ID: 1181630599

View in Genome Browser
Species Human (GRCh38)
Location 22:24149187-24149209
Sequence CCGGGCTCACAGGTGGGTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 85}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181630599_1181630613 24 Left 1181630599 22:24149187-24149209 CCTATACCCACCTGTGAGCCCGG 0: 1
1: 0
2: 0
3: 12
4: 85
Right 1181630613 22:24149234-24149256 GGCTCCAATCCTGACCTGAGTGG 0: 1
1: 0
2: 0
3: 12
4: 136
1181630599_1181630607 3 Left 1181630599 22:24149187-24149209 CCTATACCCACCTGTGAGCCCGG 0: 1
1: 0
2: 0
3: 12
4: 85
Right 1181630607 22:24149213-24149235 GGATCACCCCAGCCAGCCTCAGG 0: 1
1: 0
2: 3
3: 23
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181630599 Original CRISPR CCGGGCTCACAGGTGGGTAT AGG (reversed) Intronic
900320541 1:2081425-2081447 CCAGGCCCAGAGGTGGGTCTCGG + Intronic
900544026 1:3218514-3218536 CCGCCCGCACAGGTGGGCATCGG + Intronic
900556423 1:3283140-3283162 CCGGGCTCATGGGTGGGAACTGG + Intronic
902829169 1:18998717-18998739 AGGGGCTCAAAGGTGGGGATGGG - Intergenic
904811502 1:33165904-33165926 CCCAGGCCACAGGTGGGTATTGG + Intronic
905291040 1:36922056-36922078 CCAGGCTGAGAGGTGGGTGTTGG + Intronic
906568478 1:46817102-46817124 CCTGGGGCACAGGTGGGTAGAGG - Exonic
907272603 1:53299618-53299640 CTGGGCACACAGGTGGGCACAGG - Intronic
908534886 1:65067593-65067615 CCGGGGGCGCAGGTGGGTGTGGG - Intergenic
919978485 1:202628075-202628097 CCGGGCTCAGAGGTGGGTGCCGG + Intronic
920175854 1:204101326-204101348 GTGGGCTCACAGATGGGTAGAGG + Intronic
1063119833 10:3097552-3097574 CCTGGCTCACAGGCTGGTACAGG - Intronic
1063224450 10:4002637-4002659 CCAGGCTCAGATGTGGGTTTTGG + Intergenic
1064097014 10:12431371-12431393 CCGGGTGCACAGGTGGGTCTGGG + Intronic
1064265451 10:13821735-13821757 CGCGGCACACAGGTGGGCATGGG + Intronic
1065901474 10:30211919-30211941 CCGGTCACAGAGGTGGGTAGAGG + Intergenic
1066461508 10:35616536-35616558 TCGGGGTCACAGGAGGGTATAGG - Intergenic
1070761526 10:79027229-79027251 CAGGCCCCACAGGTGGGTGTTGG + Intergenic
1075421760 10:122306555-122306577 CTGGGCTCAGACCTGGGTATAGG - Intronic
1083365079 11:62137591-62137613 CCGTGCTCTCAGATGGGCATGGG + Intronic
1089630495 11:119781297-119781319 CCGTGCTCGCAGGTGGGGAGGGG - Intergenic
1092024840 12:5231898-5231920 CAGGGCTCACAGGAGGGGCTCGG - Intergenic
1092118074 12:6023671-6023693 CTGGGCACACACGTGGGCATAGG + Exonic
1098477431 12:70921061-70921083 CCGAGCTCACTGCTGGGAATTGG + Intergenic
1102471511 12:113162292-113162314 CCAGGGTCACAGCTGGGTAGGGG - Intronic
1109508553 13:63337760-63337782 CCAAGCACACAGTTGGGTATGGG - Intergenic
1122863522 14:104593301-104593323 CCAGGCTCACAGGTGGGCACTGG + Exonic
1123480269 15:20624703-20624725 CAGGGCTCTCAGGTGAGAATTGG - Intergenic
1123637737 15:22375662-22375684 CAGGGCTCTCAGGTGAGAATTGG + Intergenic
1123975225 15:25547214-25547236 CCTTGCTCACACGTGGCTATGGG + Intergenic
1124409124 15:29421046-29421068 CCGGGCTGACAGCTGTGTACAGG + Intronic
1124494112 15:30176014-30176036 CCGGGCTCAGAGGTGGGTGCCGG + Intergenic
1124565916 15:30813676-30813698 CTGGGCTAACATGTGGGTAAGGG + Intergenic
1124707399 15:31977453-31977475 CCAGGCGCACAGGTGGGTGTTGG - Intergenic
1124749458 15:32362631-32362653 CCGGGCTCAGAGGTGGGTGCCGG - Intergenic
1125677247 15:41509000-41509022 CCAGGCTCAGAGGTGGGGTTGGG + Intronic
1126910009 15:53407961-53407983 CTGGGCTCAGAGGTGGGACTGGG + Intergenic
1132681031 16:1141811-1141833 CCAGGGTCTCAGGAGGGTATGGG - Intergenic
1134089411 16:11383676-11383698 ACGGGCACACAGGTGGATGTAGG + Exonic
1135945732 16:26863332-26863354 CCAGGTTCAGAGGTAGGTATAGG - Intergenic
1136343824 16:29662969-29662991 CTGGGCTCAGAGGTGGGTGGTGG - Intronic
1139347643 16:66314514-66314536 CAGGGGTCACAGGTGGGCATGGG + Intergenic
1141821709 16:86450777-86450799 TCTGGCTCACAGGTGGGAATGGG - Intergenic
1141946232 16:87311568-87311590 CGGAGCACACAGGTTGGTATTGG + Intronic
1142125387 16:88407700-88407722 CTGGGCCCACAGGTGGGACTTGG - Intergenic
1142419395 16:89961148-89961170 CCGGGTGCACAGGTGTGTAAGGG + Intronic
1142763675 17:2054881-2054903 TCGGGGTCCCAGGTGGGTACAGG + Intronic
1143336885 17:6178181-6178203 CTGGGCTCACAGGTGTGGGTCGG + Intergenic
1147646672 17:42038359-42038381 CAGGGCTGACAGGAGGGAATGGG + Intronic
1148853391 17:50565607-50565629 CCAGGCTCCTAGGTGGGAATGGG + Intronic
1151582359 17:74987734-74987756 CCGGGCCCGCAGGCGGGTCTGGG - Exonic
1152424147 17:80209949-80209971 CCGTGCTCCCAGGTGAGTGTCGG + Exonic
1152829984 17:82491180-82491202 CCTGGCTCACTAGTGGGCATGGG - Intergenic
1153359454 18:4176960-4176982 CCAGGCTCACAGCTGGATCTTGG + Intronic
1161968496 19:7561984-7562006 CCGGGCTCACAGGTGCTCTTGGG + Intergenic
1163762972 19:19147025-19147047 CCGGGCCCCCAGGTGAGCATGGG - Exonic
1166532898 19:43553178-43553200 CCTGGATCACTGGTGGGTTTTGG - Intronic
931021900 2:58055242-58055264 CCAGGCTAGCAGATGGGTATGGG + Intronic
937287889 2:120764518-120764540 TCCGGGTCACAGCTGGGTATTGG + Intronic
946305591 2:218855364-218855386 CCAGGCTCCCAGCTGGGTAGCGG - Intergenic
946868087 2:224060220-224060242 CCAGGATCCCAGGAGGGTATGGG - Intergenic
948888103 2:240893829-240893851 CCTGTCTCACAGGTGGGGACAGG + Intronic
1172505441 20:35458300-35458322 CCAGGTTCACAGGTGGCTGTTGG + Exonic
1179791333 21:43757495-43757517 ATGGCCTCACAGGAGGGTATGGG - Exonic
1180569505 22:16702087-16702109 CTGGGCACACACGTGGGCATAGG + Intergenic
1180858102 22:19060790-19060812 CGGGGCTCACAGGCTGGTGTGGG + Intronic
1181278470 22:21702293-21702315 TGGGGCCCACAGATGGGTATGGG + Intronic
1181630599 22:24149187-24149209 CCGGGCTCACAGGTGGGTATAGG - Intronic
1184771343 22:46598580-46598602 CCTGGCTCACCTGTGGGTCTAGG + Intronic
1184857685 22:47155473-47155495 CCGGGCTCCCAGGATGGTCTGGG + Intronic
950659705 3:14459564-14459586 CCGTGCTCACTGGTGGGCACGGG - Intronic
950860102 3:16140337-16140359 TCTGGCCCACAGGTGGATATGGG - Intergenic
963170002 3:142241034-142241056 CCAGGCTCACAGGTGGTCATGGG + Intergenic
969495459 4:7523744-7523766 CCGGGCTCAGTGCTGGGTGTTGG - Intronic
973636142 4:52863025-52863047 CCGGGCTCAGAGGAGGGGGTGGG + Intronic
973735278 4:53865250-53865272 CCGGGCTCACACTTGTGCATGGG + Intronic
991644399 5:68786986-68787008 CAGGGCACACTGGTGGGTAGAGG - Intergenic
1003179883 6:3782458-3782480 CAGGGCCCACAGGTGTGTCTGGG + Intergenic
1012932587 6:105332243-105332265 TCGGGGTCACAGGTTGCTATGGG - Intronic
1014393855 6:120899338-120899360 CATGGCTGACAAGTGGGTATTGG - Intergenic
1018463942 6:164025249-164025271 CCTGGCTCCCAGGAGGGTGTGGG + Intergenic
1023105866 7:36762808-36762830 CCAGGCTCCCAGGTGGGTTTGGG - Intergenic
1024578158 7:50781613-50781635 GCCGGCACACAGGTGGCTATGGG - Intronic
1032020528 7:128405256-128405278 CCCTGCCCACAGGTTGGTATTGG - Intronic
1035569852 8:665342-665364 CCGGGCTCACGGGTGGACACTGG + Intronic
1038523266 8:28251723-28251745 CCTGGGCCACAGATGGGTATTGG - Intergenic
1048319207 8:133385399-133385421 CAGGGGTCACAGGTGGCTTTGGG + Intergenic
1052352678 9:27473398-27473420 CCAGGCTCACAGGAGGGCACAGG + Intronic
1053421774 9:37984298-37984320 ACAGGCTCAAAGGTTGGTATTGG - Intronic
1056520127 9:87393475-87393497 CCAGACTCAAAGGTGGGTAGAGG - Intergenic
1057701586 9:97366689-97366711 CCTGCCTCATAGGTGAGTATAGG + Exonic
1061403770 9:130382674-130382696 CCAGGATCACAGGTGGGGCTGGG - Intronic
1061814043 9:133182515-133182537 CTGGGCTGACAGGTGGGTGGAGG + Intergenic
1190248222 X:48704822-48704844 CAGGGGTCACAGGTGGGTAGGGG - Intronic
1193761602 X:85473775-85473797 CCAGGTTCACAGGTGGGGAGCGG - Intergenic
1195573337 X:106421320-106421342 CAGCCCTCACAGGTGGGTTTGGG - Intergenic
1200011850 X:153125904-153125926 AAGGGGTCACAGGTGGGCATGGG - Intergenic
1200027751 X:153274015-153274037 AAGGGGTCACAGGTGGGCATGGG + Intergenic