ID: 1181626924

View in Genome Browser
Species Human (GRCh38)
Location 22:24128663-24128685
Sequence GAGGAAACAGGAGTGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 873
Summary {0: 1, 1: 1, 2: 5, 3: 94, 4: 772}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181626924 Original CRISPR GAGGAAACAGGAGTGGTGGA GGG (reversed) Intronic
900031190 1:374097-374119 GAGGAGAAAGGAGAGGGGGATGG - Intergenic
900051723 1:602225-602247 GAGGAGAAAGGAGAGGGGGATGG - Intergenic
900193594 1:1362212-1362234 GAGGAGACAGTGGTGGTGGAGGG - Intergenic
900391651 1:2436388-2436410 GAGGAAGGAGGAAAGGTGGAGGG - Intronic
900391673 1:2436455-2436477 GAGGAAGGAGGAAAGGTGGAGGG - Intronic
900391708 1:2436554-2436576 GAGGAAGGAGGAAAGGTGGAGGG - Intronic
900654512 1:3748610-3748632 GAGGAACCAGGAGTACGGGAGGG + Intergenic
901556181 1:10033013-10033035 GGGGAAAGAGTAGGGGTGGAGGG + Intronic
901751465 1:11412548-11412570 GAGGGATCAGGATGGGTGGAGGG + Intergenic
901756193 1:11443006-11443028 GAGAAAAAGGGAGAGGTGGAGGG + Intergenic
902163301 1:14549861-14549883 GAGAAAACCAGAGTGGTGAATGG - Intergenic
902606301 1:17571193-17571215 GAGGAAGGAGGAGCGGAGGAAGG + Intronic
902685102 1:18071427-18071449 GAGGAGACAGAAGTGGTGATGGG - Intergenic
902853468 1:19180905-19180927 TATGAAAGAGGAGTGGAGGAAGG - Intronic
903461870 1:23526004-23526026 GAGGGGGCAGGAGTGGGGGAAGG - Intronic
904049572 1:27631185-27631207 GAGAACACAGCAGTGGGGGAGGG - Intronic
904051681 1:27643562-27643584 GAGAAAACAGGAATGAAGGAAGG + Intergenic
904269026 1:29336972-29336994 GAAGAAACAGGACTGGAAGATGG + Intergenic
904813293 1:33178153-33178175 GGGGAAACAGGAGAGGGAGAGGG - Intronic
904905262 1:33892963-33892985 GAGCAAACAGGTCTGGTGAAAGG + Intronic
905276649 1:36822855-36822877 GAGGAAACAGGAAGGGAGCAGGG - Intronic
905363526 1:37436240-37436262 GAGGATCCAGGGGTGGTGGCAGG + Intergenic
905551517 1:38844467-38844489 GAAGAAACAGGAGAGGTGGTCGG + Intronic
906168191 1:43703592-43703614 GAGGAAACAGGAAGGAAGGAGGG - Intronic
906265896 1:44429131-44429153 GAGGCAAAAGTAGAGGTGGAAGG - Intronic
906381064 1:45332469-45332491 CAGGCAACCGGTGTGGTGGATGG - Exonic
907184809 1:52601742-52601764 GAGGGAACAGGAGTGGCACAGGG - Intergenic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907551402 1:55308237-55308259 GAGGAAACTGGAGTGGGGAGGGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
907605891 1:55817154-55817176 AAGGAAAAAGGAATGGGGGAAGG + Intergenic
907660677 1:56390000-56390022 GAGAAAACAGGGAGGGTGGAGGG + Intergenic
907786973 1:57622025-57622047 TAAGAAACAGGAGAGGTGGGAGG + Intronic
907938604 1:59065501-59065523 AAGGAAACAAGAGGGGTAGAGGG + Intergenic
908717659 1:67087517-67087539 CAGCAAACAGAAGTGGTGGACGG - Intergenic
908802630 1:67896425-67896447 GAGGAAACAGGAGGTATGCAAGG - Intergenic
909286538 1:73826960-73826982 GAGGGAAAAGGAATGGGGGAGGG + Intergenic
909914011 1:81295323-81295345 AAACAAACAGGAGTGGTAGAAGG - Intergenic
910118881 1:83762042-83762064 GAGTGAACAGGAGGTGTGGAGGG - Intergenic
911029734 1:93473772-93473794 GTGGAGCCAGCAGTGGTGGATGG + Intronic
911476769 1:98382670-98382692 GAGATAACAGGAGTGGCCGATGG + Intergenic
912449764 1:109761641-109761663 GAGGAAGGGGGAGTGGAGGATGG + Intronic
912649536 1:111425532-111425554 CAGGAAACAGGAGAGATGGGAGG + Intronic
912662357 1:111543669-111543691 GAGGAAAAAGGAGAGGAGGAGGG + Intronic
913245376 1:116865910-116865932 ATGGAAACAGGAGTGGGGAAAGG - Intergenic
913305387 1:117425066-117425088 GACAAAACAGGAGAGGGGGAAGG + Intronic
914513431 1:148353912-148353934 GAGGAAAAGGGAGAGGAGGAGGG - Intergenic
914956990 1:152171797-152171819 GAGCAAAGAGGAGGGATGGAGGG + Intergenic
915150623 1:153828066-153828088 GAGACAACAGGACTGCTGGAAGG - Exonic
915171400 1:153980507-153980529 AATTAGACAGGAGTGGTGGAGGG - Intergenic
915368026 1:155326198-155326220 GAGGAAGCAGGAGGGGCAGAAGG - Intronic
915457637 1:156051244-156051266 GGTGAAGCAGGCGTGGTGGAGGG + Exonic
915613460 1:157015030-157015052 GAGGACAGAGGTGTGGTGCATGG - Intronic
915733481 1:158070176-158070198 CAGGAAGAAGGAGTGGTAGATGG + Intronic
916054596 1:161059659-161059681 GAGGAGTATGGAGTGGTGGATGG - Exonic
916288192 1:163133947-163133969 GAGGAAACAAGAGTGGCAGATGG + Intronic
916374297 1:164135263-164135285 GAGGAAACAGGACTAGAGCAGGG + Intergenic
917053267 1:170949377-170949399 GAAATAACAGGAGTTGTGGATGG + Intronic
917056189 1:170984541-170984563 CAGGATACTGGAGTGGAGGATGG - Intronic
917403535 1:174678931-174678953 TGGCAAACAGCAGTGGTGGATGG + Intronic
917724021 1:177812763-177812785 TGGCAAACAGCAGTGGTGGACGG - Intergenic
917910408 1:179638717-179638739 GGGGAAAAAGAAGTGGGGGATGG + Intronic
917954877 1:180085023-180085045 GAGGAAAGAGGAAAGGGGGAAGG - Intronic
918756506 1:188345120-188345142 GAGGAAACAGAAGAGTGGGAAGG - Intergenic
918971736 1:191428439-191428461 GAGGAAAATGGTGTGGTGGAAGG + Intergenic
919082780 1:192886797-192886819 TGGCAAACAGCAGTGGTGGATGG + Intergenic
919297456 1:195720981-195721003 AAGGAAAAAGGAGAGGAGGAGGG + Intergenic
919344469 1:196357634-196357656 GAGGAAACAGGCAGGGTGGGAGG + Intronic
919398963 1:197084917-197084939 GATGAATCAGAAATGGTGGATGG - Intronic
919759371 1:201087721-201087743 AAAGAAACAGGAGGGGTGGGGGG - Intronic
920029700 1:203029073-203029095 GGGGAAACAGCAGTGGGGGAAGG + Intronic
920117024 1:203628529-203628551 GAGGGGAAAGGAGTGGGGGAGGG + Intronic
920350194 1:205332870-205332892 GGGGAAAGAGAAGTGATGGAGGG + Intergenic
920525102 1:206660412-206660434 GAGGGAACAGGAGTTGTCGTAGG + Intronic
920530834 1:206701114-206701136 GAGCCCAGAGGAGTGGTGGAGGG + Intronic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
921171657 1:212555252-212555274 CAGGAATCCTGAGTGGTGGATGG + Intergenic
921463759 1:215461103-215461125 GAGGTAGCAGGAGTCGGGGAAGG - Intergenic
921574864 1:216823043-216823065 GAGGAAATAGGAGAGCTGGAAGG - Intronic
922620709 1:226986387-226986409 GAGGAACCCGGGCTGGTGGAGGG + Intronic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
923121721 1:230998370-230998392 GAGGCAACAGGAGTGGAGGATGG - Intronic
923777296 1:236991018-236991040 GAGGAGAAAGAAGTGGTGGTAGG - Intergenic
924678966 1:246211154-246211176 CAGGAAAGAGGAGTGAGGGAAGG + Intronic
1062806472 10:423819-423841 GAGGAAAACGGGGAGGTGGAGGG - Intronic
1063019199 10:2109400-2109422 GAGGAAAAAGTTGTGGTGGAAGG - Intergenic
1063138982 10:3240070-3240092 GAGGAAACTGGGGGGATGGAGGG - Intergenic
1063330572 10:5155065-5155087 GAGGAAATGGGAGTTGTGGTAGG + Intergenic
1063632423 10:7746445-7746467 GAGGAAAAAGGAGTGGTGATGGG - Intronic
1063901268 10:10734680-10734702 AAGGAAATAGGAGTGGAGAAAGG + Intergenic
1064115678 10:12575385-12575407 TAAGAAACAGGAGTGATGGCTGG - Intronic
1065744107 10:28823116-28823138 GAGGAAACAGGGGGACTGGAAGG - Intergenic
1065846333 10:29746737-29746759 GAGCAGACTGGAGTGGAGGAGGG - Intergenic
1067920340 10:50449353-50449375 GAGTAACCTGGGGTGGTGGAGGG + Intronic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068988851 10:63131015-63131037 CAGCAAACAGCGGTGGTGGACGG + Intergenic
1069037966 10:63665000-63665022 CAGCGAACAGCAGTGGTGGATGG + Intergenic
1069521376 10:69124232-69124254 GAGGGAAGAGGAGTGGAGTAGGG + Exonic
1070636500 10:78132443-78132465 GAGGAAACAGAACTGGGAGATGG + Intergenic
1070647711 10:78212949-78212971 GAGGAAAGAAGAGGGGTGGAGGG - Intergenic
1070806064 10:79271403-79271425 GAGGAAACTGGGGTGCAGGAAGG + Intronic
1071082706 10:81831312-81831334 CAGCAAATAGCAGTGGTGGACGG + Intergenic
1071154362 10:82672320-82672342 GAGGAGACTGGAGAGGAGGAAGG + Intronic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1071928297 10:90436738-90436760 GGGGAAAGAGGAATGGGGGAAGG - Intergenic
1072378564 10:94841392-94841414 TGGCAAACAGCAGTGGTGGACGG + Intronic
1072472439 10:95724729-95724751 TGGCAAACAGCAGTGGTGGATGG + Intronic
1072900432 10:99402289-99402311 GAGGTAACAGGATTGGTAGCTGG - Intronic
1073336128 10:102710929-102710951 AAAGAAACCAGAGTGGTGGAGGG + Intronic
1073592324 10:104769068-104769090 ATGAAAACAGGAGAGGTGGAAGG - Intronic
1073611622 10:104949270-104949292 GAGGAGACATGAGTGGTGGAAGG + Intronic
1074973333 10:118560968-118560990 GAGAAGACAGGGGTGGGGGAAGG - Intergenic
1075118119 10:119644122-119644144 GAGGAAACAGGAGCCGTAGCTGG - Intergenic
1075571211 10:123547585-123547607 GAGAAAGCAGGAGTGGTTGGGGG + Intergenic
1075610907 10:123853951-123853973 GAGAAAAAAGGAGAGGAGGAGGG - Intronic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1077018052 11:405625-405647 GATGAGAGAGGAGGGGTGGAAGG + Intergenic
1077346600 11:2060886-2060908 GAAGAAACAGGAATGGAGAATGG - Intergenic
1077446391 11:2593008-2593030 GAGACAACTGGAGTGGAGGAGGG - Intronic
1077836795 11:5933281-5933303 AAGCACACAGGAGTGGGGGAAGG - Intronic
1078153566 11:8779143-8779165 CAGGACAATGGAGTGGTGGAGGG + Intronic
1079647895 11:22890545-22890567 AGGGAAACAGGAGTTGTTGATGG + Intergenic
1079652657 11:22949683-22949705 GAGGACAGAGAAGGGGTGGAGGG + Intergenic
1079678730 11:23265149-23265171 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1080230542 11:30014748-30014770 GAGGAGACAGGAGATTTGGATGG - Intronic
1080881486 11:36325361-36325383 TAGCAAACGGCAGTGGTGGACGG + Intronic
1081069741 11:38595865-38595887 CAGCAAATAGCAGTGGTGGATGG + Intergenic
1081070858 11:38606845-38606867 CAGCAAACAGCAGTGGTGGAAGG - Intergenic
1081090082 11:38853755-38853777 GAGGAAAACAGAGTGGGGGAAGG - Intergenic
1081532469 11:43971812-43971834 GAGGCAGCACGATTGGTGGAAGG - Intergenic
1081623095 11:44630729-44630751 GAAGGAAGAGGAGAGGTGGAGGG + Intergenic
1081686340 11:45045899-45045921 GAGTGGACAGGAGTGGAGGAGGG - Intergenic
1081747219 11:45481741-45481763 GAGGAAAGAGGAAGGGAGGAAGG - Intergenic
1082208508 11:49468446-49468468 GGGGAAAGAGGAGAGGGGGATGG + Intergenic
1082767690 11:57181991-57182013 CAGGCAACAGCAGTGCTGGAGGG - Exonic
1083791773 11:64990314-64990336 GAGGAAACAGGAAATGTGGCCGG - Intronic
1084363271 11:68682997-68683019 GAGGAGACAGGACTTGGGGAGGG - Intergenic
1084597022 11:70123108-70123130 GAGGAGACAGGGATGGGGGAAGG + Intronic
1084636994 11:70399008-70399030 GAGGGAATAGGAGAGGGGGATGG + Intronic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1085038763 11:73314744-73314766 GAGGTAACAAGAGTGTGGGAGGG - Intronic
1085621391 11:78040576-78040598 CACAGAACAGGAGTGGTGGATGG - Intronic
1085621569 11:78041702-78041724 TGGCAAACAGCAGTGGTGGATGG - Intronic
1086058305 11:82674398-82674420 CAGGCAACAGAAGTGATGGATGG + Intergenic
1086554817 11:88096669-88096691 AAGGAAGCAGGAATGATGGAAGG + Intergenic
1086641108 11:89156675-89156697 GGGGAAAGAGGAGAGGGGGATGG - Intergenic
1086777263 11:90853979-90854001 GAGCAAACAGAAGGGCTGGATGG - Intergenic
1087013473 11:93534674-93534696 CAGAGAGCAGGAGTGGTGGAGGG - Intronic
1087158933 11:94930354-94930376 GAGAATGAAGGAGTGGTGGAAGG + Intergenic
1088242923 11:107789629-107789651 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1088645117 11:111911692-111911714 GCGGATCCAGGGGTGGTGGATGG + Exonic
1088993093 11:114971522-114971544 GGGGAGACAGTAGTGGTAGACGG - Intergenic
1089398294 11:118149963-118149985 GAGGAAAGGGGAGAAGTGGAGGG - Intronic
1089603367 11:119628094-119628116 GAGGAGACAGGACTGCTGGGAGG - Intronic
1089612532 11:119677478-119677500 GAGGAGAAAGGAGAGGAGGAGGG + Intronic
1089882920 11:121792182-121792204 GATGAAATAGGAGGGGTGGAAGG + Intergenic
1090108188 11:123874496-123874518 GAGGAATCAGGAAGGGGGGAGGG - Intergenic
1090206538 11:124887392-124887414 GAGGAAAGAGGGGTGCTGGAGGG + Exonic
1090517644 11:127446088-127446110 GAGGAAACAGGTGAGGTAGGTGG + Intergenic
1090635850 11:128690216-128690238 GAGAAAACCGGAGGGGTGGGCGG - Intronic
1091193283 11:133711924-133711946 TAGGGAACAGAAGTGGTGGTGGG - Intergenic
1091369969 11:135049605-135049627 GAGGAAACAGGCTTAGTGGAAGG + Intergenic
1091442464 12:522022-522044 GTGGAAAGAGGAGGGGTGGCAGG - Intronic
1092095845 12:5841318-5841340 GTGGACACAGGTGGGGTGGAGGG - Intronic
1093106666 12:15095461-15095483 TGGCAAACAGCAGTGGTGGACGG + Intergenic
1094083777 12:26566232-26566254 GAGGAAAGAGGAGAGGTGAGAGG + Intronic
1094640992 12:32275642-32275664 TGGCAAACAGCAGTGGTGGACGG - Intronic
1096218112 12:49809467-49809489 CAGGGACCAGGAGTGGGGGAGGG + Intronic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1097376748 12:58852228-58852250 CAGCAAACAGCAGTGGTGGGCGG + Intergenic
1097377757 12:58859357-58859379 CAGCAAACAGCAGTGGTGGGCGG + Intergenic
1097740530 12:63236654-63236676 GAGGTAACAGGAATTGTTGATGG - Intergenic
1097840840 12:64319958-64319980 CGGCAAACAGGAGTGGTGGACGG - Intronic
1098066937 12:66628470-66628492 GAGGAAGCAGGAGAGGAGGAGGG - Intronic
1098398992 12:70053238-70053260 GAGGAAGCAGGACTGGTCAAGGG - Intergenic
1098429952 12:70408231-70408253 GAGGAAACAGGAGTGCTGTTTGG + Intronic
1098639878 12:72825637-72825659 CAGCAAACAGCAGTGGTAGACGG + Intergenic
1098984869 12:77001448-77001470 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1099292613 12:80790072-80790094 GGCAAAACAGCAGTGGTGGATGG - Intergenic
1100773549 12:97950114-97950136 TGGGAAACAGGGGTGGGGGATGG + Intergenic
1101242009 12:102848309-102848331 CAGGAGACTGGAGAGGTGGAGGG + Intronic
1101242036 12:102848449-102848471 CAGGAGACTGGAGAGGTGGAGGG + Intronic
1101242050 12:102848519-102848541 CAGGAGACTGGAGAGGTGGAGGG + Intronic
1101242113 12:102848868-102848890 CAGGAGACTGGAGAGGTGGAGGG + Intronic
1101651109 12:106677737-106677759 GAGGCAACAAGACTGGTGGCAGG + Intronic
1101843196 12:108342254-108342276 GAGGGAAGAGGAGAGGAGGAGGG + Intergenic
1102422744 12:112817001-112817023 GAGGAAACTGAGGTGTTGGAAGG + Intronic
1102454962 12:113065539-113065561 GAGGAAGCTGGAGAGGAGGAGGG - Intronic
1102464514 12:113120597-113120619 GATGAGAGAGGAGTGGGGGAAGG + Intronic
1102834542 12:116042310-116042332 AAGGAAACTTGAGTGTTGGAAGG + Intronic
1102929008 12:116848529-116848551 GAGGTCACAGAAGTGATGGAGGG - Intronic
1103037396 12:117667494-117667516 GTGTGAACAGGAGGGGTGGAAGG + Exonic
1103168221 12:118789290-118789312 CAGGAAACAGCAGTGGGTGATGG - Intergenic
1104050856 12:125192719-125192741 GTGGAAACAGCAGATGTGGAAGG + Intronic
1104233770 12:126911683-126911705 GCGGAACCAGGAGTGATGGCAGG + Intergenic
1104850971 12:131873564-131873586 CAGCAAGCAGCAGTGGTGGATGG + Intergenic
1104982838 12:132581867-132581889 GAGGACACAGGCATGGGGGAGGG - Intronic
1105032471 12:132893512-132893534 AAGGAAAGAGGAGTGGGGAAAGG - Intronic
1105334227 13:19449903-19449925 AAGGAAAGAGGAGAGGAGGAAGG - Intronic
1105860697 13:24409451-24409473 AAGGAAAGAGGAGAGGAGGAAGG + Intergenic
1106093816 13:26624405-26624427 GAGGAAAGTGGAGTGGGGAAGGG + Intronic
1106352288 13:28943773-28943795 GAGGAAGCTGGAGGGGTGGCTGG + Intronic
1107156430 13:37172407-37172429 CAGCAAACAGCAGTGGCGGAGGG + Intergenic
1107310269 13:39069918-39069940 AAGGAAAAAGGAGAGGTTGAGGG - Intergenic
1107488374 13:40854488-40854510 AAGGAAAGAGGAGAGGAGGAAGG - Intergenic
1107594817 13:41952037-41952059 GAGGAAAAGGGAGCGGTGCACGG - Intronic
1107753924 13:43599132-43599154 AAGGAAGCATGATTGGTGGAGGG - Intronic
1107999444 13:45892761-45892783 GAGGAAAGGGGAGTAGGGGAGGG + Intergenic
1108197570 13:48010169-48010191 GAGGAAACTGGAGTTTTTGAGGG + Intergenic
1108876192 13:55054003-55054025 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1108877212 13:55061318-55061340 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1109931290 13:69221993-69222015 CAGCAAACAGTAGTGGTGGACGG - Intergenic
1110440695 13:75522117-75522139 GAGGAGAGAGAGGTGGTGGAAGG - Intergenic
1110987077 13:81984444-81984466 TAGCAAACAGCAGTGGTGGATGG + Intergenic
1110995165 13:82098075-82098097 GAGAAAACAGGACTGTTGGTGGG + Intergenic
1111021439 13:82457681-82457703 AGGCAAACAGCAGTGGTGGATGG - Intergenic
1111195949 13:84874545-84874567 GGGAAAACATGTGTGGTGGAAGG + Intergenic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1111830722 13:93325737-93325759 GAGAAAAAAAGAGTGATGGAGGG + Intronic
1111910276 13:94303076-94303098 CAGCAAACAGCAGTGGTGGATGG + Intronic
1113087980 13:106587317-106587339 GAGGAAACATTAGGGGTGAAGGG - Intergenic
1114383847 14:22236732-22236754 TGGCAAACAGCAGTGGTGGATGG - Intergenic
1114384823 14:22243779-22243801 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1114602584 14:23968827-23968849 GGGGAAACAGTGGTGGTGGGTGG + Exonic
1114606953 14:24005956-24005978 GGGGAAACAGTGGTGGTGGGTGG + Exonic
1114616711 14:24072356-24072378 GATGGAAAAGGAGTGGTGGTGGG - Intronic
1114881771 14:26795202-26795224 GAGGAAAGAGTATTTGTGGATGG + Intergenic
1116688019 14:48067650-48067672 GAGGAAACAAGACTGGAGGCAGG - Intergenic
1117171807 14:53108124-53108146 TGGCAAACAGCAGTGGTGGATGG - Intronic
1117322565 14:54637708-54637730 GAGGAATGAGCAGGGGTGGAAGG + Intronic
1117341477 14:54795812-54795834 GAGGTAACGGGACTGGTGGTGGG + Intergenic
1118680022 14:68231316-68231338 GAGAAAACAAGATTGGAGGAAGG - Intronic
1118908858 14:70044722-70044744 GAGGGACCAGGAGAGGTGAAGGG + Exonic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1119288595 14:73476249-73476271 GTGGAAACAGGAGAGGGGAAAGG + Intergenic
1119328000 14:73773504-73773526 GGAGAAACCTGAGTGGTGGAGGG - Intronic
1119647021 14:76355340-76355362 AGGGAAACATGAGTGGTGAAAGG - Intronic
1120107987 14:80517978-80518000 CAGCAAACAGCAGTGGTGGACGG + Intronic
1120397381 14:83985581-83985603 GCGCAAACAGCAGTGGTGGATGG - Intergenic
1120531571 14:85638471-85638493 GAAGAACCAGGACTGGTAGAGGG - Exonic
1121170991 14:91854442-91854464 GAGGAGATAGGAGAGGGGGAGGG + Intronic
1121571047 14:94946782-94946804 GAGGGAAGAGGACTGGCGGAGGG + Intergenic
1121732754 14:96197871-96197893 GAAGACACAGGAGTGGGGGTTGG - Intergenic
1122854648 14:104554283-104554305 GAGGAGACAGGAGGGCAGGAGGG + Intronic
1123125452 14:105942865-105942887 GGGCAAACAGCAGTGGTGGACGG - Intergenic
1123587457 15:21772713-21772735 GGGGAGAGAGGAGTGGGGGACGG + Intergenic
1123624095 15:22215278-22215300 GGGGAGAGAGGAGTGGGGGACGG + Intergenic
1124047223 15:26161469-26161491 GAGGAACCAAGACTGGAGGAAGG + Intergenic
1126153889 15:45547395-45547417 CAGCGAACAGCAGTGGTGGATGG + Intergenic
1126370682 15:47943393-47943415 GAGGAAAAAGGAAAGGAGGAAGG + Intergenic
1126393495 15:48185780-48185802 GAGGAAAAAGGAGGAGTGAATGG + Intergenic
1126482444 15:49140964-49140986 AAGAAAACAGCAGAGGTGGATGG + Intronic
1126814204 15:52438858-52438880 TGGCAAACAGCAGTGGTGGACGG - Intronic
1127473350 15:59309967-59309989 GAGGAAAGGGGAGTAGTCGAGGG - Intronic
1127530321 15:59837385-59837407 GAAGAAACAGGAGTTGTTCAAGG + Intergenic
1127646582 15:60964807-60964829 GAGGAAAGGGAAGTGGTGGCTGG + Intronic
1127821137 15:62657162-62657184 GAAGCAACAGCAGTGATGGATGG + Intronic
1128090927 15:64918420-64918442 GAGGAGACAGGATTGGGGAATGG - Intronic
1128312127 15:66637366-66637388 GAGGAGACAGGAGAGGTGGGAGG + Intronic
1128363113 15:66976484-66976506 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1129462987 15:75709322-75709344 GAGGCAAGAGGAGAGCTGGATGG + Intronic
1129667254 15:77586233-77586255 GAAGAGACAGGAGTGGAGGCAGG + Intergenic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1130061766 15:80575496-80575518 GTGGGAACACGAGTGGTGGCAGG - Intronic
1130213955 15:81951298-81951320 AAGGAAACAGGAGTGAAAGAAGG - Intergenic
1131244116 15:90775134-90775156 GTGGAAACAGCAGAAGTGGAAGG + Intronic
1131292501 15:91118841-91118863 GAGGAACCAGAAATGGAGGAAGG - Intronic
1131420109 15:92298265-92298287 CAGCAAATAGCAGTGGTGGACGG - Intergenic
1131493146 15:92880428-92880450 GAGCAAACAAGAGAGCTGGAGGG + Intergenic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1132000323 15:98172956-98172978 GAGGAAGCAGGAGAGAAGGAAGG - Intergenic
1132833491 16:1941230-1941252 GAGGCCACAGGGGTGGGGGAGGG - Intronic
1133297604 16:4762532-4762554 GAGGAATGAGAAGTGGTGCAGGG - Intronic
1133539138 16:6731788-6731810 TAGGAAACAGCAGTGGGGAAGGG - Intronic
1134224205 16:12379086-12379108 CAGGAAACAGGAGTGGAGTATGG - Intronic
1134370670 16:13621307-13621329 GAGAAAATAGGATTGGTAGAAGG - Intergenic
1135068916 16:19335341-19335363 CAGGAACCAGAAGGGGTGGACGG + Intergenic
1136056696 16:27695136-27695158 GAGGCAACAGCGGTGGAGGAGGG - Intronic
1136069984 16:27781986-27782008 GAGCAAGCAGGATTGGTGAACGG - Intergenic
1136683620 16:31981828-31981850 GGGGGAACAGGAGTGGTGAGAGG - Intergenic
1136784249 16:32925388-32925410 GGGGAAACAGGAGTGGTGAGAGG - Intergenic
1136885535 16:33928418-33928440 GGGGAAACAGGAGTGGTGAGAGG + Intergenic
1138315244 16:56064130-56064152 CAGGAAACAGGAGTGGGAAAGGG - Intergenic
1138410332 16:56834230-56834252 GAGGAAATAGAAGTACTGGAGGG - Exonic
1138544385 16:57706985-57707007 GGGGAAAGAGGATTGGAGGAAGG - Intronic
1138547243 16:57727239-57727261 GGGGTTACAGGAGTGGAGGAGGG + Intronic
1139869296 16:70091502-70091524 GAGAAAAAATGAGTGGTGGGAGG + Intergenic
1140026721 16:71297614-71297636 GAGGAAAAAGGAGGGGAGGAGGG - Intergenic
1140386087 16:74540637-74540659 GAGAAAAAATGAGTGGTGGGAGG - Intronic
1141298453 16:82791595-82791617 CAGCAAACAACAGTGGTGGATGG - Intronic
1141367689 16:83458360-83458382 GAGGAATTAGGAGAGGTGGAAGG - Intronic
1142152091 16:88517135-88517157 GAAGAAACACTCGTGGTGGATGG + Intronic
1142209961 16:88804158-88804180 GGGGAAACAGGCGGGGGGGACGG + Intronic
1203086906 16_KI270728v1_random:1189394-1189416 GGGGAAACAGGAGTGGTGAGAGG - Intergenic
1142547411 17:714578-714600 GGGGAAACGGGAGTGCGGGAGGG - Intronic
1142597167 17:1035447-1035469 GGGGGAACAGGTGTGGGGGATGG - Intronic
1142735935 17:1899597-1899619 CAGGAAACAGAAGTGGGGGAGGG - Intronic
1143379480 17:6487116-6487138 GAAGAACCAGGAGTGATGGCAGG + Intronic
1144556916 17:16290377-16290399 AAGGGAAGAGGAGTGGAGGAAGG - Intronic
1146260449 17:31417071-31417093 GAGGGAACAGGAGAGGGAGAGGG - Intronic
1146318537 17:31828197-31828219 GAGGAAACAGGAGTGTTTGATGG + Intergenic
1147282473 17:39373529-39373551 GAGAAAACAGGAGTGGCAGCTGG - Intronic
1147959310 17:44156605-44156627 TAGGAAATAGGAGTGGGGAAGGG - Intronic
1148395001 17:47300781-47300803 TGGGAAGCAGAAGTGGTGGATGG - Intronic
1148774725 17:50088909-50088931 GAGGAAGAAGGAGTTGAGGAAGG - Intronic
1148826730 17:50399327-50399349 CAGCAAACAGCAGTAGTGGACGG + Intergenic
1148905593 17:50909893-50909915 GAGGGCACAGGAGTGGTGGAAGG - Intergenic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1149302918 17:55321200-55321222 GAGGAGGCAGGAGTGAAGGAGGG - Exonic
1149625277 17:58075200-58075222 GTGGAAAGAGGAGAGGGGGAGGG + Intergenic
1150466831 17:65400717-65400739 AAGGAAACAGGAGGGAGGGAAGG - Intergenic
1151224445 17:72638348-72638370 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1151940309 17:77287841-77287863 CAGGAAACAGGAGTGGCGCAGGG + Intronic
1152002337 17:77654594-77654616 GAGCAGACAGGAGGGGTGGGAGG - Intergenic
1152741605 17:82020850-82020872 GTGAACACAGGAGTGGTGGGTGG + Intronic
1152948463 17:83211616-83211638 GAGGAGAAAGGAGAGGGGGATGG + Intergenic
1153400773 18:4682045-4682067 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1155143383 18:23063661-23063683 GAGAAAACAGGAATTCTGGAGGG - Intergenic
1157193260 18:45598777-45598799 GAGGAGCCTTGAGTGGTGGAGGG - Intronic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158086886 18:53661924-53661946 GGGGAAACAGGAGTGTTACATGG - Intergenic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158185298 18:54764630-54764652 GAGAGAATAGGATTGGTGGAGGG - Intronic
1158195461 18:54880597-54880619 GAGGAACCAGCAGTGTTGAAGGG - Intronic
1158203282 18:54963354-54963376 GATGAAGCAGGAGGGGTGGATGG - Intergenic
1158294751 18:55983429-55983451 GATGAAAAAGAAGAGGTGGAGGG - Intergenic
1158397767 18:57093003-57093025 GAGGACAGATGAGTAGTGGAGGG - Intergenic
1158516911 18:58138365-58138387 GAGGAAAGAGGAGGAGGGGAGGG - Intronic
1158810102 18:61021983-61022005 GATGAAAGAAGAGTGGTAGATGG - Intergenic
1159916566 18:74193683-74193705 GATGGAAGAGGGGTGGTGGAGGG - Intergenic
1159934060 18:74347289-74347311 GAGGAAGCAAGAGTGGAGAAAGG + Intronic
1160486344 18:79296681-79296703 TATGAAACAAGGGTGGTGGAAGG - Intronic
1160518552 18:79491459-79491481 GAGGAAACAGGAGAGAAGTAAGG + Intronic
1160827666 19:1088350-1088372 GAGGGAAGACGAGGGGTGGAAGG + Exonic
1161852122 19:6743093-6743115 GATGAAACAGGAGAGGAAGATGG + Exonic
1162162907 19:8731904-8731926 GAGGAATCCGGAGGTGTGGATGG + Exonic
1162195216 19:8979448-8979470 GAGGGAACAGAAGTGGTGATAGG + Exonic
1163285244 19:16342767-16342789 AAGGAAACCGGTGTGGTGGAGGG - Intergenic
1163407111 19:17129622-17129644 GAGGAAACAGAAGTGCTGAAAGG - Intronic
1163779676 19:19239792-19239814 GAGAAAAGAGGAGGAGTGGAAGG - Intronic
1163944238 19:20521174-20521196 ATGGAAAGAGGAGTGGTGAAAGG + Intergenic
1164173170 19:22745520-22745542 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1164667546 19:30051523-30051545 GAGGAAACAGAAAAGGAGGAGGG - Intergenic
1164856444 19:31528310-31528332 GAGCAAACAGAACTTGTGGAAGG + Intergenic
1165760698 19:38319802-38319824 GAGGAAAAAGGGGAGGTGGGGGG - Intergenic
1166241814 19:41499699-41499721 GAGGAAACGAGAGTGGGGGTGGG + Intergenic
1166535123 19:43568740-43568762 GAGGGAGCAGGAGTTGGGGAGGG + Intronic
1166535129 19:43568758-43568780 GAGGGAGCAGGAGTTGGGGAGGG + Intronic
1166769076 19:45269749-45269771 GAGGAAACAGAAGCTGTGGGAGG - Intronic
1167270166 19:48501928-48501950 GAGGAGTCAGGAGAGGAGGAGGG - Intronic
1167270249 19:48502150-48502172 GAGGAACCAGGGGAGGGGGAGGG - Intronic
1167305154 19:48703885-48703907 GAGGAAAGGGGAGTCGGGGAGGG - Exonic
1167317814 19:48776269-48776291 GAGGGCACAGGGGAGGTGGAAGG - Intergenic
1167599423 19:50445722-50445744 GAGGCATCTTGAGTGGTGGACGG - Intronic
1167674848 19:50877701-50877723 GAGGAGTCAGGAGCTGTGGATGG + Intronic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
925023807 2:592583-592605 CAGCAAACAGCAGTGGTGGAGGG - Intergenic
926104152 2:10139835-10139857 GAGGATCCAGGGGTGGAGGAAGG - Intergenic
926225859 2:10966445-10966467 GAGGAAAGAGGGTTGTTGGAAGG - Intergenic
926705767 2:15836359-15836381 GAGGAAACAGAAGTGGGTCAGGG + Intergenic
926884897 2:17588022-17588044 CACAAAACAGGACTGGTGGAAGG - Intronic
927089777 2:19701400-19701422 GAGGCAAGAGGCCTGGTGGATGG + Intergenic
927307723 2:21592629-21592651 GAGGAAACAGGCATATTGGATGG - Intergenic
928394172 2:30931433-30931455 GAGGAAAAAAGAGTGGATGAAGG + Intronic
929450661 2:42034927-42034949 GAGGACAGAAGGGTGGTGGAGGG + Intergenic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
930183820 2:48390972-48390994 GAGGTTACAGGAGTGGGGCAGGG - Intergenic
930415164 2:51081596-51081618 GAGGTAACAGGTTTGGAGGAAGG - Intergenic
930599840 2:53430258-53430280 GAGAAAACAGGAGAGATGAAAGG + Intergenic
930767350 2:55097548-55097570 AAGGAGACAGCAGTGGGGGAAGG + Intronic
930852612 2:55976565-55976587 GAGGAAACTGGAGAGGTGGGAGG + Intergenic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
931212552 2:60211800-60211822 GAGGAAACATCAGTGAGGGAAGG + Intergenic
931289787 2:60862308-60862330 GAGGAAACAGGAGTGCATGGGGG + Intergenic
931627688 2:64271626-64271648 GATCAGACAGGAGTGGTAGAAGG + Intergenic
931981034 2:67694495-67694517 GAGGAGAGAGGAGTGGGGGAAGG + Intergenic
932514642 2:72333483-72333505 GAAGAAACAGGAGGGTGGGAGGG + Intronic
932675619 2:73778544-73778566 GGGGAAACAGGAGAGAAGGACGG - Intronic
932774404 2:74518901-74518923 GAGGAGACAGGATTTGTGGAAGG - Intronic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
933321559 2:80781584-80781606 GAGGAAACTGGAGTGGGGCCTGG - Intergenic
933476105 2:82792697-82792719 GAGGAAACAAGAGTGTTCGGGGG - Intergenic
933766449 2:85712528-85712550 GTGGAACCAGAAGTGGAGGATGG + Intergenic
934673725 2:96234411-96234433 CAGGAGACAGGAATGGAGGAGGG - Intergenic
935535209 2:104285639-104285661 AAGGGAAAAGAAGTGGTGGAGGG - Intergenic
935698680 2:105791368-105791390 GAGTGACCAGGTGTGGTGGAAGG + Intronic
935700762 2:105809881-105809903 GAAGAAGAGGGAGTGGTGGAAGG + Intronic
935748347 2:106209327-106209349 CAGCAAACAGCAGTGGTGGATGG - Intergenic
936060579 2:109293238-109293260 GAGGACAGAGGGATGGTGGAGGG + Intronic
937187525 2:120058562-120058584 GATCAAAAAGGATTGGTGGAGGG + Intronic
937357354 2:121206414-121206436 GAGGCAAGAGGATTGCTGGAAGG - Intergenic
937632442 2:124118582-124118604 GAGGAAATAAGGGTAGTGGAAGG + Intronic
937919853 2:127121304-127121326 GAGGTAACAGGAAACGTGGAGGG + Intergenic
938000164 2:127727477-127727499 GAAGAAACAGAAGGGCTGGAAGG + Intronic
938378646 2:130824445-130824467 GAAGAAACAGTCCTGGTGGATGG - Intergenic
938641256 2:133282854-133282876 GAGGAAACAGGAATTCTGGTAGG - Intronic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
939419043 2:141942216-141942238 GAGAAAAGATGTGTGGTGGAGGG - Intronic
939731886 2:145795014-145795036 GAGTAACCAGGAGGGCTGGATGG - Intergenic
939888023 2:147702566-147702588 GAAGAAACCTGAGTGGTTGAAGG + Intergenic
940110956 2:150153502-150153524 GAGGAAAGAGGAATTGGGGAGGG + Intergenic
940524780 2:154799463-154799485 GAGGAAGGAGGAGGGGTGGTGGG + Intronic
940669037 2:156645140-156645162 TGGCAAACAGCAGTGGTGGATGG - Intergenic
940722290 2:157295153-157295175 TAGGAGACAGGAGTGGGGAATGG - Intronic
941587001 2:167372456-167372478 GGGGGAATAGAAGTGGTGGAAGG - Intergenic
941785301 2:169491629-169491651 GAGGAAAAAGGACAGGGGGAGGG - Intronic
942338176 2:174914117-174914139 GAGGAAACAGAAGACCTGGATGG - Intronic
942679484 2:178462535-178462557 TGGCAAACAGCAGTGGTGGACGG - Intergenic
943119975 2:183723710-183723732 GGGTCCACAGGAGTGGTGGATGG + Intergenic
944250880 2:197579354-197579376 GAAGAAAGAGGAATGGAGGATGG - Intronic
944940759 2:204623443-204623465 AAGGAAAAAGGGATGGTGGAGGG - Intronic
945118158 2:206429846-206429868 GAGGAGACAGGAGCAATGGAGGG + Intergenic
945189492 2:207172108-207172130 GAGAAAATAGGAGTAGGGGAAGG - Intergenic
945287022 2:208093021-208093043 GAGGAAAGCAGAGTGGAGGAAGG + Intergenic
946109601 2:217403023-217403045 AAAGAAAAAGGAGGGGTGGAAGG - Intronic
946446164 2:219741429-219741451 GAGGAATCAGGAGTTGGGGCAGG + Intergenic
947222588 2:227807851-227807873 GAGACAACAGGAATGGAGGAAGG + Intergenic
948454607 2:238099002-238099024 GGGGAAGCAGGAGGGGTGGTGGG - Exonic
948575793 2:238948702-238948724 GTGGGGACAGGAGTGGAGGAGGG - Intergenic
948856352 2:240732246-240732268 GATGAAACATGAGGGGAGGAGGG + Intronic
948958256 2:241312048-241312070 GAGGAAACATGATTAGGGGAAGG + Intronic
1169192289 20:3666063-3666085 GAGGAAAGAGGGGTGAGGGAAGG + Intergenic
1169211484 20:3768249-3768271 GTCGAAACAGGAGTGATGGAGGG - Intronic
1169790251 20:9402583-9402605 GAGGAAACAGGAGTGGAAGCAGG + Intronic
1169905638 20:10600485-10600507 AAGGAGACAGCAGTGGTTGATGG + Intronic
1170821335 20:19758153-19758175 GAGGAAAGAGGAGGAGGGGAGGG - Intergenic
1170928436 20:20746698-20746720 GAGGAAAGAGGAGGAGAGGAGGG + Intergenic
1171022520 20:21599083-21599105 TAGGAAACAGGAATTATGGAGGG + Intergenic
1171339841 20:24419342-24419364 GAGGGAACAGGAGAGGTTGCTGG - Intergenic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1172204457 20:33153038-33153060 GAGAAAGCAGGAGTGGGGGAAGG - Intergenic
1172499069 20:35412177-35412199 AAGGAGACAGGCGTGGGGGAAGG - Intergenic
1172780177 20:37431958-37431980 GAGGACACAGCCCTGGTGGAGGG - Intergenic
1172944849 20:38679125-38679147 GAGGAGAGAAAAGTGGTGGATGG - Intergenic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1173065220 20:39704114-39704136 GGGGAAACAAGAGGGGTGAAGGG + Intergenic
1173088564 20:39948636-39948658 GAGCAAACAGAATGGGTGGAAGG - Intergenic
1174641636 20:52049661-52049683 GAAGAAAAAGGAGTGGTAGTGGG - Intergenic
1175057274 20:56209686-56209708 GTGGAATAAGGAGTGGGGGAAGG + Intergenic
1175141162 20:56861075-56861097 GAGGAAAGAAGAGTGGTGAGAGG + Intergenic
1175424300 20:58854331-58854353 GAGGAAGCAGCAGAGATGGAAGG + Exonic
1175625199 20:60483904-60483926 GAGGAAGCAGGTGTGGGGGTGGG + Intergenic
1175674478 20:60934938-60934960 GCGGAAAGGGGAGGGGTGGATGG - Intergenic
1176125509 20:63472936-63472958 GGGGAGACAGGAGTGGAGGGGGG + Intergenic
1176149968 20:63585772-63585794 GAGGACACAGGAGTGGGGAGTGG - Intergenic
1176520400 21:7819871-7819893 GTGGAGATTGGAGTGGTGGATGG - Intronic
1176738831 21:10578756-10578778 AAGGAAAGAGGAGAGGAGGAAGG + Intronic
1177263980 21:18760153-18760175 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177507037 21:22032778-22032800 GAAGAAACAGGATTGGCAGAGGG + Intergenic
1177809800 21:25914067-25914089 TAGAAAACAGGAAAGGTGGAAGG - Intronic
1177829821 21:26125511-26125533 CAGTAAACAGGAGTGGAGGTAGG + Intronic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1178413061 21:32381805-32381827 GAGGAAACTGAAAAGGTGGAGGG + Intronic
1178654423 21:34449883-34449905 GTGGAGATTGGAGTGGTGGATGG - Intergenic
1179259613 21:39746277-39746299 TGGCAAACAGCAGTGGTGGACGG + Exonic
1179268931 21:39833232-39833254 GGGGAAACAGGAGCCGGGGAAGG - Intergenic
1179482008 21:41684486-41684508 GAGGAGCCAGGAGAGGTGGGTGG + Intergenic
1179622889 21:42630439-42630461 GTGGCCACAGGTGTGGTGGAGGG + Intergenic
1179908890 21:44437767-44437789 GAGGAAACAGGAGCTGTTGGAGG - Intronic
1180047074 21:45311923-45311945 GAGCCAAGAGGATTGGTGGATGG - Intergenic
1180064732 21:45406347-45406369 GAGGAAGCAGGAAAGGGGGAGGG + Intronic
1180632196 22:17237385-17237407 CAGAAAACAGGAGAGGAGGAGGG + Intergenic
1181428522 22:22860379-22860401 AAGGAGACAAGATTGGTGGAGGG + Intronic
1181626924 22:24128663-24128685 GAGGAAACAGGAGTGGTGGAGGG - Intronic
1182221360 22:28761554-28761576 GGCAAAACAGCAGTGGTGGATGG - Intergenic
1182267281 22:29127291-29127313 GAGGAAAGAGGAGTAGTGTGAGG + Intronic
1182592101 22:31389450-31389472 GAGGGAAGAGGAGGGGAGGAAGG - Intergenic
1182782784 22:32881223-32881245 GAGGAGAGAGGAGTGGGGGAAGG + Intronic
1183178948 22:36245533-36245555 GAGGACACATGAGTGGGAGAGGG + Intergenic
1183210785 22:36449949-36449971 GAGGAAAGAAGGGTGGTTGAGGG - Intergenic
1183347339 22:37315124-37315146 GAGCAGCCAGGGGTGGTGGAAGG + Exonic
1183442486 22:37831025-37831047 CAGGAAACTGGAGTTGAGGAGGG - Exonic
1184095602 22:42314660-42314682 GAGCAGACAGGAGGGGTGCAGGG - Intronic
1184161135 22:42697943-42697965 GAGGAGAGAGGAGAGGTGCAGGG + Intronic
1184328591 22:43811333-43811355 GAGGAGAGAGGAGGGGAGGAAGG + Intronic
1184646168 22:45896595-45896617 GAGGAGGCAGGAGGGGAGGAAGG + Intergenic
1185109557 22:48893508-48893530 GAGGAAACAGGAGGGAGCGAGGG + Intergenic
949718708 3:6964037-6964059 AAGGAAATAGGGGTGGTGGATGG - Intronic
949736453 3:7177594-7177616 GAGGAGACAGGAGAGTTAGATGG + Intronic
949811676 3:8012972-8012994 CAGCAAACAGCAGTGGTGGATGG + Intergenic
950528235 3:13537030-13537052 GAGGAAGCAGGAGTCGGGGGAGG + Intergenic
951016256 3:17735811-17735833 CAGCAAACAGCAGTGGTGGATGG + Intronic
951326078 3:21303135-21303157 CGGAAAACAGCAGTGGTGGATGG + Intergenic
951732306 3:25823802-25823824 CAGGAAGCAGGGGTGGAGGATGG + Intergenic
952297117 3:32071383-32071405 ATGGAAACAGGAGTGGGGAAAGG - Intronic
952405154 3:32998682-32998704 GAGGAAAGAGGAATGGAAGAAGG + Intronic
952728597 3:36615847-36615869 GAGCAAACAGGAGATGAGGATGG + Intergenic
953110823 3:39936411-39936433 GAGGAAACAGGAATGGGAGAAGG + Intronic
953317647 3:41943591-41943613 GAGGAAAGAGGAGGTGTGAATGG - Intronic
953410604 3:42688584-42688606 GAGGAGACGGGAGTGGGGGTGGG - Intronic
953918968 3:46938886-46938908 GAGGAAACAGGATTAGGGAAAGG - Intronic
954036685 3:47854638-47854660 GAGGAAAGAGGAGAGAGGGAAGG + Intronic
954161541 3:48726387-48726409 ATGGAAACAGGAGTGGGGAAAGG + Intronic
954685512 3:52368050-52368072 GAGGAAACATCAGTGGTGAGGGG + Intronic
954992921 3:54856432-54856454 GAGGAAAAAGGAAGGGAGGAAGG - Intronic
954997080 3:54891639-54891661 GAGGAACAAAGGGTGGTGGAAGG - Intronic
955381279 3:58440224-58440246 TGGCAAACAGCAGTGGTGGACGG + Intergenic
955446395 3:59015552-59015574 GAGGAAGGAGGAGGGTTGGAGGG + Intronic
955625755 3:60917530-60917552 GAGGAGAAAGAAGTGGTAGATGG - Intronic
955889041 3:63631251-63631273 GAGGAAACAGGAGGGGTAACAGG - Intergenic
955916689 3:63913522-63913544 GGAGAAACAGGAGTAGAGGAAGG + Intronic
956240402 3:67123669-67123691 GAGGAAACAGGAGAGAGGGCAGG + Intergenic
956548776 3:70436930-70436952 ATGGAAACAGGAGTGGGGAAAGG + Intergenic
956798973 3:72739769-72739791 AAGGAAACAGGAGTGGGGCAGGG + Intergenic
957000509 3:74877945-74877967 CAGCAAACAGCAGTGGTGGATGG + Intergenic
957193622 3:77040153-77040175 TTGGAAACCGGAGAGGTGGAGGG + Intronic
957279269 3:78128600-78128622 GATGAATGAGGAGTGGTGGATGG - Intergenic
957451657 3:80388524-80388546 ATGGAAAGAGGAGTGGTGGAAGG - Intergenic
957687039 3:83515284-83515306 CAGCAAACAGCAGTGGTGGACGG - Intergenic
958457051 3:94345318-94345340 CAGTGAACAGCAGTGGTGGACGG + Intergenic
958825608 3:99026687-99026709 GAAGCATCAGGAGTGCTGGAAGG + Intergenic
959019908 3:101177674-101177696 GAGGAAAGAGGAGAGAAGGAGGG - Intergenic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
960334098 3:116394722-116394744 GAGGAAGCAGGAATGGGGCAAGG - Intronic
960870455 3:122244047-122244069 GAGGAAGCAGGGGTGGTTAATGG + Intronic
960906451 3:122606532-122606554 GAGGAAACAGTAGGAGAGGAGGG - Intronic
960995160 3:123335822-123335844 GGGGAAACAGCAGTGGTTGGGGG - Intronic
962315290 3:134355529-134355551 GTGGGAAAAGGAGTGGGGGAAGG + Intergenic
962436369 3:135370796-135370818 GAGGAAGCTAGAGTGTTGGATGG - Intergenic
962502418 3:136008969-136008991 GAGGAAAGTGGGGTGGGGGATGG - Intronic
962708722 3:138068166-138068188 GAGGAAGGAGGGGTGCTGGAGGG + Exonic
962712975 3:138102919-138102941 GTGGAAGCAGGAGTGGAGGCAGG + Intronic
962977535 3:140458621-140458643 GAGGCAGCAGGAGTGGGGGCAGG - Intronic
963024086 3:140901144-140901166 TGGCAAACAGCAGTGGTGGATGG - Intergenic
963414385 3:144976107-144976129 AAGGAAACAGAAGTGCTTGAAGG - Intergenic
963732574 3:148987323-148987345 GGTGAAGCAGGCGTGGTGGAGGG + Intergenic
965528599 3:169747825-169747847 CAGGGAATAGGGGTGGTGGAGGG - Intergenic
965609396 3:170528770-170528792 GAAGAAAGAGGAGAGGAGGAAGG - Intronic
965798754 3:172468922-172468944 GAAGAAACAGGCGTGTTGGCGGG + Intergenic
966240799 3:177753589-177753611 GGGGAAACAGGAGTGAGGGCAGG + Intergenic
966398213 3:179522990-179523012 AGGGAAAGAGGAGTGGTGAAAGG + Intergenic
966547879 3:181171281-181171303 GAGGAACAAGGAGGGGTGGGAGG + Intergenic
966880490 3:184347142-184347164 AAGGAGACAGGACTGCTGGAGGG + Intronic
966932765 3:184686533-184686555 GGGGAAACAAGACTGGTGGTAGG + Intergenic
966944775 3:184770156-184770178 GAGGAAGTAGGGGTGGTGGGAGG - Intergenic
967363323 3:188656850-188656872 GAGGAAACAGGATTAGAGAAGGG + Intronic
967535298 3:190595021-190595043 GAGGAATCAGGAATGAAGGAGGG - Intronic
968440894 4:623916-623938 GAGGAAAAAGGAGGTGGGGAGGG + Intergenic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
969248423 4:5951728-5951750 GAAGAAACAGGAAGTGTGGAGGG - Intronic
969271725 4:6107818-6107840 GAGGAAACTGGAGCTCTGGAAGG - Intronic
969804894 4:9599650-9599672 GAGGGAAGAGGAGAGGAGGAAGG + Intergenic
970247855 4:14081960-14081982 GAGGAAACAGGATTGGACAAGGG + Intergenic
970402839 4:15734571-15734593 GAGAAAACAGGAATGGGGGAGGG + Intronic
971294868 4:25379089-25379111 CTGGAAAGAGGGGTGGTGGATGG + Intronic
972645329 4:40962709-40962731 GAGGACAAAGAAGTGGGGGAAGG + Intronic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
972853836 4:43082217-43082239 GGGCAAACAGCAGTGGTGGACGG - Intergenic
973817253 4:54630522-54630544 GAGGAAACAGGACTGAGGAAGGG - Intergenic
974129810 4:57740192-57740214 AATGAACTAGGAGTGGTGGATGG - Intergenic
974237634 4:59202421-59202443 GATGAAAAAGGAGAGGAGGAAGG - Intergenic
974441534 4:61924602-61924624 AAGGAAACAGTAGAGGTGGGAGG - Intronic
974487853 4:62526898-62526920 CAGCAAACAGCAGTGGTGGACGG + Intergenic
974841794 4:67307594-67307616 CAGAGAACAGCAGTGGTGGATGG - Intergenic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
975418825 4:74138679-74138701 CAGCAAACAGCAGTGGTGGATGG + Intronic
976190167 4:82479711-82479733 CAGCAATCAGCAGTGGTGGATGG - Intergenic
976515229 4:85956792-85956814 CAGCAAAAAGCAGTGGTGGATGG + Intronic
976610265 4:87023857-87023879 GGAGAAAGAGGAGTGGTGTAAGG + Intronic
976786432 4:88826699-88826721 GTGGGAACAGGAGTGGTAGGTGG - Intronic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
977926497 4:102705829-102705851 GAGGTACCAACAGTGGTGGATGG - Intronic
978587031 4:110284303-110284325 TGGCAAACAGCAGTGGTGGACGG + Intergenic
978904852 4:113993839-113993861 GGAGAAACAGGACTGGAGGAGGG + Intergenic
979546246 4:121943231-121943253 GTGGAAGAAGCAGTGGTGGAGGG + Intronic
979731293 4:124025646-124025668 GAGGAAAGACGAGAGGTAGAGGG + Intergenic
979910827 4:126363671-126363693 TGGCAAACAGCAGTGGTGGATGG - Intergenic
979977963 4:127220177-127220199 GAGGAAGCAAGAGTGGTGCGGGG - Intergenic
980106944 4:128596955-128596977 GAGGAAACACAAGCGGTGAATGG - Intergenic
980190519 4:129519325-129519347 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980386303 4:132090774-132090796 CAGCAAACAGCAGTGATGGATGG + Intergenic
980523646 4:133961712-133961734 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
981023692 4:140054544-140054566 GTGAAAACAGGAGAGGTGCAAGG - Intronic
981226001 4:142294934-142294956 GAGGAAAGAGGAGTGGTGTGGGG + Intronic
981495675 4:145389398-145389420 TAGGAAAAAGGAGTTGTGGGCGG - Intergenic
982978783 4:162104067-162104089 TGGCAAACAGCAGTGGTGGACGG - Intronic
983660519 4:170126752-170126774 AGGAAAACATGAGTGGTGGAAGG - Intergenic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
984365393 4:178792990-178793012 GAGCAAAAAGCAGAGGTGGAGGG - Intergenic
984628306 4:182034047-182034069 GAGGACTCACAAGTGGTGGAAGG + Intergenic
984658966 4:182352096-182352118 AAGGAAGGAGGAGTGGGGGAGGG - Intronic
985023566 4:185716826-185716848 GAGGAAACATCAGTGGAGGGAGG + Intronic
985114888 4:186580981-186581003 GAGGTGACAGGAGTGGAGGAGGG - Intergenic
985226354 4:187765516-187765538 CAGCTAACAGTAGTGGTGGATGG - Intergenic
985230483 4:187810837-187810859 GAGGAAGCAGGAAGGGAGGAGGG - Intergenic
985783126 5:1881225-1881247 GAGGAAAAAGGGGTGGAGAAAGG + Intronic
986576757 5:9220993-9221015 GCAGAAACAGGAGGAGTGGAGGG - Intronic
987121606 5:14773066-14773088 GAGGAAGCAGGATAGGTGGTGGG - Intronic
987508221 5:18800422-18800444 GGCAAAACAGCAGTGGTGGAGGG - Intergenic
987905347 5:24069366-24069388 TGGCAAACAGCAGTGGTGGACGG - Intronic
988556383 5:32239669-32239691 GAGGACTTAGGAGTGGAGGAAGG - Intronic
988569200 5:32347436-32347458 GAAGAAACAAGAGAGATGGATGG + Intergenic
988609504 5:32711702-32711724 GAGGAAAGAGGAAGGGTGGGTGG + Exonic
988622113 5:32833687-32833709 GAGGAAACAGGAGGGGGAAAGGG - Intergenic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
988978321 5:36537745-36537767 TAGGAAGCAGGAGTGAGGGATGG - Intergenic
989688426 5:44114670-44114692 TGGCAAACAGCAGTGGTGGATGG - Intergenic
989717696 5:44483491-44483513 CAGCAAATAGCAGTGGTGGACGG - Intergenic
989986767 5:50709447-50709469 GAGGAAACAGAAGCAGTGAAAGG - Intronic
990040353 5:51371944-51371966 GAGGAAAAAGGAGTGGGATATGG + Intergenic
990211151 5:53482351-53482373 GAGGAGAGAGGAGAGATGGAGGG - Intronic
990761938 5:59139311-59139333 GAGGAAACAGAAGATGGGGAAGG + Intronic
990891806 5:60658870-60658892 TGGTAAACAGCAGTGGTGGATGG - Intronic
990987677 5:61655768-61655790 GTGGAAGCAGGAGTGCTGGAGGG + Intronic
991290608 5:65030855-65030877 CCGGAAACGGCAGTGGTGGATGG - Intergenic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
992550237 5:77852658-77852680 GAGGAGAGAGGGGAGGTGGAAGG + Intronic
992578556 5:78146364-78146386 GAGGAAACTGAAGTGCTTGAAGG - Intronic
993225633 5:85165289-85165311 TGGCAAACAGCAGTGGTGGACGG - Intergenic
993884265 5:93397852-93397874 GAGGAAGCCAGTGTGGTGGAGGG + Intergenic
993941859 5:94068393-94068415 TGGCAAACAGCAGTGGTGGATGG + Intronic
994033783 5:95175714-95175736 GAGGAAACAGGACTGCAGAAAGG - Intronic
994320967 5:98393531-98393553 GTGGAAGCAGGAGTGGAGGCAGG + Intergenic
995125595 5:108574491-108574513 AGCGAAACAGCAGTGGTGGATGG + Intergenic
995465163 5:112444070-112444092 TGGCAAACAGCAGTGGTGGACGG - Intergenic
996018042 5:118562804-118562826 GGGAAAACAGGAGTGGGGAAGGG + Intergenic
996052394 5:118948798-118948820 AAGGAAAGAGGAGTGGGGAAAGG + Intronic
996115285 5:119611347-119611369 GAGGAACAAGAAGTGGTTGATGG - Intronic
996944706 5:129052919-129052941 AAGGAAACAGGAATGGCTGATGG - Intergenic
997211068 5:132077083-132077105 GAGGAAGCAAGAGGGGTGGTGGG - Intergenic
997424905 5:133796513-133796535 GAGGAGCCAGAAGTGGGGGATGG + Intergenic
997823528 5:137086621-137086643 GTGGATGCAGGAATGGTGGAGGG - Intronic
998290662 5:140911034-140911056 AAGCAAACAGGGGTGGTGGGGGG + Intronic
999891874 5:155986734-155986756 GAAGAAACAGGTGTGGGAGAAGG - Intronic
999958230 5:156725470-156725492 GAGGAAACAGGAATGTGAGATGG + Intronic
1000095449 5:157967370-157967392 GTGGAAAAAGCAGTTGTGGATGG - Intergenic
1000202341 5:159023882-159023904 GGGCAAACAGGAGGAGTGGAAGG + Intronic
1000452335 5:161405203-161405225 GAAGGAACTGGAGTGTTGGACGG - Intronic
1000509634 5:162165223-162165245 TAGAATACAGGAGTGGGGGAGGG - Intergenic
1000750664 5:165092284-165092306 GGGGCAACAGAGGTGGTGGAGGG + Intergenic
1001424997 5:171617175-171617197 GAGGAAACATCAGGGGTGAAGGG - Intergenic
1001919040 5:175586253-175586275 GAATCAACAGGACTGGTGGATGG + Intergenic
1002531986 5:179852703-179852725 GAGGAAAGATGAGAGGTGAAGGG + Intronic
1002534955 5:179870907-179870929 GAGGCAGCTGGAGAGGTGGACGG + Intronic
1002742630 5:181444771-181444793 GAGGAGAAAGGAGAGGGGGATGG + Intergenic
1003135723 6:3433432-3433454 TAGGAAGCAGGAGTGATGGGAGG - Intronic
1003224075 6:4189145-4189167 GAAGAAACAGAAGTGGTTGGAGG + Intergenic
1003493128 6:6641388-6641410 GAGGAAGCAGGAGGGGGGCACGG - Intronic
1004019285 6:11761939-11761961 GAGGAATCAGGAAGGGTGGGAGG + Intronic
1004177743 6:13354802-13354824 GAGGAAACAGGAGAGAAGAAAGG - Intergenic
1004224133 6:13770759-13770781 GAGGAGTCAGGAGTCATGGAAGG + Intergenic
1004236359 6:13878455-13878477 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1004665024 6:17741570-17741592 GAGGAAACGGGAGGGGTAGGTGG + Intergenic
1005081915 6:21965283-21965305 GAGGAAGGAGGAGGGGAGGAAGG - Intergenic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1005899079 6:30201968-30201990 GAGGAAAAAGGAGTGGTACTGGG + Intronic
1005972279 6:30770799-30770821 GAGGAAACTAAAGTGGTGAAGGG + Intergenic
1006470760 6:34227404-34227426 GAGGAAAGCAGAGTGGGGGAGGG - Intergenic
1006613822 6:35311690-35311712 GAGGAACCGGAAGTGGTGGCTGG - Intronic
1006729401 6:36225130-36225152 GAGGGAAAAGGAAGGGTGGAGGG + Intronic
1007011949 6:38426521-38426543 GGCAAAACAGCAGTGGTGGATGG - Intronic
1007340151 6:41186162-41186184 GAGGAAGCAGGAGGCCTGGAAGG + Intergenic
1007777313 6:44230903-44230925 GAGGAAGCTGGGGTGGAGGATGG + Intronic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1009519551 6:64664074-64664096 CAGGGATCAGTAGTGGTGGACGG + Intronic
1009544321 6:65005109-65005131 TGGCAAACAGCAGTGGTGGACGG - Intronic
1009999446 6:70933813-70933835 GGGGCAACAGGAGCTGTGGAAGG - Intronic
1010002942 6:70966572-70966594 GAGGAAACATCAGGGGTAGAAGG - Intergenic
1010071504 6:71750622-71750644 AAGGAAAGAGGAGTGGGGAAAGG + Intergenic
1010426592 6:75734750-75734772 GGGGAAGGAGGAGAGGTGGAGGG + Intergenic
1011190324 6:84720755-84720777 CAGCGAACAGCAGTGGTGGATGG + Intronic
1012276404 6:97280174-97280196 AAGGAAAATGGAGAGGTGGAAGG - Intronic
1012466104 6:99517844-99517866 GAGGAAATGGGAGTGTGGGAAGG - Intronic
1012734542 6:102921703-102921725 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1013164113 6:107574643-107574665 GATGAAATAGGAGTGGTGCCAGG - Intronic
1013413652 6:109905173-109905195 GAGGAAACTGAAGTTCTGGAGGG + Intergenic
1013842929 6:114419573-114419595 GATAAAACAGAAGTGGTGCATGG - Intergenic
1013925761 6:115469431-115469453 GAGAAAACTTGATTGGTGGAAGG - Intergenic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1014218980 6:118781085-118781107 AAGGAAACAGGAATGGTGGGTGG + Intergenic
1014884639 6:126764809-126764831 GAGGGAAAAAGAGTGATGGACGG + Intergenic
1015045714 6:128774084-128774106 GGGGACACAGGAGTGGGTGAAGG - Intergenic
1015632764 6:135247944-135247966 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1015738373 6:136425967-136425989 AAGGAAAAAGAAGTGGTAGAAGG - Intronic
1015902672 6:138083724-138083746 GAGGAAATTGGATTGGGGGATGG + Intergenic
1015903571 6:138092865-138092887 GAGGAAACAGACGTGGAGGGAGG + Intronic
1015973583 6:138767389-138767411 GAGTAAACAGGATTAGGGGATGG - Intronic
1016444928 6:144121424-144121446 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1017870124 6:158479982-158480004 GAGGAAGAGGGAGGGGTGGAGGG - Intronic
1017927223 6:158921128-158921150 GGAGAAACAGGGATGGTGGAAGG - Intergenic
1018101888 6:160447387-160447409 AGGGAAACAGAAGTGCTGGAGGG - Intronic
1018133767 6:160757822-160757844 AGGGAAACAGAAGTGCTGGAGGG + Intergenic
1018292228 6:162303841-162303863 GATGGAACACAAGTGGTGGATGG + Intronic
1018726135 6:166614752-166614774 GAGGTTACAGGGGTGGAGGAAGG - Intronic
1018813783 6:167316487-167316509 GAGGGCACGGGAGTGGGGGAAGG - Intergenic
1019247765 6:170720510-170720532 GAGGAGAAAGGAGAGGGGGATGG + Intergenic
1019319349 7:408625-408647 TAGGATACAGGAGTGGTGAGTGG + Intergenic
1019521645 7:1463396-1463418 GAGGAGACAGGAGGGGAGGAGGG + Intergenic
1020276573 7:6628271-6628293 GAGGAAAGAGGAGAGGTGATTGG + Intergenic
1020434477 7:8147924-8147946 GAGGAAACTGGAGTGGAGCCAGG - Intronic
1021144253 7:17065920-17065942 CAGCGAACAGCAGTGGTGGACGG - Intergenic
1021571152 7:22066589-22066611 CAGGAAACAGGAGAGAAGGAAGG - Intergenic
1021843514 7:24742465-24742487 GAGGAAGAGGGAGTGGGGGAGGG - Intronic
1021858139 7:24878182-24878204 GTGGAAACAGCTGTGCTGGAGGG - Intronic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1022175481 7:27868412-27868434 GAGGAATCTGGAGAGGGGGATGG - Intronic
1022694598 7:32691868-32691890 GAACAAACAGGAGAGGTGGGTGG + Intergenic
1024148021 7:46536784-46536806 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1024601831 7:50988816-50988838 GAGGAATCAGTGGTGGTGGTGGG + Intergenic
1025068599 7:55879404-55879426 GAGGAAATATGAGGGGTGGGTGG + Intergenic
1026142366 7:67717412-67717434 GAGAAAACTGGACTGGAGGAGGG - Intergenic
1027608647 7:80331753-80331775 AAGGAAATAGGAATGATGGAGGG + Intergenic
1027798845 7:82726419-82726441 GAGGAATGAGGGGTGGTGGAGGG + Intergenic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028589093 7:92477798-92477820 TGGCAAACAGCAGTGGTGGACGG + Intronic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1029412902 7:100426994-100427016 GAGGAAACGGGAGGGAGGGAAGG - Intronic
1029677653 7:102081539-102081561 CAGGAAACAGTTGTGGCGGAAGG - Intronic
1030055138 7:105577337-105577359 GAGGAGACAGAAGAGTTGGATGG + Intronic
1030318666 7:108141882-108141904 GAGGAAACAGGAGGGCTGGGAGG + Intergenic
1030336804 7:108337404-108337426 TGGCAAACAGCAGTGGTGGATGG - Intronic
1030843985 7:114386161-114386183 TGGCAAACAGCAGTGGTGGATGG + Intronic
1031129299 7:117813068-117813090 GATGATACAGGAGAGGTGAAGGG + Intronic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1032223267 7:130010211-130010233 GTGGAAACAGCAGTGGGGAAAGG + Intergenic
1032447557 7:131997660-131997682 GAGCAAACAGGAGTGATGGATGG - Intergenic
1032468617 7:132162370-132162392 GAGGAAATTGGAGTGGTTCAGGG - Intronic
1032800508 7:135313907-135313929 GAGGAAAGAGGAGGGGGAGAGGG + Intergenic
1032851552 7:135799545-135799567 CTGAAAACAGGAGTGGAGGATGG - Intergenic
1033159805 7:138985198-138985220 GAGGGAAAAGGAGTGAGGGAAGG + Intergenic
1033220124 7:139522275-139522297 GAGGGAGCAAGAGTGGAGGATGG + Intergenic
1034101262 7:148452477-148452499 GAAGAAACAGGAGTTGGGGCAGG - Intergenic
1034112277 7:148548513-148548535 AAGAAAACAGAAGTGGAGGAAGG - Intergenic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034271316 7:149804593-149804615 GAAGAAAGAGGAGTGGGGGAGGG + Intergenic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034707081 7:153155210-153155232 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1034827739 7:154282019-154282041 GAGGAAACAGAGGTGTTGAAAGG - Intronic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1035022408 7:155807416-155807438 GAGCAAACTGAAGAGGTGGAGGG + Intronic
1035096376 7:156359470-156359492 ATGGAACCAGGAGAGGTGGAAGG - Intergenic
1035392659 7:158515722-158515744 AAGGAATCAGGAGAGGAGGATGG - Intronic
1035500371 8:87426-87448 GAGGAGAAAGGAGAGGGGGATGG - Intergenic
1035600553 8:894672-894694 GGGGAAAGTGGAGCGGTGGATGG + Intergenic
1035617306 8:1011860-1011882 GTGGAACCAGGAGTTGTGGATGG + Intergenic
1035663346 8:1363445-1363467 GAGGAAACGCGTGTGGGGGACGG - Intergenic
1035733301 8:1868244-1868266 GTGGGGACAGGAGTGGTGGCTGG + Intronic
1036217491 8:6892832-6892854 CAGGCAAAAGGAGTGGTGCAGGG + Intergenic
1036604499 8:10293704-10293726 GAGGAAGCAGGAGGGGAGGAAGG - Intronic
1036763029 8:11525689-11525711 GAGGGCACATGAGTGGTGGCAGG - Intronic
1038234402 8:25737873-25737895 AAGGATGCAGGAGTTGTGGATGG - Intergenic
1038411807 8:27364819-27364841 GAGGAAAAAGGAGTAGATGAAGG - Intronic
1038683697 8:29695192-29695214 GAGAAAACAAAAGTGGTAGAAGG - Intergenic
1038701768 8:29855711-29855733 GAGGCAAGAGGCGTGGGGGAAGG - Intergenic
1039039139 8:33390347-33390369 AAGGAAACAGGAGTCGTGTCTGG + Intronic
1039380177 8:37077488-37077510 GAGGGAACTGCAGTGGTGAAGGG + Intergenic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1040872265 8:52112720-52112742 GAGGAAACAGGAAAGGGTGAAGG - Exonic
1040906396 8:52473504-52473526 CAGGAAACAGGAATGGTGAGAGG - Intergenic
1042055652 8:64763075-64763097 TGGCAAACAGCAGTGGTGGACGG - Intronic
1043068875 8:75612939-75612961 CAGGAAACTGGCATGGTGGAAGG + Intergenic
1043207307 8:77462538-77462560 GAGAAGACAGGAGAGGTTGAAGG + Intergenic
1043597234 8:81900599-81900621 ATGGAAAGAGGAGTGGTGAAAGG + Intergenic
1043936590 8:86149355-86149377 GATGAAACAGGAATGATGAAGGG + Intronic
1043941031 8:86196347-86196369 GAGGAATCAAGAGTGGTGGTAGG - Intergenic
1044017895 8:87068782-87068804 GAGGAGAAAGGAATGATGGAGGG - Intronic
1044686240 8:94828489-94828511 GAAGCAGCAGGAGTGGAGGATGG + Intronic
1044837077 8:96306219-96306241 GAGGTGGCAGGGGTGGTGGATGG - Intronic
1044915668 8:97110620-97110642 GAGGACACAGAAGTAGGGGATGG - Intronic
1045278085 8:100724390-100724412 GAGGAAACAGGAGTGGGATCTGG + Intergenic
1045657587 8:104403114-104403136 TGGCAAACAGCAGTGGTGGACGG - Intronic
1045664320 8:104468926-104468948 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1047051253 8:121116004-121116026 GAGGACTCAGGAGAGGAGGAGGG + Intergenic
1047276649 8:123410761-123410783 CAGCAAACAGCAGTGGTGGACGG - Intronic
1047324049 8:123819442-123819464 GAGGAAAGAGGAGGGAAGGAAGG - Intergenic
1047561252 8:125989981-125990003 GAGGAAACAGCAAAGGTAGAGGG + Intergenic
1047707644 8:127516095-127516117 GAGGAAAGAGGAGAGGAAGAAGG + Intergenic
1047774722 8:128060321-128060343 TAGGAGACTAGAGTGGTGGAAGG - Intergenic
1047995280 8:130329162-130329184 GAGGCAGCAGCAGTGGTTGAGGG - Intronic
1048505839 8:135020526-135020548 GAGAAGTCAGGAGTGTTGGAGGG - Intergenic
1048565180 8:135588576-135588598 AAGGAAAGAGGAGAGGTGGCTGG - Intronic
1048567290 8:135614971-135614993 GAGGAAACATCAGTGGTAGGGGG + Intronic
1048631490 8:136247645-136247667 CAGCAAACAGCAGTGGTGAATGG - Intergenic
1048724430 8:137366435-137366457 GAGAAAAGAGGAGAGGTTGAGGG - Intergenic
1049051827 8:140203822-140203844 TGGGTACCAGGAGTGGTGGAAGG + Intronic
1049318397 8:141981956-141981978 GAGAAGAGAGGAGTGGAGGAGGG + Intergenic
1049692296 8:143966770-143966792 CAGGAAGCCGGATTGGTGGAAGG + Intronic
1049705551 8:144040461-144040483 AAGGTAACAGGTGTGGTGGGTGG + Exonic
1050337544 9:4603979-4604001 GAGGAAGCAAGAGAGCTGGAAGG + Intronic
1050423598 9:5491862-5491884 GAGGAGAGAGGAATGATGGAGGG + Intergenic
1050744266 9:8858184-8858206 GAGGAAAGAGGAGAGGCGGAGGG - Intronic
1050863757 9:10470800-10470822 AAGGAAACAGGAGTGGTGGAGGG + Intronic
1051699196 9:19801422-19801444 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1051970178 9:22878077-22878099 CAGCCAACAGCAGTGGTGGACGG + Intergenic
1053134339 9:35640685-35640707 TGGCAAACAGCAGTGGTGGACGG + Intronic
1053452574 9:38205246-38205268 GAGGAAACCAGAGAGGGGGAAGG - Intergenic
1054756079 9:68959445-68959467 GAGGAAATAGGGGTGGGGAATGG - Intronic
1055789844 9:79911963-79911985 CGGTAAACAGCAGTGGTGGACGG + Intergenic
1055998505 9:82189237-82189259 GAAGAAACAGGAGCAATGGAAGG - Intergenic
1056052950 9:82789047-82789069 AAGGAAACAGGGATGGCGGAGGG - Intergenic
1056298132 9:85214068-85214090 GAGGGAACAGGGTTGGTGCAAGG + Intergenic
1056511450 9:87309937-87309959 GAGGCACCAGGAGTGGTGGGAGG - Intergenic
1056705015 9:88944283-88944305 CAGCAAACAGCAGTGGTGGTTGG + Intergenic
1059254791 9:112919848-112919870 AAGGAAACAGGATTGATCGAAGG + Intergenic
1059431661 9:114254244-114254266 GAGGAAGCAGGGTTGGTGGGAGG + Intronic
1059441858 9:114312246-114312268 GAGGATACAGAAGTGTTGGGAGG - Exonic
1059641332 9:116219717-116219739 GAGGAAACAGGAGGGAGGGAAGG - Intronic
1059972010 9:119677880-119677902 GAGGAAACAGGGGTGTGGGTGGG + Intergenic
1060718953 9:125961231-125961253 GAGGAAGCTGGAATGCTGGAGGG + Intronic
1060918860 9:127406616-127406638 GAGGTCACAGTGGTGGTGGATGG + Intronic
1060982859 9:127803519-127803541 CAGGAATCAGGGGTAGTGGAGGG + Intronic
1061120693 9:128640634-128640656 GAGGAGACAGAAGTGGGGCAGGG + Intronic
1061230462 9:129312884-129312906 GAGGAAGGAGGAGAGGTGGATGG + Intergenic
1061613497 9:131763850-131763872 GAGGAAGCAGCAGTGGCTGAGGG - Intergenic
1062542339 9:137047134-137047156 GAGGCAACAGGTGAGGTGCAAGG - Intergenic
1062728802 9:138096878-138096900 GAGGTACCAGGAGTCATGGAAGG + Intronic
1185467941 X:366382-366404 GATTAACCAGGTGTGGTGGAGGG + Intronic
1185467962 X:366547-366569 GATTAACCAGGTGTGGTGGAGGG + Intronic
1185499183 X:584483-584505 GAGGAAAAAGGGGAGGAGGAGGG + Intergenic
1186607178 X:11104495-11104517 GAGAAAATAGGAGTAATGGAAGG - Intergenic
1186780034 X:12903226-12903248 GAGAGAACAGGAGTGGTGGGTGG + Intergenic
1188527272 X:31099922-31099944 GAGGAAACAGCTGTCGGGGAAGG - Intronic
1188589589 X:31817691-31817713 GAGAAGACAAGAGTGGTGGGGGG + Intronic
1188599530 X:31944624-31944646 AAACAAACAGGAGTGGTGGCGGG - Intronic
1189558160 X:42166260-42166282 GGGGAAACTGCAGTGGTGGGAGG + Intergenic
1189621162 X:42839806-42839828 GAGGAAGCAAGAGAGGGGGAAGG + Intergenic
1189648221 X:43157856-43157878 GAGGGAGCAGGAGTGGTTGGGGG + Intergenic
1189678149 X:43485507-43485529 GTGGAAACAGGAGTGTTGAAAGG - Intergenic
1189700852 X:43715521-43715543 GAGGAGACAGGAAGTGTGGAAGG + Intronic
1189700983 X:43716168-43716190 AAGTAAACAGGAAAGGTGGATGG + Intronic
1190473721 X:50808057-50808079 GAGGAAACAGGAGGAGAGGCTGG + Intronic
1190658609 X:52634759-52634781 GAGGAAACAGTTGTGGGGAAGGG + Intergenic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1191220604 X:57984662-57984684 GTGGAAGCAGGAGTGGAGGCAGG - Intergenic
1191825796 X:65363539-65363561 ACGGAAACAGGAGTGGGGAAAGG - Intergenic
1192254874 X:69447982-69448004 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1192341557 X:70267724-70267746 GTGGGGGCAGGAGTGGTGGAGGG - Intergenic
1192571972 X:72213538-72213560 TGGCAAACAGCAGTGGTGGACGG - Intronic
1192853931 X:74987161-74987183 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1192960997 X:76130737-76130759 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1193172388 X:78350375-78350397 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1193295496 X:79827570-79827592 CTGCAAACAGCAGTGGTGGAAGG + Intergenic
1193306246 X:79956018-79956040 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1193339949 X:80335625-80335647 GAGGAAAGAGGTGGGGCGGAAGG - Intronic
1194930315 X:99880312-99880334 GAGGCAACAGCTGTGGTAGAAGG + Intergenic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1195422127 X:104687358-104687380 GAGGAGAAAGGAGTGGGGGGAGG + Intronic
1195449960 X:105000044-105000066 GAGGAAAAAGAAGTTGAGGAAGG - Intronic
1195584602 X:106551389-106551411 CAGCAAACAGCAGTGGTGGTCGG - Intergenic
1195652348 X:107298410-107298432 GAGGAAACATCAGGGGTGAAGGG + Intergenic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196686153 X:118512243-118512265 GAGGTAGGAGGAATGGTGGAAGG + Intronic
1197346144 X:125327215-125327237 CATGAAGCAGGAGGGGTGGAAGG + Intergenic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1198089513 X:133313581-133313603 GAGCAAACAGGACTGGAGGGGGG + Intronic
1198567134 X:137916328-137916350 CAGGAAAGAGGAATGGTGAATGG - Intergenic
1198618646 X:138483271-138483293 GAGCACACAGGAGTGGCTGATGG - Intergenic
1199096756 X:143751774-143751796 GTGGAAACAGGAGTGCAGGCAGG + Intergenic
1199432073 X:147773164-147773186 GGCAAAACAGCAGTGGTGGATGG - Intergenic
1200206571 X:154320610-154320632 GAGGAAAGAGGGGTGTGGGAAGG + Intronic
1200314602 X:155118695-155118717 GAGGAAACGAGAATGGTGGAGGG + Intronic
1200807748 Y:7449539-7449561 GAGGAAAGAGGGGTGGGGGCGGG - Intergenic
1200813055 Y:7504377-7504399 ATGGAAAGAGGAGTGGTGAAAGG - Intergenic
1201421473 Y:13804542-13804564 CAGCAAACAGCAGTAGTGGAGGG - Intergenic
1201455763 Y:14165585-14165607 AAGGAAGCAGGAGTGATAGATGG - Intergenic
1201652293 Y:16302896-16302918 TAGGAAACAGAAGTGATTGATGG + Intergenic
1202336545 Y:23817880-23817902 AATTAAACAGGAGTGGTGGTGGG - Intergenic
1202534221 Y:25852191-25852213 AATTAAACAGGAGTGGTGGTGGG + Intergenic