ID: 1181632213

View in Genome Browser
Species Human (GRCh38)
Location 22:24157185-24157207
Sequence GGCCAGGTTGAACACCCCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181632213_1181632224 12 Left 1181632213 22:24157185-24157207 CCCTAGGGGTGTTCAACCTGGCC No data
Right 1181632224 22:24157220-24157242 CCCTTTCCTCCCAACCTTAGGGG No data
1181632213_1181632226 15 Left 1181632213 22:24157185-24157207 CCCTAGGGGTGTTCAACCTGGCC No data
Right 1181632226 22:24157223-24157245 TTTCCTCCCAACCTTAGGGGAGG No data
1181632213_1181632229 21 Left 1181632213 22:24157185-24157207 CCCTAGGGGTGTTCAACCTGGCC No data
Right 1181632229 22:24157229-24157251 CCCAACCTTAGGGGAGGAACAGG No data
1181632213_1181632222 11 Left 1181632213 22:24157185-24157207 CCCTAGGGGTGTTCAACCTGGCC No data
Right 1181632222 22:24157219-24157241 CCCCTTTCCTCCCAACCTTAGGG No data
1181632213_1181632233 29 Left 1181632213 22:24157185-24157207 CCCTAGGGGTGTTCAACCTGGCC No data
Right 1181632233 22:24157237-24157259 TAGGGGAGGAACAGGACTGCGGG No data
1181632213_1181632220 10 Left 1181632213 22:24157185-24157207 CCCTAGGGGTGTTCAACCTGGCC No data
Right 1181632220 22:24157218-24157240 GCCCCTTTCCTCCCAACCTTAGG No data
1181632213_1181632232 28 Left 1181632213 22:24157185-24157207 CCCTAGGGGTGTTCAACCTGGCC No data
Right 1181632232 22:24157236-24157258 TTAGGGGAGGAACAGGACTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181632213 Original CRISPR GGCCAGGTTGAACACCCCTA GGG (reversed) Intronic