ID: 1181620202

View in Genome Browser
Species Human (GRCh38)
Location 22:24085885-24085907
Sequence CTGTAGGCACACTTTCTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 119}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181620195_1181620202 19 Left 1181620195 22:24085843-24085865 CCCTCTGTGGCAGACCTGCATCT 0: 1
1: 0
2: 1
3: 16
4: 190
Right 1181620202 22:24085885-24085907 CTGTAGGCACACTTTCTGGAAGG 0: 1
1: 0
2: 1
3: 12
4: 119
1181620199_1181620202 5 Left 1181620199 22:24085857-24085879 CCTGCATCTAAAGGGTTCAGAGT 0: 1
1: 0
2: 0
3: 6
4: 121
Right 1181620202 22:24085885-24085907 CTGTAGGCACACTTTCTGGAAGG 0: 1
1: 0
2: 1
3: 12
4: 119
1181620196_1181620202 18 Left 1181620196 22:24085844-24085866 CCTCTGTGGCAGACCTGCATCTA 0: 1
1: 0
2: 0
3: 17
4: 249
Right 1181620202 22:24085885-24085907 CTGTAGGCACACTTTCTGGAAGG 0: 1
1: 0
2: 1
3: 12
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181620202 Original CRISPR CTGTAGGCACACTTTCTGGA AGG Intronic
901615441 1:10535849-10535871 CTGTATGCTGTCTTTCTGGAAGG - Intronic
902116337 1:14124778-14124800 CTCTGTGCACACTTTCTGAATGG - Intergenic
906585008 1:46968139-46968161 CTGAAGGGGCACTTTGTGGATGG + Intergenic
909199831 1:72677151-72677173 CAGTTGTCCCACTTTCTGGATGG - Intergenic
916480816 1:165212834-165212856 CTGTGGCCACACTTCCTGCAGGG - Intronic
916759708 1:167805350-167805372 CTTTGGGCACTCTCTCTGGATGG - Intergenic
917985176 1:180309462-180309484 CTGTTGCTACAGTTTCTGGAAGG + Intronic
918567147 1:185948010-185948032 CAGTAGGCACACTGTTAGGATGG + Intronic
918786136 1:188766882-188766904 TTGTAGGCACAGTTTCTAAAGGG - Intergenic
919698340 1:200603939-200603961 CTGTAGACAGAATTTGTGGAAGG - Exonic
920444046 1:206002261-206002283 CTGTAGGTACACTTCCCAGAGGG - Intronic
921106573 1:211986786-211986808 ATGTAAGCACACTAGCTGGAAGG + Intronic
1067658065 10:48212186-48212208 CTGTAGTCACAATTCCAGGAGGG + Intronic
1067784870 10:49238251-49238273 CTGCAGTCAAGCTTTCTGGAAGG - Intergenic
1069798684 10:71069208-71069230 CAGCAGGCAGCCTTTCTGGAGGG - Intergenic
1070104659 10:73420126-73420148 CTGTAGTCACACTACCTGGGAGG - Intergenic
1070264411 10:74888010-74888032 CTGTGGGCACTATTTCAGGAAGG - Intronic
1071203610 10:83249394-83249416 TTGTAGGCAAACTTTCGGCAGGG - Intergenic
1071417932 10:85458493-85458515 CTGGAGGCAGACTTGCTGGCAGG - Intergenic
1077573503 11:3358182-3358204 CTGTCTGCACAGTTACTGGAGGG + Intronic
1083799477 11:65038235-65038257 CTTCAGGGAAACTTTCTGGAGGG + Intronic
1084140340 11:67223804-67223826 GTATAGCAACACTTTCTGGAAGG - Intronic
1085042807 11:73336539-73336561 CAGCAGGGACAGTTTCTGGAAGG + Intronic
1085424637 11:76393273-76393295 CTGTAGGCTCACCTTAGGGATGG + Intronic
1090458388 11:126868900-126868922 CTGTATCCTCACTTGCTGGAGGG + Intronic
1091822328 12:3484988-3485010 CTGCAGGCACAACCTCTGGAAGG + Intronic
1111689346 13:91542644-91542666 CTGCAATCACACTTTCCGGATGG - Intronic
1112963104 13:105152553-105152575 CTGTAGGCACTTTCTCTGCAGGG - Intergenic
1114406777 14:22464137-22464159 TTGCAGGCCCAATTTCTGGAAGG + Intergenic
1118632372 14:67717564-67717586 CTTTAGGCCTACATTCTGGAGGG + Intronic
1119531141 14:75362184-75362206 CTGGAGACACACTCTCAGGAAGG - Intergenic
1121097087 14:91224972-91224994 CTGCATGCCCACTTTCTGGGAGG + Exonic
1121111105 14:91313743-91313765 CTGCAGGGACACGTTCTGCAAGG + Exonic
1121341495 14:93107788-93107810 CTGTAGGCCCATCCTCTGGATGG - Intronic
1121407187 14:93726201-93726223 GTGGAGGCACAGTTTCTGCAGGG - Intronic
1121489112 14:94345408-94345430 CTGTGGGCACAATTTCTGTATGG + Intergenic
1122823343 14:104358014-104358036 ATGTAGGGACACTTCCAGGACGG - Intergenic
1123120772 14:105915402-105915424 CTGCAGGCACACTGTGTGGCAGG - Intergenic
1126514712 15:49521562-49521584 CAGCAGGCACACTTTCAGGGAGG - Intronic
1130099940 15:80885640-80885662 CTGCAGTCACACCTCCTGGAAGG - Intronic
1131856486 15:96602140-96602162 CAGTAGGCACACTTTTCGGGAGG + Intergenic
1132163391 15:99563994-99564016 CAGGAGGCTCAATTTCTGGAAGG + Intergenic
1132602921 16:781917-781939 CTGGAGGCCCCCTTTCTGCATGG + Intronic
1137987024 16:53117736-53117758 CTTTACCCAAACTTTCTGGAAGG + Intronic
1138963887 16:62060236-62060258 CTTTGGACACACTTTCTGGAAGG + Intergenic
1142302538 16:89266884-89266906 CTGGAGCCACACTGGCTGGAGGG + Intergenic
1142566356 17:842633-842655 CTGAAGGTGCACTTTCTGAACGG - Intronic
1143907946 17:10224802-10224824 CTCTTGGAAGACTTTCTGGAGGG + Intergenic
1144051764 17:11502870-11502892 CAGTAGGCAGCCTTTTTGGATGG + Intronic
1144239597 17:13297319-13297341 CTTTAGACAAACTGTCTGGAAGG + Intergenic
1149554362 17:57562578-57562600 CTGTTGGCCAGCTTTCTGGAGGG + Intronic
1149643975 17:58225814-58225836 CTGTTGGCACACTGCCTGGAAGG - Intronic
1151107314 17:71631368-71631390 GTGTAGGCAGAGTTTGTGGATGG - Intergenic
1152471622 17:80492723-80492745 CTGTAGGCACTGGGTCTGGAGGG - Intergenic
1155431976 18:25769017-25769039 CTGTAGGCTGAGTTTCTTGAGGG + Intergenic
1155707624 18:28836916-28836938 CTGTAGTCTCACTTACTTGAGGG + Intergenic
1156420854 18:36951182-36951204 CTGTAGGAACACTTTCTAAAAGG - Intronic
1162497616 19:11032164-11032186 CTGTCAGCACACTTCCTGGCAGG - Intronic
1164519200 19:28964916-28964938 CTATAGGCACACTTTCTCAGTGG + Intergenic
1164911614 19:32016988-32017010 CTGGATGCCCACTTTATGGAGGG + Intergenic
925378082 2:3402937-3402959 TAGTGGGCACACTTTCTTGAAGG + Intronic
925729717 2:6910550-6910572 CTATAGAGACCCTTTCTGGATGG - Intergenic
926050905 2:9744227-9744249 CTGTGGGCTCCCTTTCTGGGTGG + Intergenic
929099406 2:38295274-38295296 CTGTAGGCAACATTTTTGGATGG + Exonic
934755366 2:96820755-96820777 CTGCAGCCACACTCTGTGGAGGG - Intronic
934916756 2:98306272-98306294 CTGTAGGCACAAGTCCTTGAAGG + Intronic
943185033 2:184597573-184597595 CTGGAGACAGACTTTCTGGTTGG - Intergenic
946589478 2:221228383-221228405 CTTTAAGAACACTTGCTGGAGGG + Intergenic
947723542 2:232382927-232382949 CTGTGGGCACAGTGTCTGGAGGG + Intergenic
948626501 2:239272361-239272383 CTGTAGGTTGCCTTTCTGGATGG - Intronic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1169608578 20:7352429-7352451 TTGTCGGCAGAATTTCTGGATGG - Intergenic
1171345715 20:24464711-24464733 CAGTATGCCCACTTTCTAGATGG + Intergenic
1179207534 21:39296340-39296362 CTGCAGGCACACAGTTTGGAAGG - Exonic
1179655632 21:42842563-42842585 CTGTCTGCACCCTGTCTGGAAGG + Intergenic
1181620202 22:24085885-24085907 CTGTAGGCACACTTTCTGGAAGG + Intronic
1185057195 22:48587240-48587262 CTGTGGGCACGAGTTCTGGAGGG + Intronic
949255104 3:2036439-2036461 CTCTAGGCACACTGCCTGGGAGG + Intergenic
951200225 3:19868327-19868349 CTGTAGTCCCACTTACTGGGGGG - Intergenic
953140807 3:40227746-40227768 CTGCAGGCACACTTCCTGGCTGG - Intronic
957112561 3:75983335-75983357 CTGAAAGCACATTTTCTGAACGG + Intronic
957192875 3:77032780-77032802 CTGTTGCCTCACTTTTTGGATGG - Intronic
958735630 3:98006653-98006675 CTGTTGGCACACTTTCTGGCTGG + Intronic
962601776 3:136996501-136996523 CTGGAGTCACTCTTTCTGAAAGG + Intronic
962989551 3:140565895-140565917 CTGGAGACAGACTTCCTGGAAGG - Intronic
974757036 4:66223146-66223168 CTGTAAGCACATTTTCGAGAGGG - Intergenic
975146998 4:70979359-70979381 CTGTATTCACACTGTCAGGATGG + Intronic
985384588 4:189432120-189432142 ATGTAGGGACTCTTTCTGGGGGG - Intergenic
990154011 5:52854013-52854035 GGGTAGGCACACATGCTGGAAGG - Intronic
996015151 5:118525563-118525585 CTGTAGTCACAGTTTCTGGGGGG - Intergenic
997439934 5:133902058-133902080 CAGTAGGCAGCCTCTCTGGAGGG - Intergenic
997657619 5:135567040-135567062 CTGTAGACTGAGTTTCTGGAGGG + Intergenic
997720461 5:136074534-136074556 CTGTAGCCTCACTTGGTGGAGGG - Intergenic
1006550833 6:34821854-34821876 CAGTAGGCCTGCTTTCTGGAGGG + Intronic
1007294402 6:40810898-40810920 AAGTAGGCACACTTTAAGGATGG - Intergenic
1007509192 6:42362507-42362529 CTGTATGCCCATTTTATGGAGGG + Intronic
1010086242 6:71921584-71921606 CAGTAGGCAAACTTCCTGTAAGG - Intronic
1012582321 6:100883731-100883753 CTCATGGCATACTTTCTGGACGG - Intergenic
1012665970 6:101970433-101970455 CTTTAGGCACACTGTCTGTGGGG - Intronic
1013487811 6:110614849-110614871 CTGTAACCACACATTCTGGCAGG + Intronic
1015508206 6:134010965-134010987 CTCCAGGCACACTTTCTGTTTGG + Intronic
1016317422 6:142805936-142805958 CTCTAGGCACAATTTCTGCAGGG - Intronic
1016652103 6:146474058-146474080 CAGAAGGCACACTTTGTGAAAGG - Intergenic
1016741091 6:147529587-147529609 CTTTATGCAAACCTTCTGGAAGG - Intronic
1022382927 7:29877088-29877110 CTGGAGGCACATTTTCTTCAGGG - Intronic
1024589703 7:50870742-50870764 CTGGAGTCACACATCCTGGAAGG + Intergenic
1029050925 7:97686511-97686533 CAGTAGGCACACATACTGTAAGG + Intergenic
1031413973 7:121473789-121473811 CTGTTGGCACTCTTCCTGGGTGG - Intergenic
1032650054 7:133868468-133868490 CTGAAGGCTTATTTTCTGGAAGG - Intronic
1036563779 8:9920798-9920820 CTCTAAGGACACTTTCAGGAAGG + Intergenic
1037717695 8:21413617-21413639 CTGTAGGAACAATTTCTGGTTGG - Intergenic
1038547445 8:28436298-28436320 CTGTAGGGACACCTTCCAGAGGG + Intronic
1039290329 8:36087807-36087829 CTGGCGGCTCACTGTCTGGATGG + Intergenic
1039316304 8:36376509-36376531 CTGTATCCACTCTTTCTGGCTGG + Intergenic
1041332400 8:56740960-56740982 CTGGAGGCACATTTGCTGGAAGG - Intergenic
1042807916 8:72791956-72791978 CTGTAGGTACACTCACTGGTAGG - Intronic
1049011059 8:139887695-139887717 ATGCATGCACACTTTCTGGAGGG - Intronic
1050137958 9:2487871-2487893 ATGTATGCACACTTGCTGGTTGG - Intergenic
1053728340 9:41026741-41026763 CTGCAGTTACTCTTTCTGGAAGG + Intergenic
1054700164 9:68405339-68405361 CTGCAGTTACTCTTTCTGGAAGG - Intronic
1061791759 9:133062884-133062906 CTGCCGGCTCTCTTTCTGGAGGG - Intronic
1061795434 9:133083450-133083472 CTGCCGGCTCTCTTTCTGGAGGG - Intronic
1186214858 X:7289194-7289216 CTGTAGCCACCATTTCTGGGTGG + Intronic
1186948357 X:14594707-14594729 ATGTGTGCACACTTTCTGAAAGG + Intronic
1187773978 X:22734043-22734065 CTTTAGACACATTTTCTTGAAGG + Intergenic
1189234454 X:39476780-39476802 CTGTGGCCACCCTTTGTGGAGGG + Intergenic
1189782831 X:44532474-44532496 TAGTAGGAATACTTTCTGGAAGG + Intronic
1190850757 X:54238853-54238875 CTGTAAGCACACTACCTTGACGG + Exonic
1190976557 X:55408660-55408682 CAGGAGGCCCACATTCTGGAGGG - Intergenic
1195965804 X:110428990-110429012 CTGTAGGTTCACTTTCTCCACGG + Intronic
1197728327 X:129791144-129791166 CTGGTGGCACACTGTCTGGGCGG + Intronic
1200965285 Y:9029913-9029935 CTGTATGCACACTTTTTGGTGGG + Intergenic
1201274959 Y:12287998-12288020 CTGTCTGCACAGTTACTGGAAGG + Intergenic