ID: 1181631895

View in Genome Browser
Species Human (GRCh38)
Location 22:24155978-24156000
Sequence CTCTCGCTCGCGGCGGGCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 71}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181631895_1181631903 7 Left 1181631895 22:24155978-24156000 CCCCGGCCCGCCGCGAGCGAGAG 0: 1
1: 0
2: 1
3: 6
4: 71
Right 1181631903 22:24156008-24156030 GAGCCTCCGCGGCCATGGCCCGG 0: 1
1: 0
2: 0
3: 10
4: 179
1181631895_1181631901 -4 Left 1181631895 22:24155978-24156000 CCCCGGCCCGCCGCGAGCGAGAG 0: 1
1: 0
2: 1
3: 6
4: 71
Right 1181631901 22:24155997-24156019 AGAGAGCGAACGAGCCTCCGCGG 0: 1
1: 0
2: 2
3: 4
4: 52
1181631895_1181631902 2 Left 1181631895 22:24155978-24156000 CCCCGGCCCGCCGCGAGCGAGAG 0: 1
1: 0
2: 1
3: 6
4: 71
Right 1181631902 22:24156003-24156025 CGAACGAGCCTCCGCGGCCATGG 0: 1
1: 0
2: 0
3: 2
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181631895 Original CRISPR CTCTCGCTCGCGGCGGGCCG GGG (reversed) Intronic