ID: 1181632218

View in Genome Browser
Species Human (GRCh38)
Location 22:24157201-24157223
Sequence AGGGGCCCCAGAAGCAGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181632218_1181632235 17 Left 1181632218 22:24157201-24157223 CCTGGCCTGCTTCTGGGGCCCCT No data
Right 1181632235 22:24157241-24157263 GGAGGAACAGGACTGCGGGAGGG No data
1181632218_1181632220 -6 Left 1181632218 22:24157201-24157223 CCTGGCCTGCTTCTGGGGCCCCT No data
Right 1181632220 22:24157218-24157240 GCCCCTTTCCTCCCAACCTTAGG No data
1181632218_1181632233 13 Left 1181632218 22:24157201-24157223 CCTGGCCTGCTTCTGGGGCCCCT No data
Right 1181632233 22:24157237-24157259 TAGGGGAGGAACAGGACTGCGGG No data
1181632218_1181632224 -4 Left 1181632218 22:24157201-24157223 CCTGGCCTGCTTCTGGGGCCCCT No data
Right 1181632224 22:24157220-24157242 CCCTTTCCTCCCAACCTTAGGGG No data
1181632218_1181632236 18 Left 1181632218 22:24157201-24157223 CCTGGCCTGCTTCTGGGGCCCCT No data
Right 1181632236 22:24157242-24157264 GAGGAACAGGACTGCGGGAGGGG No data
1181632218_1181632229 5 Left 1181632218 22:24157201-24157223 CCTGGCCTGCTTCTGGGGCCCCT No data
Right 1181632229 22:24157229-24157251 CCCAACCTTAGGGGAGGAACAGG No data
1181632218_1181632226 -1 Left 1181632218 22:24157201-24157223 CCTGGCCTGCTTCTGGGGCCCCT No data
Right 1181632226 22:24157223-24157245 TTTCCTCCCAACCTTAGGGGAGG No data
1181632218_1181632232 12 Left 1181632218 22:24157201-24157223 CCTGGCCTGCTTCTGGGGCCCCT No data
Right 1181632232 22:24157236-24157258 TTAGGGGAGGAACAGGACTGCGG No data
1181632218_1181632234 16 Left 1181632218 22:24157201-24157223 CCTGGCCTGCTTCTGGGGCCCCT No data
Right 1181632234 22:24157240-24157262 GGGAGGAACAGGACTGCGGGAGG No data
1181632218_1181632222 -5 Left 1181632218 22:24157201-24157223 CCTGGCCTGCTTCTGGGGCCCCT No data
Right 1181632222 22:24157219-24157241 CCCCTTTCCTCCCAACCTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181632218 Original CRISPR AGGGGCCCCAGAAGCAGGCC AGG (reversed) Intronic