ID: 1181632213

View in Genome Browser
Species Human (GRCh38)
Location 22:24157185-24157207
Sequence GGCCAGGTTGAACACCCCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 66}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181632213_1181632222 11 Left 1181632213 22:24157185-24157207 CCCTAGGGGTGTTCAACCTGGCC 0: 1
1: 0
2: 0
3: 5
4: 66
Right 1181632222 22:24157219-24157241 CCCCTTTCCTCCCAACCTTAGGG No data
1181632213_1181632232 28 Left 1181632213 22:24157185-24157207 CCCTAGGGGTGTTCAACCTGGCC 0: 1
1: 0
2: 0
3: 5
4: 66
Right 1181632232 22:24157236-24157258 TTAGGGGAGGAACAGGACTGCGG 0: 1
1: 0
2: 2
3: 33
4: 319
1181632213_1181632233 29 Left 1181632213 22:24157185-24157207 CCCTAGGGGTGTTCAACCTGGCC 0: 1
1: 0
2: 0
3: 5
4: 66
Right 1181632233 22:24157237-24157259 TAGGGGAGGAACAGGACTGCGGG 0: 1
1: 0
2: 0
3: 30
4: 269
1181632213_1181632229 21 Left 1181632213 22:24157185-24157207 CCCTAGGGGTGTTCAACCTGGCC 0: 1
1: 0
2: 0
3: 5
4: 66
Right 1181632229 22:24157229-24157251 CCCAACCTTAGGGGAGGAACAGG 0: 1
1: 0
2: 1
3: 12
4: 122
1181632213_1181632224 12 Left 1181632213 22:24157185-24157207 CCCTAGGGGTGTTCAACCTGGCC 0: 1
1: 0
2: 0
3: 5
4: 66
Right 1181632224 22:24157220-24157242 CCCTTTCCTCCCAACCTTAGGGG 0: 1
1: 0
2: 1
3: 20
4: 213
1181632213_1181632226 15 Left 1181632213 22:24157185-24157207 CCCTAGGGGTGTTCAACCTGGCC 0: 1
1: 0
2: 0
3: 5
4: 66
Right 1181632226 22:24157223-24157245 TTTCCTCCCAACCTTAGGGGAGG 0: 1
1: 0
2: 0
3: 12
4: 99
1181632213_1181632220 10 Left 1181632213 22:24157185-24157207 CCCTAGGGGTGTTCAACCTGGCC 0: 1
1: 0
2: 0
3: 5
4: 66
Right 1181632220 22:24157218-24157240 GCCCCTTTCCTCCCAACCTTAGG 0: 1
1: 0
2: 1
3: 28
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181632213 Original CRISPR GGCCAGGTTGAACACCCCTA GGG (reversed) Intronic
902253065 1:15168610-15168632 GGCAAGGTTGAAGAACTCTATGG - Exonic
907460406 1:54602176-54602198 GGCCAGGATCAGCACCCCAATGG - Intronic
913684877 1:121222264-121222286 GGTCAGGTTCAGCAGCCCTATGG - Intronic
914036716 1:144009885-144009907 GGTCAGGTTCAGCAGCCCTATGG - Intergenic
914152738 1:145058062-145058084 GGTCAGGTTCAGCAGCCCTATGG + Intronic
915651127 1:157311662-157311684 GCCCAGGCAGAACACCCCCAAGG + Intergenic
915660293 1:157399896-157399918 GCCCAGGCAGAACACCCCCAAGG - Intergenic
920472192 1:206240819-206240841 GGTCAGGTTCAGCAGCCCTATGG - Intronic
923730290 1:236543574-236543596 TGCAAGGTTGAACACCCCCATGG + Exonic
1065428850 10:25633246-25633268 GGTCAGATTTAACACCCCTAGGG + Intergenic
1066425592 10:35304822-35304844 GCCCAGGTTGAGAACCACTAGGG + Intronic
1070059344 10:72967366-72967388 GGCCTGGCAGAACACCCCTTGGG - Intergenic
1070580866 10:77718372-77718394 GGTCAGATTGAACACAGCTAAGG + Intergenic
1071827060 10:89335973-89335995 AGCCAAATTGAAAACCCCTAGGG + Intronic
1076113230 10:127877020-127877042 AGCCAGGTTGAACACTGATAGGG - Intergenic
1078923820 11:15856801-15856823 GGCCATGCTGACCACCCATAGGG + Intergenic
1091308560 11:134556849-134556871 GGCCAGTTTGTACACACATAGGG + Intergenic
1104488023 12:129168624-129168646 GCCCAGGTGGAACCCCCCTGGGG - Intronic
1105327431 13:19382944-19382966 GGCCAGGTAGAGCACCGCCACGG - Intergenic
1109761111 13:66830261-66830283 GTCCAGGTTGAACAGTCATATGG - Intronic
1110613818 13:77519504-77519526 GGCAAGGTGGCACACACCTATGG - Intergenic
1117741960 14:58827945-58827967 GGCCAAGTGGAACAGCCCCAGGG - Intergenic
1118944387 14:70370788-70370810 GGACAAGTTGAAGACCCTTAAGG - Exonic
1120354875 14:83419528-83419550 AGGCAGGTTGAACACCGCTCTGG + Intergenic
1138541688 16:57691491-57691513 TGCCATGTTGAGCACCCATAAGG + Intergenic
1142467600 17:145125-145147 GGCCAGGTTAGACACCTCTGGGG + Intergenic
1142753967 17:2004649-2004671 GGCCAGGGAGAAGTCCCCTAAGG - Intronic
1144262534 17:13536602-13536624 GCCCACGTTTAACACCCCTAGGG + Intronic
1144347462 17:14362368-14362390 GGCCAAACTGAACACACCTATGG - Intergenic
1150257970 17:63764046-63764068 GGCCTGGTTTAACACTCATAGGG - Exonic
1152189877 17:78881933-78881955 TGCCAGGTTGACCAGCCATATGG - Intronic
1152466739 17:80470927-80470949 GGCCAGGTTGTACACCTCCCCGG + Exonic
1160809710 19:1008092-1008114 GGCCAGGTGGGACAGCCCCAGGG - Intronic
929482067 2:42318842-42318864 GGCAAGGTGGCACACACCTATGG - Intronic
937162481 2:119777792-119777814 GGCATGGTGGAACACACCTATGG - Intronic
942150894 2:173075626-173075648 GGCGAGGGGGAACACCCCCACGG + Intronic
945500182 2:210563160-210563182 AGCCAGGTTAAACACAACTATGG - Intronic
948592374 2:239059748-239059770 GGACAGGGAGAACACTCCTAGGG + Intronic
1170463531 20:16601442-16601464 GGCCAAGCTGAAGACCCCAAGGG - Intergenic
1175515329 20:59566357-59566379 GGCCATGTTGACCACCCCTGAGG + Intergenic
1176117717 20:63440274-63440296 GGCCAGGTTGGACCTCCCCAAGG + Intronic
1178943268 21:36925363-36925385 GGCCACGATGAACACCCACAAGG + Intronic
1181632213 22:24157185-24157207 GGCCAGGTTGAACACCCCTAGGG - Intronic
1183806462 22:40215600-40215622 GGCCAGTGTCAACACCCCTGAGG - Intronic
953362367 3:42309287-42309309 GGCCTGGCAGAACACCCCCATGG - Intergenic
953485834 3:43294568-43294590 GTACAGGTTGAGCATCCCTAAGG - Intronic
953912099 3:46898442-46898464 GGCCAGGATGAGCACAGCTACGG - Exonic
957232110 3:77533444-77533466 GGCCAGGTTGCACTCTCCTCCGG + Intronic
966718330 3:183036232-183036254 AGCCAGGATGAACCCCACTATGG + Intronic
971683358 4:29731531-29731553 GGCCAAGTTGAACATTTCTAAGG - Intergenic
973112670 4:46414601-46414623 AGCCAGTTTGAAGACCTCTACGG - Intronic
976949399 4:90810772-90810794 GGCCAAGTGGCACACCCCTTTGG - Intronic
980321194 4:131278937-131278959 GGCCAGGTTGCAGACAACTAAGG + Intergenic
990391066 5:55321558-55321580 GGTCAGATTGAATTCCCCTATGG + Intronic
995600797 5:113793373-113793395 TGCCACATTGCACACCCCTAAGG - Intergenic
998234370 5:140385592-140385614 GGGGAGGTTGAAAACCTCTAGGG + Intergenic
999442727 5:151615121-151615143 GGGCAGGCTGTACACCTCTAAGG - Intergenic
1005961806 6:30699052-30699074 GGCATGGTTGCACACACCTATGG + Intergenic
1007645442 6:43376785-43376807 TGCCATGTTGAGCAACCCTATGG + Intergenic
1012390978 6:98739905-98739927 GGCATGGTGGAACACACCTATGG + Intergenic
1017291000 6:152736489-152736511 GACCAGGTTCAAGACCCCAAAGG + Intergenic
1031528693 7:122851262-122851284 GGCCCAGTTGAACATCCCTGGGG - Intronic
1034692082 7:153021901-153021923 GGCCAGGTTGAACACAGCTTGGG + Intergenic
1035699483 8:1627133-1627155 GGCCAGGATGACCACCCTTTTGG - Intronic
1037983296 8:23270606-23270628 GGCCAGGTGGCACACGCCTGTGG + Intronic
1040329671 8:46379443-46379465 GGCCATGCAGAACACCCCTGGGG - Intergenic
1055014644 9:71602961-71602983 GGACAGCTTCAACAACCCTATGG + Intergenic
1056262368 9:84861929-84861951 GGCCAGGATGAACAAGCATAGGG - Intronic
1062444563 9:136588197-136588219 TCCCAGGTTGCACACCCCCATGG + Intergenic
1062587093 9:137254320-137254342 GGCCAAGTTGGTCAGCCCTAGGG - Intergenic
1192080103 X:68039551-68039573 GGAGAGGTTGAACAACCCTGGGG + Intergenic
1200083727 X:153592566-153592588 GGCCAGGTAGAGCACCGCCACGG + Exonic