ID: 1181630821

View in Genome Browser
Species Human (GRCh38)
Location 22:24150414-24150436
Sequence CGTGAGGGTCCCTCATGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 116}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181630815_1181630821 -3 Left 1181630815 22:24150394-24150416 CCAAGAGAGGCAGTTTGCAGCGT 0: 1
1: 0
2: 0
3: 9
4: 163
Right 1181630821 22:24150414-24150436 CGTGAGGGTCCCTCATGGGGTGG 0: 1
1: 0
2: 0
3: 8
4: 116
1181630813_1181630821 10 Left 1181630813 22:24150381-24150403 CCAGGAGGGAAAACCAAGAGAGG 0: 1
1: 0
2: 5
3: 32
4: 314
Right 1181630821 22:24150414-24150436 CGTGAGGGTCCCTCATGGGGTGG 0: 1
1: 0
2: 0
3: 8
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181630821 Original CRISPR CGTGAGGGTCCCTCATGGGG TGG Intronic
900344630 1:2205029-2205051 CGTGAGGGAGCCTCGTGGGAGGG - Intronic
900762488 1:4482480-4482502 CGGGAGGGTCACTCTTGAGGAGG - Intergenic
902241918 1:15095187-15095209 CGTGAGGTTCCCGCATTGGTTGG - Intronic
904847158 1:33429182-33429204 AGTAAGGGTCCATCATGTGGAGG - Intronic
912504912 1:110149948-110149970 CGTGAGGGAACCTCCTGGAGAGG - Intergenic
913331742 1:117673333-117673355 TGGTAGGGTCCCTCATTGGGAGG + Intergenic
913670440 1:121093285-121093307 TATGATGGTCCCTCAGGGGGAGG - Intronic
914022207 1:143880726-143880748 TATGATGGTCCCTCAGGGGGAGG - Intergenic
914660692 1:149788652-149788674 TATGATGGTCCCTCAGGGGGAGG - Intronic
919019351 1:192084351-192084373 TATGACAGTCCCTCATGGGGTGG - Intergenic
919951434 1:202367899-202367921 CGGGAGGGTCCCTCATGGTTTGG + Intronic
921836670 1:219785444-219785466 CGGGAAGGTCCTTCCTGGGGAGG - Intronic
1063463430 10:6228726-6228748 TGTGGGGGGTCCTCATGGGGAGG - Intronic
1066655919 10:37699906-37699928 CGTGAGGGATCCTGGTGGGGAGG + Intergenic
1067040367 10:42949827-42949849 CGTGAGGGATCCTGGTGGGGAGG + Intergenic
1069914911 10:71781506-71781528 AGAGTGGGCCCCTCATGGGGAGG - Intronic
1075160015 10:120015291-120015313 CCTGAGGGGCCGTCTTGGGGTGG + Intergenic
1076405675 10:130211105-130211127 TGTGAGGAGCCCCCATGGGGAGG - Intergenic
1076736353 10:132460903-132460925 AGTGAGGGGCCCTCCTGGGATGG + Intergenic
1077235585 11:1480646-1480668 CGTGGGGGTCCCCCTTGAGGAGG + Intronic
1082749266 11:56999762-56999784 AGAGAGGGTCCATAATGGGGAGG + Intergenic
1083270223 11:61568495-61568517 CATGATGCTCCCTCCTGGGGAGG - Intronic
1084116157 11:67044344-67044366 CGGGAGGGTCCTGCCTGGGGCGG - Intronic
1084567398 11:69939106-69939128 CGTTAGAGTCCCCCATGGGGTGG + Intergenic
1085476715 11:76793810-76793832 GAGGAGGGTCCCACATGGGGAGG + Intronic
1089358949 11:117873885-117873907 AGTGAGGGTCCCTTAGTGGGCGG - Intronic
1096933173 12:55238888-55238910 CGTGAATGTCCCTCATGGCATGG + Intergenic
1100722290 12:97371623-97371645 CATGAGGGAACCTCCTGGGGTGG + Intergenic
1107445938 13:40470474-40470496 CGTGGGGGTCCCAGATGGGCTGG + Intergenic
1111661187 13:91213922-91213944 GGTGAGGGTCCTTGATGGTGGGG + Intergenic
1113451589 13:110413827-110413849 CCTGAGGGTCCCACATGCTGAGG - Intronic
1113520465 13:110936941-110936963 CGTCAGGGTGCCGCATGGAGTGG - Intergenic
1113790406 13:113025294-113025316 CGTGAGGTTTCATCATGGTGGGG + Intronic
1113790589 13:113025996-113026018 CGTGAGGTTTCATCATGGTGGGG + Intronic
1119476682 14:74934598-74934620 CGTCAGGGTCCAACCTGGGGGGG - Intergenic
1119942445 14:78655980-78656002 CATGAAGGTCCCTCATGAGTGGG - Intronic
1122774613 14:104111723-104111745 TGTGCGGGTCCTGCATGGGGAGG - Intronic
1122815884 14:104313782-104313804 CCTGAGGGTCCCTGAGGGGTGGG + Intergenic
1129388298 15:75207705-75207727 CCTGAGGGGCCCTCCTGGGCAGG - Exonic
1132644457 16:992400-992422 CCTGCGAGACCCTCATGGGGAGG + Intergenic
1132937806 16:2490480-2490502 TGTGAGGGTGCCTCCTGTGGGGG - Intronic
1134441355 16:14301531-14301553 GGTGAGAGACCGTCATGGGGTGG + Intergenic
1134655237 16:15943228-15943250 TGTGAGAGCCCCTAATGGGGAGG + Intergenic
1137674730 16:50298702-50298724 CCTGGGGGTTCCTCCTGGGGAGG + Intronic
1138537356 16:57667118-57667140 TGTCAGGGTCACTCATGGTGTGG - Intergenic
1139252916 16:65513389-65513411 CGTGAGGGACCCTCATGACTGGG - Intergenic
1142491002 17:279563-279585 TGTGAGGGTGACTCATGAGGGGG + Intronic
1142744229 17:1947744-1947766 TGTGAAGGTCTCGCATGGGGTGG + Intronic
1144503880 17:15813397-15813419 TGTGAAGGTCTCTCATAGGGGGG + Intergenic
1144633067 17:16885210-16885232 TGTGAGGGTCTCTCATAGGGGGG + Intergenic
1144945189 17:18966137-18966159 CGTGGGGGTCCTGCATGGGGAGG + Intronic
1145167734 17:20628899-20628921 TGTGAGGGTCTCTCATAGGGGGG + Intergenic
1145268106 17:21390170-21390192 GGTGACAGTCCATCATGGGGAGG - Intronic
1146904466 17:36609106-36609128 CGTGGGGGGCCCCCGTGGGGTGG - Intergenic
1147604985 17:41769392-41769414 TGTGAGGGTCCCTGCTAGGGTGG - Intronic
1149784082 17:59421011-59421033 GGTGAGGGTAGGTCATGGGGGGG + Intergenic
1151721015 17:75855954-75855976 GGGGAGAGTCCCTCATGGGAAGG + Intronic
1160763130 19:795793-795815 TGTGAGGGTGCCTGACGGGGAGG - Intergenic
1160840003 19:1142174-1142196 AGTGAGGGTTGATCATGGGGAGG - Intronic
1160909017 19:1466314-1466336 CTTGAGGGTGCCTCAAGGGCGGG + Exonic
1161196023 19:2987238-2987260 CGTGAGTGTCCCTGAGGGTGAGG + Exonic
1161849979 19:6733137-6733159 CGTGGGGGACCCTCAGGGGCAGG + Intronic
1162013295 19:7830622-7830644 CCTGCGGGGTCCTCATGGGGAGG - Intronic
1162420781 19:10565179-10565201 GGAGAGGGGCCCTCTTGGGGTGG + Intronic
1163684157 19:18701164-18701186 CCTGAAGGTCCACCATGGGGTGG + Intronic
1163743939 19:19033695-19033717 CGTGAGCGTCCCGGAAGGGGCGG + Exonic
1165929261 19:39345525-39345547 CCTGAGGGTGCCTCAAGGGGAGG - Intronic
1166553714 19:43684224-43684246 CTGGAAGGCCCCTCATGGGGTGG + Intergenic
1167350239 19:48969696-48969718 GGTGGGGGTCCCTCCTGGAGTGG - Intronic
924979320 2:206922-206944 CGTGAGGGTGCCGCATGCTGAGG + Intergenic
927476702 2:23419371-23419393 CTGGAGGGTCCCACCTGGGGAGG + Intronic
927602284 2:24454597-24454619 CGCGATCTTCCCTCATGGGGTGG - Intergenic
929923859 2:46193442-46193464 AGTGAGGATCCCTCATTGGGGGG - Intergenic
947587362 2:231364870-231364892 GGTCAGGGTGCCTCACGGGGTGG - Intronic
1168890631 20:1293636-1293658 AGGCAGGGTCCCTCATGGGAGGG - Intronic
1168998114 20:2147545-2147567 CGTTAGGGTCCCTCCTTAGGGGG - Exonic
1172445649 20:34991975-34991997 TGTGAAGGCCCCTCATGAGGGGG - Intronic
1174354388 20:49988449-49988471 CCTGAGGGTTCCTTGTGGGGGGG - Exonic
1176197513 20:63844294-63844316 CATGATGGTCCCTCAGGGGCGGG - Intergenic
1177757697 21:25367630-25367652 CCTGAGGGCCCCCCTTGGGGTGG + Intergenic
1179786739 21:43734552-43734574 GAGGAGGGTCCCCCATGGGGTGG + Intronic
1180057720 21:45367466-45367488 CCTGGGGGTCCCAGATGGGGAGG + Intergenic
1180083108 21:45495432-45495454 GGTGAGTGTCTCTCAAGGGGCGG + Exonic
1180232738 21:46437118-46437140 CGAGAGGGCCCCTCTGGGGGAGG - Intronic
1180624087 22:17182389-17182411 AGTGAGGGTCCCCAGTGGGGTGG - Intronic
1181278423 22:21702052-21702074 GGAGAAGGTCCTTCATGGGGAGG + Intronic
1181630821 22:24150414-24150436 CGTGAGGGTCCCTCATGGGGTGG + Intronic
1183639710 22:39085396-39085418 CGTGTGCTTCCCTCATGGGGAGG - Intronic
1183654096 22:39175135-39175157 CGTGAGGGGCCCCCAGGTGGGGG + Intergenic
1183985643 22:41568797-41568819 CCTGAGAGCCCATCATGGGGAGG + Intronic
951317578 3:21205402-21205424 GGTTCGGGTCCCTCATGGTGGGG + Intergenic
951473840 3:23083502-23083524 CCTCAAGGTCCCTCATGAGGAGG - Intergenic
954541751 3:51397651-51397673 CGTGTAGCTCTCTCATGGGGAGG - Exonic
968448276 4:663399-663421 GGAAAGGGCCCCTCATGGGGTGG + Intronic
969497460 4:7534331-7534353 CCTGTGGCTCCCTGATGGGGGGG - Intronic
971375886 4:26055634-26055656 CCTGAGGCTCCTTCTTGGGGTGG - Intergenic
971585036 4:28394613-28394635 GGTGAGGATCCCTCATGGCTTGG + Intronic
972849398 4:43030376-43030398 CATGAGTGTCCCTCTTGTGGAGG + Exonic
973804007 4:54507310-54507332 CGTGAGGAGCCCTCATGGAAAGG + Intergenic
976024407 4:80670144-80670166 CATGGGGGTCTGTCATGGGGAGG - Intronic
981504242 4:145482229-145482251 CGGGAGGCGCCATCATGGGGGGG - Intronic
985714057 5:1445865-1445887 CGTAGGGGCCCCTGATGGGGAGG - Intergenic
994421982 5:99534090-99534112 GGAGAGGGGACCTCATGGGGTGG + Intergenic
994460861 5:100066494-100066516 GGAGAGGGGACCTCATGGGGTGG - Intergenic
994485008 5:100379919-100379941 GGAGAGGGGGCCTCATGGGGTGG - Intergenic
999725951 5:154437869-154437891 TGTGAGGGGCCTTAATGGGGAGG + Intergenic
1002529181 5:179833722-179833744 CCTGTGGGTCCCTCCTGGGAGGG - Exonic
1005118017 6:22359614-22359636 CAAGAGGGTCCCTCAGGGAGAGG + Intergenic
1006119404 6:31795114-31795136 GGGGAGGGTCCCGGATGGGGAGG - Exonic
1012184680 6:96197958-96197980 CAGGAGGCTCCCTCATGGAGAGG - Intronic
1017769092 6:157631422-157631444 CGTGGGGGTCACTGATGAGGGGG - Intronic
1017962209 6:159232673-159232695 CGAGATGATCCCCCATGGGGTGG - Exonic
1020165394 7:5803712-5803734 CATTAGGGTCCCTCTTGGTGTGG + Intergenic
1021749859 7:23785829-23785851 CGTGGGGGCCTGTCATGGGGTGG + Intronic
1030693135 7:112555483-112555505 CGTGAAGGGCCCTCATGGCTGGG + Intergenic
1031482871 7:122299990-122300012 CGTGAGGGTCCCTGCGGGGCTGG + Intergenic
1032197018 7:129795268-129795290 CCTGTGGGTTCCTCAAGGGGTGG - Intergenic
1035206914 7:157299933-157299955 GGGGAGGGTCCCACGTGGGGAGG - Intergenic
1045072875 8:98528738-98528760 CATCAGGGTCCCTTGTGGGGAGG - Intronic
1047731997 8:127735947-127735969 CGGGAGGGGCGCTTATGGGGAGG - Intronic
1052134673 9:24894979-24895001 CGTCAGGGCCTGTCATGGGGTGG + Intergenic
1062606875 9:137352397-137352419 CCCCAGGGTCCCTCATGGGTCGG + Intronic
1191794532 X:65006544-65006566 CATCAGGGTCTGTCATGGGGTGG + Intronic
1194341945 X:92716234-92716256 CGTGAGGGACCCACTTGAGGAGG - Intergenic
1200650292 Y:5832927-5832949 CGTGAGGGACCCACTTGAGGAGG - Intergenic