ID: 1181627992

View in Genome Browser
Species Human (GRCh38)
Location 22:24134296-24134318
Sequence CGGGCCCACTGGAGGTTCTG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 170}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181627992_1181627997 -8 Left 1181627992 22:24134296-24134318 CCCCAGAACCTCCAGTGGGCCCG 0: 1
1: 0
2: 0
3: 15
4: 170
Right 1181627997 22:24134311-24134333 TGGGCCCGCGACGTGTTGCTAGG 0: 1
1: 0
2: 0
3: 1
4: 24
1181627992_1181628003 30 Left 1181627992 22:24134296-24134318 CCCCAGAACCTCCAGTGGGCCCG 0: 1
1: 0
2: 0
3: 15
4: 170
Right 1181628003 22:24134349-24134371 GCAACAACTGCAGCACATGCCGG 0: 1
1: 0
2: 0
3: 14
4: 195
1181627992_1181628000 8 Left 1181627992 22:24134296-24134318 CCCCAGAACCTCCAGTGGGCCCG 0: 1
1: 0
2: 0
3: 15
4: 170
Right 1181628000 22:24134327-24134349 TGCTAGGCAGCAGTATCCCGTGG 0: 1
1: 0
2: 0
3: 4
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181627992 Original CRISPR CGGGCCCACTGGAGGTTCTG GGG (reversed) Exonic
901199905 1:7460877-7460899 TGGGCCCAGTGGAGTCTCTGGGG + Intronic
901437975 1:9261193-9261215 GGGGGACACTGGAGGATCTGAGG - Intronic
903974757 1:27142125-27142147 AGGGCCCACTGGAAGAACTGAGG + Intronic
905505643 1:38476909-38476931 CGGGCACAATGGTGGCTCTGGGG + Intergenic
914379050 1:147100080-147100102 CAGGCTGACTGGAAGTTCTGGGG - Intergenic
914450527 1:147787565-147787587 GGGGGCCACTGGAGGCCCTGCGG + Intergenic
914663540 1:149813296-149813318 CGGGCCAACTGGATGTCCTTGGG + Exonic
914928629 1:151909806-151909828 CGCGCCGACTGGAGGCTTTGCGG + Exonic
915238085 1:154500726-154500748 CGGACACACTGGAGGTTTTCTGG - Intronic
915360645 1:155284533-155284555 CGGCCCCACGAGTGGTTCTGAGG - Exonic
917137569 1:171802426-171802448 GGGTCCCTCTGGAGGCTCTGAGG - Intronic
921834317 1:219762163-219762185 CTGGTCCACTGGAGGCACTGGGG - Intronic
922789487 1:228303319-228303341 CAAGCCCTCTGGAGGATCTGAGG - Intronic
924815439 1:247437620-247437642 CAGGCCCTCTGGGGGCTCTGTGG + Intronic
1066614694 10:37282964-37282986 AGGGACCACTGCAGGTTCTTGGG - Intronic
1067732269 10:48820757-48820779 CTGGCCCAAGGGGGGTTCTGGGG + Intronic
1069915972 10:71787022-71787044 CAGGGGTACTGGAGGTTCTGAGG + Intronic
1071417411 10:85454168-85454190 AGGGCCCACTTGTGATTCTGAGG - Intergenic
1072070293 10:91908825-91908847 CGGGCCCACTGGCGGCTCCTCGG - Exonic
1072622915 10:97092159-97092181 TGGGGCCCCTGGAGGCTCTGAGG + Intronic
1074601413 10:114917546-114917568 CTGGCCCATGGGAGTTTCTGTGG - Intergenic
1075102409 10:119515729-119515751 CAGGCCCACAGGAGCTGCTGTGG + Intronic
1075864468 10:125705843-125705865 GGGGCCCCATGGGGGTTCTGGGG - Intergenic
1076753470 10:132555360-132555382 CTGGCCCAGTGGAGCTGCTGGGG + Intronic
1077254277 11:1573424-1573446 GGTGCCCACTGAGGGTTCTGCGG - Intergenic
1077440621 11:2567057-2567079 GGGGCCCACGGGAGGCTCTGGGG + Intronic
1077521638 11:3039276-3039298 CGGGCCCTCTTGATGATCTGGGG + Exonic
1077538762 11:3136665-3136687 CAGGCCCACAGGAGGCCCTGGGG + Intronic
1080628440 11:34051940-34051962 CGGACCCGCTGGAGCTTCCGAGG + Intronic
1080992603 11:37557429-37557451 CTGGCCCACAGTAGGTGCTGTGG - Intergenic
1081033297 11:38113069-38113091 AGGGACCACTGCAGGTTCTTGGG + Intergenic
1081863110 11:46345468-46345490 TGGGCCCAGTGGAGGCGCTGGGG + Intronic
1083761948 11:64823629-64823651 GGGGGCCACTGGAGGGTCTCCGG - Exonic
1084694300 11:70744576-70744598 CAGGACCACTGGAGCTGCTGTGG - Intronic
1086934369 11:92728707-92728729 GGCACCCTCTGGAGGTTCTGGGG + Intronic
1087015929 11:93554748-93554770 CGCTCCCACTTGAGGGTCTGGGG + Intergenic
1087102885 11:94381873-94381895 CTGCCCCACAGGAGGCTCTGGGG - Intronic
1089625041 11:119745827-119745849 TGGGCAGGCTGGAGGTTCTGTGG + Intergenic
1091253035 11:134159909-134159931 CGGGACGGCTGGAGGTGCTGAGG - Exonic
1091714172 12:2765275-2765297 GAGTCCTACTGGAGGTTCTGAGG - Intergenic
1094110652 12:26858775-26858797 CGTTCCCTCTGGAGGCTCTGGGG - Intergenic
1095337670 12:41048220-41048242 TGGGCCCACTTGAAGTTTTGTGG - Intronic
1100277605 12:93085588-93085610 CGTTCCCGCTGAAGGTTCTGAGG - Intergenic
1101560635 12:105854372-105854394 AGGCCCCTCTGGAGATTCTGAGG - Intergenic
1102929893 12:116854131-116854153 GGGGCTAACTGGAGGTTTTGCGG + Intergenic
1104036781 12:125103115-125103137 TGGACCCACTGGAGCTCCTGCGG + Intronic
1105206609 13:18231051-18231073 GGGGCCCACTGGAGGGTGGGAGG - Intergenic
1106231338 13:27823527-27823549 AAGGCCCATTGGAGATTCTGGGG + Intergenic
1106299488 13:28451124-28451146 CTGGCCAACTGTTGGTTCTGAGG - Intronic
1107750904 13:43565447-43565469 CCAGGCCACTGGAGCTTCTGAGG - Intronic
1112563353 13:100532677-100532699 CGGCCCCAGTGGAGGCTCTGTGG - Intronic
1113566776 13:111324088-111324110 TGGGCCCGCTGAAGGTCCTGGGG + Intronic
1118982806 14:70730165-70730187 CGTGTCCACTGGAGGGGCTGTGG - Exonic
1119545389 14:75468027-75468049 TGGGCCCACTGAGGGTTCTGGGG + Intronic
1123099865 14:105790430-105790452 CTGCCCTACTGGAGGCTCTGTGG - Intergenic
1123203647 14:106691895-106691917 AGCGCCCCCTGCAGGTTCTGAGG + Intergenic
1125487494 15:40122473-40122495 CAGGTTCACTAGAGGTTCTGGGG - Intergenic
1125521238 15:40348866-40348888 TGGGCCCACTCGGGGTTCAGAGG + Intergenic
1127577631 15:60307511-60307533 TGAGCCCACTGGAGGTTTTGAGG + Intergenic
1131224906 15:90616549-90616571 CAGTCACACTGGAGCTTCTGTGG + Intronic
1132702333 16:1227160-1227182 CACGCCCACTGGAGGTTTTGCGG - Intergenic
1132705992 16:1243708-1243730 CACGCCCACTGGAGGTTTTGCGG + Intergenic
1132983379 16:2750911-2750933 GGGTCTCACTGGAGGTGCTGGGG + Intergenic
1135118644 16:19745879-19745901 CTGGCCCACTGGAGGATGAGAGG - Intronic
1136496468 16:30648107-30648129 CAGCCCCACTGGAGGCTGTGTGG + Intergenic
1136872099 16:33816724-33816746 AGCGCCCCCTGGTGGTTCTGAGG - Intergenic
1138565153 16:57827706-57827728 TGTGCCCACTGGAGGGTTTGTGG - Intronic
1139383482 16:66549425-66549447 CCGTCCCACAGGTGGTTCTGAGG + Intronic
1141367272 16:83455378-83455400 CTGGCCCACCTGAGGCTCTGGGG + Intronic
1141649827 16:85386943-85386965 AGCTCCCACTGAAGGTTCTGGGG + Intergenic
1142029466 16:87831378-87831400 CGGGCCCACTGGATGGTGAGGGG + Exonic
1142130502 16:88429709-88429731 CTGGCCCACCGGCAGTTCTGTGG + Exonic
1142151118 16:88512939-88512961 CGAGGCCCCTGGAGGCTCTGCGG - Intronic
1203100073 16_KI270728v1_random:1299344-1299366 AGCGCCCCCTGGTGGTTCTGAGG + Intergenic
1142640514 17:1283073-1283095 CTGCCGGACTGGAGGTTCTGGGG - Intronic
1143029747 17:3961347-3961369 TGGGCTCACAGGAGGTGCTGGGG + Intronic
1143632716 17:8148056-8148078 GGGGCCCCCAGGAGGTCCTGGGG + Exonic
1147125660 17:38366343-38366365 AGGGGACACTGGAGGTGCTGTGG - Exonic
1151388631 17:73770798-73770820 CTGGCCCACTGGGGCTGCTGAGG + Intergenic
1151582358 17:74987733-74987755 CGGGCCCGCAGGCGGGTCTGGGG - Exonic
1152526816 17:80893058-80893080 CGGGCCCGCTGGCTATTCTGGGG - Intronic
1155927653 18:31674028-31674050 CAGTCCCTCTGGAGGCTCTGGGG - Intronic
1158187489 18:54787294-54787316 CGTGCCCACTGTTGATTCTGGGG + Intronic
1161167606 19:2796692-2796714 CGTGGCCAGTGGAGCTTCTGTGG + Intronic
1162514706 19:11141002-11141024 GGAGGCCACTGGAGGTTGTGGGG + Intronic
1163403664 19:17109634-17109656 GGGTCCCTCTGGAGGCTCTGAGG + Intronic
1163411002 19:17154444-17154466 CGTGCCCCCTGTAGGCTCTGGGG - Intronic
1164389442 19:27805376-27805398 CGGGTGCTCTGGAGGTGCTGGGG + Intergenic
1167307146 19:48715718-48715740 CGGGGCCAGAGGAGGGTCTGAGG + Exonic
1168412191 19:56147006-56147028 CGGGCCCGCGGGAGGCGCTGGGG + Exonic
925696533 2:6585930-6585952 CGTTCCCTCTGGCGGTTCTGTGG - Intergenic
925901741 2:8513879-8513901 AGGGCCCACTGGGGATGCTGAGG + Intergenic
926838857 2:17056345-17056367 CAGGCCCATTGGAGATTCTCTGG - Intergenic
927480674 2:23451559-23451581 TGGCCCCACTTGAGGCTCTGAGG + Intronic
932614384 2:73222753-73222775 AGGGCCAACTGGAACTTCTGCGG + Exonic
933725445 2:85424281-85424303 CAGGCCAACAGGAGGTTATGTGG - Intronic
933777106 2:85777778-85777800 AGGCTCCACTGGAGGCTCTGGGG - Intronic
934932369 2:98436921-98436943 CAGGCCCATGGGAGGTTCTCTGG - Intergenic
936113811 2:109686225-109686247 CGTGGCCACTGGAAGTTCTACGG + Intergenic
938073897 2:128322132-128322154 CAGCCCCACGGGAGGCTCTGAGG - Intergenic
938109036 2:128552058-128552080 AGGTCCTACTGGAGGTCCTGGGG - Intergenic
947767919 2:232649243-232649265 CGGGCCCTTTGGCGGATCTGGGG + Intronic
1168827401 20:823067-823089 CGGCCCCTGTGGAGGGTCTGAGG + Intergenic
1170634714 20:18094125-18094147 TGGGCCAACTGGTGGATCTGTGG - Intergenic
1170684732 20:18559218-18559240 CGGTCTCACTGGAGGCTATGGGG - Intronic
1175300262 20:57937945-57937967 CTGGACCACAGGAGGTTCGGGGG + Intergenic
1177134948 21:17298437-17298459 AGGGACCATTGCAGGTTCTGGGG + Intergenic
1179469122 21:41598763-41598785 CGGTCCCTCTGGATGCTCTGGGG - Intergenic
1179912230 21:44456373-44456395 AGGGCCCACTGAAGGGTCTGGGG - Intronic
1180185798 21:46138616-46138638 CGGCCCTACAGGAGGGTCTGAGG - Exonic
1180956474 22:19743576-19743598 CAGCCCCACAGGAGATTCTGCGG - Intergenic
1181387539 22:22557239-22557261 CGGCCCCTCTGAAGGTGCTGGGG - Exonic
1181627992 22:24134296-24134318 CGGGCCCACTGGAGGTTCTGGGG - Exonic
1181972734 22:26704691-26704713 AGGGCCAGCTGGAGGTGCTGGGG + Intergenic
1182249030 22:28984863-28984885 AAGGGCCAATGGAGGTTCTGCGG - Intronic
1183201399 22:36387712-36387734 CAGGCCGACTGGTGGTTCTTGGG - Intronic
1183428330 22:37751326-37751348 CGGGCCCATGGGAGGGTCCGTGG + Intronic
1184817314 22:46881982-46882004 CAGGCCCTCTGCAGGTGCTGGGG + Intronic
1185028286 22:48427892-48427914 CTGGCCCCCTGGAGGTGGTGAGG - Intergenic
952180820 3:30914667-30914689 CTGGCACACTGGAAGTCCTGAGG + Intergenic
952709699 3:36417095-36417117 GGGGCACACTGGAGGCTGTGGGG - Intronic
953207836 3:40847834-40847856 CAGGCCCACAGCAGGTGCTGAGG + Intergenic
954748375 3:52799867-52799889 CTGGCCTCCTGGAGGTTCTCGGG - Exonic
955485206 3:59428098-59428120 TGGGCCCACGGGAGCTCCTGTGG + Intergenic
957202555 3:77155506-77155528 CGGGGTTTCTGGAGGTTCTGTGG - Intronic
959297588 3:104556912-104556934 TGGGCTCACTGGAGGAGCTGAGG - Intergenic
964513289 3:157477165-157477187 GGTGCCCTCTGGAGGCTCTGAGG + Intronic
965837339 3:172866822-172866844 CGGGCCAGCTGGAGTTTCGGGGG + Intergenic
966828219 3:183983542-183983564 CGGGCCCATGGGAGGGTCTCTGG - Intronic
967283834 3:187849731-187849753 GGGCACCACTGGAGATTCTGGGG - Intergenic
968934081 4:3600982-3601004 ATTGCCCACTGGAGATTCTGTGG - Intergenic
969347489 4:6578529-6578551 CAGCCCCACTGGAGGTCCTGAGG - Intronic
970800653 4:19969569-19969591 CAGGCCAGCTGGAGATTCTGGGG + Intergenic
979104185 4:116663882-116663904 CAGGCCAATTGGAGGTTCTCTGG - Intergenic
981550238 4:145936398-145936420 CCTGCCCGCTAGAGGTTCTGAGG - Intronic
984912489 4:184687460-184687482 TGGGCCCACAGGTGCTTCTGAGG - Intronic
985553670 5:545800-545822 AAGGCCCGCTGGAGGTTGTGAGG + Intergenic
985580333 5:692700-692722 CGGGGCAGCTGGAGGCTCTGCGG + Intronic
985594991 5:784081-784103 CGGGGCAGCTGGAGGCTCTGCGG + Intergenic
986136062 5:4979182-4979204 CAGGCCTACTGGAGGTTAAGAGG - Intergenic
989291077 5:39766841-39766863 GGGACCCACTGGAGGTTGGGAGG - Intergenic
990834346 5:59999396-59999418 CTGTACCACTGCAGGTTCTGTGG - Intronic
994164688 5:96596393-96596415 CGTTCCTTCTGGAGGTTCTGAGG - Intronic
994231872 5:97316601-97316623 AGGGACCACTGCAGGTTCTTGGG - Intergenic
995382565 5:111550863-111550885 CTGGCCCACTGAAGTTCCTGGGG + Intergenic
1000209547 5:159097234-159097256 AGCGCCCACTGGATGTTTTGGGG - Intronic
1001465187 5:171957859-171957881 AGGGCCCACTTGATGTTCTATGG + Intronic
1002296120 5:178232330-178232352 CGGCCCCGCTGGAGCTTCTAGGG - Intronic
1003158356 6:3615494-3615516 TGGGCCTTCTGGAGGCTCTGAGG - Intergenic
1004249909 6:14015336-14015358 GGGGCCCAATGGAGGTTGCGAGG - Intergenic
1004418187 6:15444485-15444507 TGTGCGCACTGGAGGTTGTGGGG - Intronic
1013729846 6:113152454-113152476 AGGGCCTACTGGAGGTTGAGGGG + Intergenic
1014806936 6:125840072-125840094 CTGTCCCACTGGAAGTTCTCAGG - Intronic
1020705715 7:11541578-11541600 TGAGCCCACTGGAGGCTCTGGGG - Exonic
1023935574 7:44737570-44737592 CTGGCCCACAGGAAGTTCTGGGG + Intergenic
1024229804 7:47355263-47355285 CGGCCCCACAGGAGGAGCTGGGG + Intronic
1024322465 7:48084779-48084801 ACGGCCCTCAGGAGGTTCTGAGG - Intergenic
1026858441 7:73769811-73769833 CGGGCCGCCTGAAGGTCCTGTGG + Exonic
1026867249 7:73831421-73831443 CGGGCCGCCTGCAGGTCCTGCGG - Exonic
1029906752 7:104100561-104100583 CATCCCCACTAGAGGTTCTGGGG - Intergenic
1033045385 7:137957520-137957542 TGGGCCCAGTGGAGATTCTAGGG - Intronic
1035284557 7:157797863-157797885 CGGGGCCTCTGGAGGTTCAGAGG - Intronic
1038001809 8:23398328-23398350 CTGGCCCTCTGGATGTCCTGTGG - Intronic
1038714670 8:29981081-29981103 CAGGCACCCTGGAGATTCTGAGG + Intergenic
1039798160 8:40932909-40932931 CAGGCCCACAGGAGGTGCTGCGG - Intergenic
1039979174 8:42392007-42392029 CGGGCCTAACGGAGGCTCTGTGG + Intronic
1042796182 8:72665596-72665618 CAGGCCCACCTTAGGTTCTGAGG - Intronic
1047688571 8:127327082-127327104 CAGGCCCACTGTAGAGTCTGAGG - Intergenic
1047808699 8:128384501-128384523 CGGAGTCACTGGAGATTCTGGGG + Intergenic
1048985629 8:139733315-139733337 CAGGACCATGGGAGGTTCTGGGG - Intronic
1049149603 8:141026137-141026159 TGGGCCCACTAGATATTCTGGGG + Intergenic
1049235483 8:141510366-141510388 GGGTCCCACTGGCGGCTCTGGGG + Intergenic
1049497370 8:142942586-142942608 AGGGACAACTGGGGGTTCTGAGG + Intergenic
1049591507 8:143464950-143464972 CAGGCCCACTGGAGATGCTGAGG + Intronic
1051811177 9:21052034-21052056 CGAGCCCACTGCTGGTCCTGAGG + Intergenic
1054456072 9:65430997-65431019 ATTGCCCACTGGAGATTCTGTGG + Intergenic
1055603015 9:77939253-77939275 TTGGCCCAGTGGAGGCTCTGAGG - Intronic
1056112345 9:83408407-83408429 TGGGCCCAGTGGGGGTTCTTAGG - Intronic
1056751847 9:89357654-89357676 ACAGCCTACTGGAGGTTCTGGGG - Intronic
1061610082 9:131740150-131740172 CGGGCCCACAGGGGGCGCTGTGG - Intergenic
1062464532 9:136675305-136675327 CTGGCCCCCTGGAGGTTCCCTGG - Intronic
1185723671 X:2402285-2402307 CTGGGCAACTGGAGGTTGTGGGG + Intronic
1188999906 X:36933028-36933050 CGGGCCCAAGTGAGGTTCTGGGG + Intergenic
1190245273 X:48686775-48686797 CGGACCCACTGGAGGGCCTGTGG - Exonic
1195702264 X:107714524-107714546 CGAGGCCCCTGGTGGTTCTGCGG - Exonic
1197201452 X:123752272-123752294 TGTGCCTTCTGGAGGTTCTGGGG - Intergenic