ID: 1181624916

View in Genome Browser
Species Human (GRCh38)
Location 22:24116733-24116755
Sequence GATGGCCTAGTGAACTCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 113}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181624916_1181624924 8 Left 1181624916 22:24116733-24116755 CCCCCTGAGTTCACTAGGCCATC 0: 1
1: 0
2: 2
3: 7
4: 113
Right 1181624924 22:24116764-24116786 TCAGTCCAGAGGCTCAGCTGGGG 0: 1
1: 0
2: 3
3: 33
4: 279
1181624916_1181624922 6 Left 1181624916 22:24116733-24116755 CCCCCTGAGTTCACTAGGCCATC 0: 1
1: 0
2: 2
3: 7
4: 113
Right 1181624922 22:24116762-24116784 CATCAGTCCAGAGGCTCAGCTGG 0: 1
1: 0
2: 1
3: 18
4: 164
1181624916_1181624925 9 Left 1181624916 22:24116733-24116755 CCCCCTGAGTTCACTAGGCCATC 0: 1
1: 0
2: 2
3: 7
4: 113
Right 1181624925 22:24116765-24116787 CAGTCCAGAGGCTCAGCTGGGGG 0: 1
1: 0
2: 2
3: 29
4: 333
1181624916_1181624923 7 Left 1181624916 22:24116733-24116755 CCCCCTGAGTTCACTAGGCCATC 0: 1
1: 0
2: 2
3: 7
4: 113
Right 1181624923 22:24116763-24116785 ATCAGTCCAGAGGCTCAGCTGGG 0: 1
1: 0
2: 1
3: 13
4: 164
1181624916_1181624921 -3 Left 1181624916 22:24116733-24116755 CCCCCTGAGTTCACTAGGCCATC 0: 1
1: 0
2: 2
3: 7
4: 113
Right 1181624921 22:24116753-24116775 ATCAGTACACATCAGTCCAGAGG 0: 1
1: 0
2: 0
3: 9
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181624916 Original CRISPR GATGGCCTAGTGAACTCAGG GGG (reversed) Intronic
904339347 1:29824119-29824141 GATGGCCTGGAGAACTCAGGAGG - Intergenic
911973357 1:104463726-104463748 AAAGGCCTGTTGAACTCAGGGGG - Intergenic
912208612 1:107534714-107534736 CAGGGCCTGGTCAACTCAGGAGG - Intergenic
1064244164 10:13656383-13656405 GCTGGCCCAGTGCACTCTGGAGG + Intronic
1064397222 10:14991668-14991690 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1064400119 10:15014138-15014160 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1065478227 10:26164345-26164367 GATGGCCTCTAGAACACAGGCGG + Intronic
1066248228 10:33605785-33605807 GTTGTCCTAGCTAACTCAGGAGG - Intergenic
1066390402 10:34973491-34973513 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1068624762 10:59230671-59230693 GATGCCCTGGTGACCTCAGGAGG + Intronic
1068890738 10:62146242-62146264 GAAGGCCTGATGAACTGAGGTGG - Intergenic
1071434767 10:85637445-85637467 CAAGGCCTATAGAACTCAGGAGG + Intronic
1075002089 10:118806144-118806166 GATGGCCTGGCGCACTCAGCAGG - Intergenic
1076763675 10:132618878-132618900 GATGGCCCAGTCCATTCAGGAGG + Intronic
1077589034 11:3477521-3477543 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1079466919 11:20739820-20739842 AATGGCCTAGAAAACTCAAGTGG + Intronic
1079950003 11:26790273-26790295 GATGGCATCTTGAACTAAGGAGG + Intergenic
1080898797 11:36467886-36467908 GGTGACCCAGTGAACACAGGTGG + Intergenic
1084227710 11:67727647-67727669 AAGGGCCTATTGAACTCCGGGGG - Intergenic
1084244729 11:67849144-67849166 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1084302113 11:68258678-68258700 GATGGCCAGTTGGACTCAGGGGG + Intergenic
1084847464 11:71911683-71911705 AAGGGCCTATTGAACTCTGGGGG + Intronic
1089537435 11:119169211-119169233 GGTGGCCTCGGGAACGCAGGGGG - Exonic
1091725449 12:2843484-2843506 CATGGCATGGTGAACTCAGAGGG + Intronic
1092415293 12:8286289-8286311 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1092432376 12:8419890-8419912 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1097140982 12:56902440-56902462 GATAGCCCAGTGAAATCAAGAGG - Intergenic
1098292852 12:68974331-68974353 GATGGCCTACTCAACCCAGCAGG + Intergenic
1101252336 12:102948593-102948615 GATGCCCTAGTGACTTGAGGGGG - Intronic
1103937766 12:124485643-124485665 GCGGGGCTGGTGAACTCAGGTGG - Intronic
1105869422 13:24491029-24491051 GAGGATCTATTGAACTCAGGAGG - Intronic
1107544157 13:41421456-41421478 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1118352730 14:64985110-64985132 GCTGGCCTAAAGACCTCAGGTGG - Intronic
1118624337 14:67643918-67643940 AATGGCCTAGTCATCTCAGTAGG - Intronic
1128213590 15:65918671-65918693 GAGGGCCTTGTGAACTCAGGAGG - Intronic
1128744341 15:70103098-70103120 GAAGGCCCAGTGACCTCGGGAGG - Intergenic
1133474826 16:6110744-6110766 CATGGCCTAGTGTCCTCTGGCGG - Intronic
1133873058 16:9707649-9707671 GATGGCGGAGTGAACCCAGGAGG + Intergenic
1135818403 16:25656996-25657018 GATGGCTTTTTGAACTGAGGTGG + Intergenic
1143000257 17:3790020-3790042 GATTGACTAGTGGGCTCAGGTGG - Intronic
1144227348 17:13162426-13162448 GCTGCCCTAGTGAAGTCAGGTGG - Intergenic
1148246232 17:46032532-46032554 AAGTGCCTAGTGAATTCAGGAGG + Intronic
1150435014 17:65146997-65147019 GGTGGCCCAGGGAACTGAGGAGG - Intronic
1151181053 17:72329016-72329038 GGTGGCCTCGTGCTCTCAGGAGG - Intergenic
1152145201 17:78564202-78564224 GATCCCCTAGTGAACCCTGGGGG + Intronic
1153235474 18:2982459-2982481 GATGGCATAGTAAATGCAGGAGG + Intronic
1155899860 18:31375733-31375755 GATGGGATAGTGAAGACAGGAGG + Intergenic
1157791263 18:50533259-50533281 GATGGCATATTGAACTAAGGTGG + Intergenic
1163966372 19:20750816-20750838 AAGGGCCTATTGAACTCTGGGGG - Intronic
1164481054 19:28611268-28611290 AAAGGCCTATTGAACTCTGGGGG + Intergenic
1164995437 19:32717829-32717851 GCTGGCCTAGAGAAAGCAGGAGG + Intergenic
1168633594 19:57976444-57976466 GATGGCCTAGTGATGTCATTGGG - Intergenic
927880751 2:26688386-26688408 GTTGGCCTGGTGGGCTCAGGTGG - Intergenic
928226864 2:29457180-29457202 GCTGGCCTAGTGGACTAAGTAGG - Intronic
929610697 2:43268800-43268822 TGTGGCTGAGTGAACTCAGGAGG + Intronic
932349946 2:71023607-71023629 AAGGGCCTATTGAACTCTGGGGG + Intergenic
932353441 2:71049745-71049767 AAGGGCCTACTGAACTCTGGGGG + Intergenic
933393596 2:81703924-81703946 GGTGGCCTAGCAAAGTCAGGAGG + Intergenic
936639066 2:114292249-114292271 TCTGGTCTACTGAACTCAGGAGG + Intergenic
940869526 2:158848384-158848406 AAGGGCCTATTGAACTCTGGGGG + Intronic
940872202 2:158869382-158869404 AAGGGCCTATTGAACTCTGGGGG + Intergenic
940874409 2:158885370-158885392 AAGGGCCTATTGAACTCTGGGGG + Intergenic
945294410 2:208156606-208156628 GATGTACTGATGAACTCAGGAGG - Intergenic
947595003 2:231405528-231405550 AAGGGCCTATTGAACTCTGGGGG + Intergenic
948178580 2:235962506-235962528 GAAGGCCTAGTGAGCTGGGGAGG + Intronic
948456072 2:238105221-238105243 GCTGGCCTGGGGATCTCAGGCGG - Intronic
1171408547 20:24930246-24930268 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1172803790 20:37597094-37597116 GCTGGCCTGGTGCACACAGGAGG - Intergenic
1174749929 20:53101601-53101623 GATGTGCTAGAGAACCCAGGAGG - Intronic
1181299823 22:21871735-21871757 GAAGGTCTCTTGAACTCAGGAGG + Intergenic
1181624916 22:24116733-24116755 GATGGCCTAGTGAACTCAGGGGG - Intronic
1185343308 22:50300947-50300969 CATGGCCAGGTGAGCTCAGGGGG - Intronic
952254041 3:31680334-31680356 CCTGGGCTTGTGAACTCAGGGGG + Intronic
957022501 3:75140957-75140979 AAAGGCCTATTGAACTCTGGGGG + Intergenic
957076184 3:75604895-75604917 AAGGGCCTATTGAACTCTGGGGG - Intergenic
960598727 3:119433650-119433672 AATGGCCTAGAGAATTCAGCTGG + Intronic
961272252 3:125698050-125698072 AAGGGCCTACTGAACTCTGGGGG + Intergenic
961278032 3:125742910-125742932 AAGGGCCTACTGAACTCTGGGGG + Intergenic
961876382 3:130026746-130026768 AAGGGCCTACTGAACTCTGGGGG - Intergenic
961892843 3:130144903-130144925 AAGGGCCTAATGAACTCTGGGGG - Intergenic
964306040 3:155341084-155341106 CTTGTCCTAGTGAACACAGGAGG - Intergenic
969513784 4:7634942-7634964 GATGACCTAGTGAGCTCTGAGGG - Intronic
969631705 4:8342878-8342900 GCTGGCCTGGTGGGCTCAGGAGG + Intergenic
969789067 4:9479509-9479531 AAGGGCCTATTGAACTCTGGGGG + Intergenic
969793804 4:9510277-9510299 AAGGGCCTATTGAACTCTGGGGG + Intergenic
974764506 4:66324765-66324787 GATTGCCGAGATAACTCAGGTGG - Intergenic
975498292 4:75057870-75057892 GATGGCCTATTGATGGCAGGAGG + Intergenic
981758236 4:148164849-148164871 GAAGGCCTAGTAAACTAAGCTGG - Intronic
985824325 5:2181401-2181423 GATGGCCTCGTGAAGACAGAGGG - Intergenic
986337508 5:6766480-6766502 GATGGGCTTGTGAACTGAGGCGG + Intergenic
988145480 5:27300346-27300368 GATGTCCTAGTTTATTCAGGAGG - Intergenic
1001567268 5:172707586-172707608 GAAGGCCTGCTGAACTCAGAGGG + Intergenic
1001915145 5:175554008-175554030 GAGGGTCTATTGAGCTCAGGAGG + Intergenic
1005525133 6:26639983-26640005 GATGTCCTTGTGAACAAAGGGGG - Intronic
1010958391 6:82117733-82117755 GACAGTCAAGTGAACTCAGGAGG - Intergenic
1011565351 6:88666944-88666966 AAAGGCCTATTGAACTCAGGGGG + Intronic
1019172427 6:170140596-170140618 GAAGGCCTTGTGATCACAGGAGG + Intergenic
1020307021 7:6843222-6843244 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020311497 7:6872066-6872088 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020323065 7:6954404-6954426 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1023995535 7:45157299-45157321 GATGGCCTAGAGGAGTCTGGGGG - Intergenic
1027184624 7:75963543-75963565 CAGGGCCCAGTGAAGTCAGGAGG - Intronic
1027992814 7:85384679-85384701 GATGGACTTGTGTATTCAGGTGG - Intergenic
1029078175 7:97952166-97952188 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1029428802 7:100515826-100515848 GATGGGGTGGGGAACTCAGGAGG - Intergenic
1031253298 7:119414504-119414526 GATAGTCGAGTGAACCCAGGAGG + Intergenic
1036239833 8:7072337-7072359 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1036903500 8:12689228-12689250 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1038182964 8:25246195-25246217 GATGGCCTTGTGGAGCCAGGAGG - Intronic
1038799128 8:30733386-30733408 AAGGGCCTATTGAACTCTGGGGG + Intronic
1041591170 8:59586255-59586277 GATGGACTACTGTACTCATGGGG + Intergenic
1041741281 8:61159582-61159604 GATGGACTAGATAGCTCAGGAGG - Intronic
1042323455 8:67503384-67503406 GAGGACCTGTTGAACTCAGGAGG - Intronic
1043784447 8:84380465-84380487 CATGACCTAGTAAACTCAGGTGG - Intronic
1051044674 9:12858479-12858501 TAGGGCCTAGAGAACTCAAGGGG - Intergenic
1056306851 9:85299002-85299024 GATCCCCTGGAGAACTCAGGAGG + Intergenic
1056917169 9:90756062-90756084 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1060023784 9:120154117-120154139 GATGGACTAGAGAACCCAGATGG - Intergenic
1060667399 9:125440062-125440084 GCTGGCTTAGTGAAATGAGGTGG + Intronic
1062224082 9:135439214-135439236 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1187753809 X:22497438-22497460 GGTGGCTTACTGAACTCAGCTGG - Intergenic
1195672887 X:107484177-107484199 GAGGGCCCAGTGAACTCATTTGG - Intergenic
1197713378 X:129688162-129688184 GATTGCCTAGAGAAGACAGGGGG + Intergenic