTTTGGGAGGCCAAGGAGGGG - Intergenic
973629030 4:52801830-52801852 CACCTGGGAAGTGCAAGGAGTGG + Intergenic
974573234 4:63682977-63682999 CACCTGGGAAGTGCAAGGAGCGG - Intergenic
975210188 4:71690740-71690762 CACTTTGGGAGGCCAAGGAGGGG + Intergenic
975515384 4:75242173-75242195 AACCCAGGGATGGCAAGTAACGG - Intergenic
976392800 4:84523215-84523237 TACCTGGGGAGGGTAAGGAGGGG + Intergenic
976715857 4:88122042-88122064 CACCCAGGAAGCACAAGGGGTGG + Intronic
979178171 4:117691660-117691682 AAACCAGGGAGGGTGAGGAGAGG + Intergenic
979435711 4:120687297-120687319 CAACCAGGGAAGGCAAAGAAGGG - Intronic
979547023 4:121951050-121951072 TACCCAGGGAGGCCGAGGAAGGG - Intronic
979647886 4:123093248-123093270 CACCCAGAGTTGGCAAGGTGTGG + Intronic
980096461 4:128496350-128496372 AACCCAGGAAGTGCCAGGAGAGG - Intergenic
980223384 4:129948291-129948313 AGCCCACGGAGGGCAAGCAGGGG - Intergenic
981092189 4:140743296-140743318 CACCAAGGGAGGACAATGATGGG + Intronic
981299063 4:143166652-143166674 CACCCGGGAAGCGCAAGGAAGGG + Intergenic
981318134 4:143362002-143362024 CACCTTGGGAGGCCAAGGTGGGG - Intronic
982437690 4:155397599-155397621 CATCCTGGGAAGGCCAGGAGGGG - Intergenic
982584614 4:157221606-157221628 TGCCCCGGGAGGGAAAGGAGGGG - Intronic
983590047 4:169399000-169399022 CACTTTGGGAGGCCAAGGAGGGG + Intronic
984708128 4:182862732-182862754 CACCCAGGGAAGGCTGGGGGTGG - Intergenic
984828156 4:183946870-183946892 CACTCTGGGAGGCCAAGGAGGGG - Intronic
985190658 4:187369309-187369331 GAGTCAGGGAGGGCAGGGAGAGG + Intergenic
985687142 5:1288596-1288618 CACCCAAGGGGGCCAAGCAGAGG + Intronic
985985385 5:3511306-3511328 CATGAAGGGAGGGCAGGGAGTGG - Intergenic
986669098 5:10127322-10127344 CACAAAGGGAGTGCAGGGAGAGG + Intergenic
987008886 5:13739712-13739734 CAGACATGGAGGGAAAGGAGAGG + Intronic
988241127 5:28610406-28610428 CACTTTGGGAGGCCAAGGAGGGG - Intergenic
988990529 5:36666071-36666093 CACCCAGGAAAGGCAGTGAGGGG - Intronic
989282953 5:39665702-39665724 CACCGAGGGTGGGCTAGGCGTGG - Intergenic
989950384 5:50291088-50291110 CAACCAGGGAGAGCATGTAGGGG + Intergenic
990863732 5:60357099-60357121 CAGACAGAAAGGGCAAGGAGAGG + Intronic
991123997 5:63048888-63048910 CACTCAGGGTGGGAAAGGGGTGG - Intergenic
991299457 5:65114921-65114943 CACTTTGGGAGGCCAAGGAGGGG + Intergenic
991950936 5:71946175-71946197 CAGCCAGGGAAGGGTAGGAGGGG + Intergenic
992303028 5:75404761-75404783 CACTCTGGGAGACCAAGGAGGGG + Intronic
993285239 5:85987578-85987600 CACTTTGGGAGGCCAAGGAGGGG - Intergenic
993516080 5:88836585-88836607 AATCCAGGCAGGGCAAGGACAGG + Intronic
996275354 5:121660079-121660101 CACCCAGGAAGTGCAAGGGGTGG + Intergenic
996367829 5:122721653-122721675 TAACTGGGGAGGGCAAGGAGGGG + Intergenic
997102849 5:130987799-130987821 GACCTGGGGAGGGGAAGGAGGGG - Intergenic
997373800 5:133382839-133382861 CTCACAGGGAGGGCACGGAAAGG + Intronic
997779388 5:136641499-136641521 AACAAAGTGAGGGCAAGGAGTGG + Intergenic
998464052 5:142328971-142328993 GCCACAGGGAGGGCATGGAGAGG + Intergenic
998642019 5:144021894-144021916 CACTTTGGGAGGCCAAGGAGGGG - Intergenic
999185246 5:149702605-149702627 CACTTTGGGAGGGCAAGGTGAGG - Intergenic
1001078139 5:168644756-168644778 CACTTTGGGAGGCCAAGGAGGGG - Intergenic
1001099866 5:168805300-168805322 CACACAGGGAAGGGGAGGAGGGG + Intronic
1001226743 5:169951113-169951135 CAGCCAGGGAGGGAAAGGGTTGG - Intronic
1001551079 5:172602804-172602826 CACTCTGGCAGGACAAGGAGGGG - Intergenic
1001705080 5:173735650-173735672 CCGGCAGGGAGGGCAAGGAAGGG + Intergenic
1001784088 5:174396764-174396786 CAGCCATGGAGGTGAAGGAGGGG + Intergenic
1002166722 5:177352155-177352177 CACCCGGGGAGGACAAGGGTTGG - Intergenic
1002332138 5:178450455-178450477 CAGCCAGCGGGGGCCAGGAGAGG + Intronic
1002435316 5:179227768-179227790 CAAGGAGGGAGGGCCAGGAGAGG + Intronic
1002514861 5:179750081-179750103 CACACTGGCAGTGCAAGGAGAGG - Intronic
1002685703 5:181007916-181007938 AACCCAGGAAGTGCAAGGAGTGG + Intergenic
1002877735 6:1226364-1226386 CAACAAGGAGGGGCAAGGAGGGG + Intergenic
1003497877 6:6679793-6679815 CTGCCAGGGTGGGCAGGGAGGGG + Intergenic
1003540355 6:7013026-7013048 CACTCAGAGAAGGCAAGGTGTGG + Intergenic
1003645342 6:7910030-7910052 CACCGAGGGAGGGGAAGGTGGGG - Intronic
1004123749 6:12852078-12852100 CACTTTGGGAGGCCAAGGAGGGG - Intronic
1005392851 6:25350771-25350793 CATCCAGGGAGAGCCAGTAGGGG - Intronic
1005627999 6:27681472-27681494 CACTTTGGGAGGCCAAGGAGGGG + Intergenic
1005923024 6:30417583-30417605 GGCTCAGGGAGGGCAAGGTGAGG - Intergenic
1005988520 6:30889316-30889338 CACCCAGGGACGGCATGCCGGGG + Exonic
1006060187 6:31413373-31413395 GGCTCAGGGAGGGCAAGGTGAGG - Intronic
1006133473 6:31882399-31882421 CAGCTAGGAAGGGCGAGGAGGGG + Intronic
1006192554 6:32218466-32218488 CACCCAGGGAGAACAAGAAGCGG - Intronic
1006403147 6:33829512-33829534 CACCCAGGGAGGTGAAGGAGGGG - Intergenic
1006403163 6:33829568-33829590 CACCCAGGGAGATGAGGGAGGGG - Intergenic
1006403179 6:33829622-33829644 CACCCAGGGAGGTGAGGGAGGGG - Intergenic
1006403212 6:33829729-33829751 CACCCAGGGAGGTGAGGGAGGGG - Intergenic
1006403228 6:33829784-33829806 CACCCAGGGAGGTGAGGAAGAGG - Intergenic
1006403241 6:33829839-33829861 CACCCAGGGAGGTGAGGAAGAGG - Intergenic
1006403254 6:33829894-33829916 CACCCAGGGAGGTGAGGAAGAGG - Intergenic
1006403279 6:33830004-33830026 CACCCAGGGAGGTGAGGAAGAGG - Intergenic
1006474253 6:34244736-34244758 GAGCCAGGGAGTGCAGGGAGCGG + Intronic
1006682659 6:35808203-35808225 CACTTTGGGAGGCCAAGGAGAGG + Intronic
1006828702 6:36955877-36955899 CCCTCAGGGAGGGCAGGAAGTGG - Intronic
1007126980 6:39433672-39433694 CACTCAGGGAGGCCAAGGTGAGG + Intronic
1007292306 6:40797059-40797081 CAGCCGGGGACGGGAAGGAGGGG - Intergenic
1007927700 6:45663418-45663440 CACGCGGGGATGACAAGGAGCGG + Intronic
1007976151 6:46103549-46103571 CATTATGGGAGGGCAAGGAGAGG - Intergenic
1009054251 6:58316351-58316373 CACCCAGGAAGTGCAAGGGGTGG + Intergenic
1009236883 6:61134228-61134250 CACCCAGGAAGTGCAAGGGGTGG - Intergenic
1009393229 6:63167161-63167183 CACCCAGGAAGCACAAGGGGTGG + Intergenic
1009727936 6:67558600-67558622 CACCCAGGAAGCGCAAGGAGTGG - Intergenic
1010171854 6:72984650-72984672 CACCCAGGAAGCACAAGGGGTGG - Intronic
1010379690 6:75209805-75209827 CACACAGGGATGGAAAGAAGAGG - Intergenic
1010649673 6:78437664-78437686 CAGCCTGGGAGGGGAAAGAGGGG - Intergenic
1011115132 6:83881419-83881441 CACTCTGGGAGACCAAGGAGTGG - Intronic
1011264935 6:85506559-85506581 CACCTTGGGAGGCCAAGGCGGGG - Intronic
1011583911 6:88903290-88903312 AACCCAGGGAGGTCAAGGCTGGG + Intronic
1011795427 6:90947439-90947461 CAGCAAGGTAGGGCATGGAGGGG + Intergenic
1012979377 6:105813624-105813646 CTGCCAGGGAGGCCCAGGAGAGG - Intergenic
1013647863 6:112163224-112163246 CACTCTGGGAGGCCAAGGTGGGG - Intronic
1014006011 6:116418991-116419013 TGCACAGGGAGGGAAAGGAGAGG - Intronic
1014569863 6:122996130-122996152 CAACGAGGCAGGGAAAGGAGCGG + Exonic
1015050710 6:128836238-128836260 CACTCTGGGAGGCCAAGGGGGGG - Intergenic
1015079692 6:129208760-129208782 GAAGCAGGGAGGGCAAGGAAAGG + Intronic
1016774096 6:147885211-147885233 CACTTTGGGAGGCCAAGGAGGGG + Intergenic
1016790870 6:148065354-148065376 CACCCATGGAGAGCGAGGAAAGG - Intergenic
1017463970 6:154677624-154677646 CACTTTGGGAGGCCAAGGAGGGG - Intergenic
1017490466 6:154940358-154940380 CACTTTGGGAGGCCAAGGAGGGG - Intronic
1018153776 6:160965765-160965787 AAGGCAGGGATGGCAAGGAGGGG + Intergenic
1018390267 6:163336340-163336362 CACCTGGGAAGGGAAAGGAGGGG + Intergenic
1018797710 6:167200129-167200151 CACCCAGAAGGTGCAAGGAGTGG - Intergenic
1018928611 6:168224321-168224343 CCCCCAGGGAGTGCTTGGAGTGG + Intergenic
1019413637 7:917363-917385 CTACCAGGGAGGGCTGGGAGGGG + Intronic
1019413996 7:919149-919171 CACCCAGGCAGGCCTAGGGGAGG + Intronic
1019578587 7:1749286-1749308 CACCCAGGGCGTGCAAGCAGAGG - Intergenic
1019616207 7:1963720-1963742 CACCCAGGGAGGGCAGCGCACGG - Intronic
1019908249 7:4081212-4081234 CATCCAGGCAGGCCTAGGAGTGG + Intronic
1020050483 7:5078207-5078229 CACTCTGGGAGGCCAAGGCGTGG + Intergenic
1020269049 7:6581297-6581319 AACCCAGGCTGGGGAAGGAGCGG + Intronic
1021306667 7:19040187-19040209 CACCCAGGAAGTGCAAGGGTCGG - Intronic
1021549485 7:21854786-21854808 CACTCTGGGAGGCCAAGGAGGGG - Intronic
1022293652 7:29028717-29028739 CACCTGGGGAGGCCAAGGTGGGG + Intronic
1022487535 7:30791299-30791321 GACCCAGGGAGGTCCTGGAGGGG - Exonic
1023037900 7:36148930-36148952 CACACAGGGAGGAGAATGAGGGG + Intergenic
1023575615 7:41623181-41623203 CCAGCAGGGAGGGCAAGAAGAGG - Intergenic
1024045682 7:45584187-45584209 CACTCTGGGAGGCCAAGGTGAGG - Intronic
1024243165 7:47450803-47450825 AAGCCAGTGAGGACAAGGAGAGG - Intronic
1024738276 7:52328748-52328770 CACCCAGGAAGCACAAGGGGTGG - Intergenic
1025105048 7:56163603-56163625 CTCCGGGGCAGGGCAAGGAGTGG - Intergenic
1026584865 7:71647882-71647904 CAGCCAGGCAGGGCAGGAAGCGG + Intronic
1026955301 7:74372903-74372925 CACCCAGGGTGGACACGGTGGGG - Intronic
1026964695 7:74431633-74431655 CACCTTGGGAGGCCAAGGTGGGG + Intergenic
1027035580 7:74922794-74922816 GCCCCATGGAGGGGAAGGAGGGG + Intergenic
1027249460 7:76389939-76389961 CTCCCAGGCAAGGGAAGGAGGGG + Exonic
1027271107 7:76519431-76519453 CACCCATGGTGGCCAAGGGGTGG + Intergenic
1027320870 7:77009366-77009388 CACCCATGGTGGCCAAGGGGTGG + Intergenic
1028590139 7:92484770-92484792 CACAGAGTGAGGGCAAGGACAGG + Intergenic
1028594581 7:92534177-92534199 GACCCATGGAGAGCAAGGAAAGG + Intronic
1028720422 7:94024246-94024268 CACCCAGGTAGGGGCAGGAAGGG - Intergenic
1029024720 7:97404038-97404060 CACTTTGGGAGGCCAAGGAGGGG - Intergenic
1029394478 7:100298343-100298365 GCCCCATGGAGGGGAAGGAGGGG - Intergenic
1029529699 7:101117238-101117260 CAGCCAGTGAGAGCATGGAGTGG - Intergenic
1030102759 7:105960866-105960888 GAACCAGGGAGGGAAAGGAAGGG + Intronic
1030347864 7:108454979-108455001 CACCGAGGGAGGGCGCCGAGCGG - Intronic
1032193208 7:129775974-129775996 CACCCAGGGCAGGCAAGCTGGGG + Intergenic
1032394845 7:131581893-131581915 CACTCAGAGAGGGAAAGGAGAGG + Intergenic
1032648961 7:133857206-133857228 CATCCAGGGAGGTTAAGTAGAGG - Intronic
1032648966 7:133857371-133857393 CATCCAGGGAGGTTAAGTAGAGG - Intronic
1032751283 7:134844448-134844470 CACCTAGGGAGGTGAAAGAGGGG + Intronic
1032984115 7:137317883-137317905 TACCCTGGGAGTTCAAGGAGTGG + Intronic
1033016459 7:137676360-137676382 AACCCAGGAAGGACAAGGACAGG - Intronic
1033328409 7:140398246-140398268 GGCCCAGGGAGGAGAAGGAGGGG + Intronic
1034097599 7:148424571-148424593 CACCCAGGAAGCACAAGGGGTGG + Intergenic
1034460558 7:151195726-151195748 CAGGCAGGGATGGGAAGGAGGGG + Intronic
1035437161 7:158867737-158867759 CTCCCGGGGAGGCCCAGGAGAGG - Intronic
1035781757 8:2233394-2233416 CACCCAGGCCGGGCACGGACAGG + Intergenic
1036184915 8:6614476-6614498 CACGCAGGGAGGGACAAGAGGGG - Intronic
1036203123 8:6785634-6785656 CACACAGGGAGGGCTTGGTGTGG - Intergenic
1036557475 8:9872948-9872970 CACTCTGGGAGGCCAAGGTGGGG - Intergenic
1036678236 8:10852141-10852163 CGCGCAGGGAGGGGAAGGGGAGG + Intergenic
1037865884 8:22441556-22441578 CACCCTAGGAGGGCTCGGAGGGG + Intronic
1038633961 8:29270643-29270665 CACTTTGGGAGGTCAAGGAGAGG - Intergenic
1039093505 8:33857788-33857810 CAAAGAGGGAGGGCTAGGAGCGG - Intergenic
1039355625 8:36812131-36812153 CACTTTGGGAGGCCAAGGAGGGG + Intronic
1039467420 8:37794723-37794745 CACCCAGGGAGGTGATGAAGTGG - Intronic
1039499225 8:38003625-38003647 CACGGAGTGAGGGCAAGGACAGG + Intergenic
1039552329 8:38452012-38452034 AACCAAAGGAGGGGAAGGAGAGG + Intronic
1039983700 8:42429882-42429904 CAGTAAGGGAGGGCAAGGATAGG + Intronic
1041287228 8:56273419-56273441 TGCCCAGGAAGTGCAAGGAGCGG + Intergenic
1042438321 8:68794415-68794437 CACTTTGGGAGGGCAGGGAGGGG - Intronic
1042554407 8:70022028-70022050 CACTGAGGGAGGGGAGGGAGAGG + Intergenic
1043031950 8:75146281-75146303 CACCAAGAGAGGTCACGGAGTGG - Intergenic
1043998965 8:86854635-86854657 CACACAGGGATGGCCAGGTGTGG - Intergenic
1045472658 8:102526172-102526194 CACCTGGGGAGGCCAAGGGGGGG - Intergenic
1046770293 8:118111302-118111324 CACCCAGGGCGGGCGAGCAGCGG + Exonic
1047292511 8:123541856-123541878 CAGCAAAGGAGGGGAAGGAGAGG + Intergenic
1047629952 8:126695820-126695842 TTCCCAGGCAGGGCATGGAGAGG - Intergenic
1047705304 8:127493209-127493231 CAGGCAGGGAGGGTAAGCAGGGG + Intergenic
1048441159 8:134459965-134459987 GGCCCAGAGAGGCCAAGGAGTGG - Intergenic
1048981058 8:139703591-139703613 CACCGAGAGGGGGCGAGGAGGGG - Intergenic
1049570985 8:143370213-143370235 AGCCCAGGGAGGGCCAGGACAGG - Intronic
1049690230 8:143955083-143955105 GTCCCAGGGAGGGCAGGGACGGG - Intronic
1051748466 9:20317735-20317757 CACACAGAGAGAGCAAGGATTGG + Intergenic
1052521852 9:29558259-29558281 TACCAAGGGAGGGGAAGAAGTGG - Intergenic
1052846876 9:33344619-33344641 CACTTTGGGAGAGCAAGGAGGGG + Intronic
1054705056 9:68453580-68453602 CACTTTGGGAGGCCAAGGAGGGG - Intronic
1054881404 9:70148602-70148624 CACCTAGGGAGGGCCAGGCATGG + Intronic
1055480468 9:76704468-76704490 CACTTTGGGAGGCCAAGGAGGGG - Intronic
1056277890 9:85011188-85011210 TACCCAGGAAGGGAAGGGAGCGG + Intronic
1056681720 9:88725102-88725124 CAGCCAGGGAAGGCCAGGCGCGG - Intergenic
1057005295 9:91552150-91552172 CACACACAGAGGGCAGGGAGGGG + Intergenic
1057243086 9:93429821-93429843 CACTTTGGGAGGCCAAGGAGGGG + Intergenic
1058361856 9:104157080-104157102 CACTTTGGGAGGCCAAGGAGGGG - Intergenic
1058390137 9:104486833-104486855 CACGTTGGGAGGCCAAGGAGGGG - Intergenic
1059336047 9:113569065-113569087 GGCCCATGGAGGGCAGGGAGAGG - Intronic
1059521482 9:114946802-114946824 CTCCCAGGAAGGGCGAGGAAGGG - Intergenic
1060152832 9:121299743-121299765 CCCCCAGGGAGGGCGCGGGGCGG - Intronic
1060548184 9:124472906-124472928 CACCCGGTGAAGGCAAGGAGAGG + Intronic
1060557240 9:124514296-124514318 CATGCAGGGAGGGCAAGGATGGG + Intergenic
1060917347 9:127398908-127398930 CACCCAGGGAGGGGCCTGAGTGG - Intronic
1060942234 9:127549623-127549645 AAGCCAGGGAGGGAAAGAAGGGG + Intronic
1061073465 9:128326368-128326390 CAGGCAGGGAGGACAAGGAGAGG + Intronic
1061376983 9:130232235-130232257 GCCACAGGGAGGGCCAGGAGTGG - Intronic
1061491842 9:130949253-130949275 CCTCCAGGAAGGGCATGGAGTGG + Intergenic
1061618190 9:131793898-131793920 CCCAGAGGGAGGGCAGGGAGAGG + Intergenic
1061975757 9:134067497-134067519 AACCCAGGGAGGACGCGGAGGGG - Intronic
1061997278 9:134192880-134192902 CACCCAGAGAGGCCAACGGGAGG + Intergenic
1062006099 9:134239329-134239351 CACCCAGGTGCGGCAAGGAGAGG - Intergenic
1062107479 9:134763880-134763902 CTCCCAGGGAAGCCAAAGAGAGG + Intronic
1062422793 9:136491709-136491731 CACTCTGGGAGGCCAAGGTGAGG + Intergenic
1062468022 9:136690034-136690056 CACCCAGGGAGGGCTGGCATGGG + Intergenic
1203622919 Un_KI270749v1:138599-138621 GACCAAGGAAGGGCCAGGAGAGG - Intergenic
1185739792 X:2522523-2522545 CACTCTGGGAGGCCAAGGTGGGG + Intergenic
1185794741 X:2955231-2955253 CACTCTGGGAGGTCAAGGAGCGG + Intronic
1186163496 X:6802636-6802658 CACTCTGGGAGGCCAAGGTGGGG + Intergenic
1186301611 X:8205378-8205400 CAGCCAGAGAGTGCCAGGAGAGG + Intergenic
1186690823 X:11973905-11973927 CACCCAGGGATGAGATGGAGTGG + Intergenic
1189217360 X:39337630-39337652 TACACAGGGAGGGGAAGGTGTGG + Intergenic
1191043651 X:56112965-56112987 CACTTTGGGAGGCCAAGGAGTGG + Intergenic
1191172080 X:57458712-57458734 TACCCGGGAAGTGCAAGGAGTGG + Intronic
1192054652 X:67760712-67760734 CACATAGGGAGGCCAAGAAGGGG - Intergenic
1192201637 X:69069968-69069990 CACTCAGGGATGGCATGGAAGGG + Intergenic
1193383605 X:80845116-80845138 CTGCCAGAGAGGGCAGGGAGAGG - Intergenic
1195345033 X:103940973-103940995 CACCCAGGAAGCTCAAGGGGTGG - Intronic
1195845944 X:109228966-109228988 CACCCAGGGAGTGCAAGTGTTGG + Intergenic
1195915016 X:109927554-109927576 CACCCAGGAAGGGCAAGGCCTGG + Intergenic
1196715534 X:118807349-118807371 CACTCACGGATGGCAATGAGAGG + Intergenic
1198531806 X:137555405-137555427 CACTTAGGGAGGCCAAGGTGGGG + Intergenic
1198532208 X:137558265-137558287 GACCAAGGGACGGCAAGGCGAGG + Intergenic
1198604538 X:138322406-138322428 CACCAAGTGGGGGCAAGGATAGG + Intergenic
1199710687 X:150467003-150467025 GAACCAGGCAGGCCAAGGAGGGG - Intronic
1200065088 X:153500412-153500434 CACCCAGAGAGGCCAATGAAGGG + Intronic
1200210952 X:154346396-154346418 AGTCCAGGGAGGGCAGGGAGGGG - Intergenic
1200219900 X:154385696-154385718 AGTCCAGGGAGGGCAGGGAGGGG + Intergenic
1201537755 Y:15069269-15069291 CTCCCAGGAAGTGCAAGGAATGG + Intergenic