ID: 1181632220

View in Genome Browser
Species Human (GRCh38)
Location 22:24157218-24157240
Sequence GCCCCTTTCCTCCCAACCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 240}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181632213_1181632220 10 Left 1181632213 22:24157185-24157207 CCCTAGGGGTGTTCAACCTGGCC 0: 1
1: 0
2: 0
3: 5
4: 66
Right 1181632220 22:24157218-24157240 GCCCCTTTCCTCCCAACCTTAGG 0: 1
1: 0
2: 1
3: 28
4: 240
1181632211_1181632220 15 Left 1181632211 22:24157180-24157202 CCTGTCCCTAGGGGTGTTCAACC 0: 1
1: 0
2: 0
3: 6
4: 70
Right 1181632220 22:24157218-24157240 GCCCCTTTCCTCCCAACCTTAGG 0: 1
1: 0
2: 1
3: 28
4: 240
1181632214_1181632220 9 Left 1181632214 22:24157186-24157208 CCTAGGGGTGTTCAACCTGGCCT 0: 1
1: 0
2: 2
3: 5
4: 96
Right 1181632220 22:24157218-24157240 GCCCCTTTCCTCCCAACCTTAGG 0: 1
1: 0
2: 1
3: 28
4: 240
1181632218_1181632220 -6 Left 1181632218 22:24157201-24157223 CCTGGCCTGCTTCTGGGGCCCCT 0: 1
1: 2
2: 5
3: 60
4: 454
Right 1181632220 22:24157218-24157240 GCCCCTTTCCTCCCAACCTTAGG 0: 1
1: 0
2: 1
3: 28
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181632220 Original CRISPR GCCCCTTTCCTCCCAACCTT AGG Intronic
900149185 1:1170844-1170866 GCCCCTTTGCCACCAACCTGTGG - Intergenic
900679510 1:3908914-3908936 GCCCCCTGCCTCCCCTCCTTTGG - Intergenic
901917542 1:12511433-12511455 GCCTGTTTCCTCCAAAGCTTTGG - Exonic
902502194 1:16918468-16918490 GTCCCCTTCCTCCAACCCTTAGG + Intronic
903606150 1:24576461-24576483 TCCCCTTTCCTGCCAAGCCTGGG - Intronic
903818676 1:26084138-26084160 GCCCTTTCCCTACCAATCTTGGG - Intergenic
907920170 1:58904190-58904212 GCCCCTTCCCTCCCTCTCTTTGG + Intergenic
909344544 1:74570940-74570962 GCCCCTTTCCTGACAGGCTTAGG + Intronic
912961000 1:114196034-114196056 GCCCATTTCCTCCCCACTCTGGG - Intergenic
915091446 1:153429055-153429077 GTCCCTGTGCTCCCAACCCTGGG + Intergenic
917287817 1:173440001-173440023 GCCCATTTTCTGCCTACCTTTGG + Intergenic
919748930 1:201024676-201024698 GCCCCCTGCCTCCCAACATTGGG + Intergenic
920508950 1:206536573-206536595 GCTCCTTTTCTCCCCACTTTTGG - Intronic
922211139 1:223487683-223487705 GCTCCCTTCCTCCCAGCCTGGGG + Intergenic
924022295 1:239797196-239797218 CCTCCTTTCCTCCCAATTTTTGG - Intronic
924364491 1:243276808-243276830 GCCCCTTCCCTCCCATCCCCTGG + Intronic
1062802556 10:390903-390925 GCCCCACTCCGCCCAGCCTTCGG + Intronic
1064982345 10:21177209-21177231 GCCCCTGTTCTCCCACCTTTTGG + Intergenic
1067075429 10:43177430-43177452 CCCTCTTTCCCCCCAAACTTAGG + Intronic
1067401555 10:45979114-45979136 GCCCATTTACTCCTAACCCTTGG - Intronic
1067833102 10:49621548-49621570 GTCCCTTTCCTCCCACCCCCCGG - Intronic
1067869907 10:49948695-49948717 GCCCATTTACTCCCAACCCTTGG - Intronic
1069773343 10:70913016-70913038 TCCCCTTCCCTCCCTGCCTTAGG + Intergenic
1069780033 10:70949612-70949634 GTCCCTCTCCTCCAAACCTCTGG - Intergenic
1069852749 10:71421002-71421024 GTTCCTTTCCCCCCAACCCTTGG + Intronic
1070440672 10:76439991-76440013 TACACTTTACTCCCAACCTTGGG - Intronic
1070617574 10:77980822-77980844 GCCCATTTCCTACCACCCTGAGG - Intronic
1073103722 10:101020578-101020600 AGCCCTTTCCCTCCAACCTTGGG + Intronic
1073188887 10:101635897-101635919 GCCCACTTCCTCCCTACCCTGGG + Intronic
1075193303 10:120331100-120331122 CCTCCTTTCTTCCCAGCCTTTGG + Intergenic
1075527057 10:123195602-123195624 GCCCCTTTCCTTTCAAGGTTCGG - Intergenic
1076356391 10:129856678-129856700 GCCCCATTCCTCCTTCCCTTGGG - Intronic
1076856071 10:133116139-133116161 GCCCCTTGCCCCCCTACCCTGGG + Intronic
1077390133 11:2297021-2297043 GCACCTTCCCTCCCACCCTGGGG + Intronic
1080908647 11:36573311-36573333 GCCTCTTTCCCACCCACCTTGGG + Exonic
1081038031 11:38174838-38174860 TCCACCTTGCTCCCAACCTTGGG + Intergenic
1087934912 11:104021807-104021829 GCCCTCTTCCACCCAAGCTTTGG - Intronic
1089065390 11:115658810-115658832 TCCCCTTTCCTTACATCCTTTGG + Intergenic
1089647660 11:119890735-119890757 GCCCCTTCCCTCAAACCCTTGGG + Intergenic
1091772928 12:3164997-3165019 GCCTCTTTCCTCCCAACCAAAGG - Intronic
1094680120 12:32660345-32660367 TCCCCTTTCTTCCCCACCTGGGG + Intergenic
1095052724 12:37568602-37568624 GCCCCTACCCTCCCACCCCTGGG + Intergenic
1097290046 12:57906906-57906928 GCCCCTCCCCACCCATCCTTTGG - Intergenic
1097878931 12:64669756-64669778 GGCCCTTTCCTCCCAGCCTCGGG + Intronic
1099316478 12:81088953-81088975 GCTCCCTTCCTCCCACCTTTAGG - Intronic
1100581108 12:95941852-95941874 GCCCCCTCCCCCCCACCCTTAGG + Intronic
1101910121 12:108855321-108855343 GCCCCATTCTCCCTAACCTTAGG - Intronic
1104806699 12:131594018-131594040 TCCCCTTTCCTCCACATCTTTGG + Intergenic
1105249438 13:18684676-18684698 TCTCCTTCCCTCCCACCCTTTGG - Intergenic
1106395493 13:29376472-29376494 TCCCCTTTCCTACCTTCCTTTGG - Intronic
1107826215 13:44331147-44331169 GCCCCTTTCTTCTCACCCTTGGG + Intergenic
1109008403 13:56908563-56908585 TCCCCTTTCCTCCCTGCTTTTGG - Intergenic
1109936965 13:69299611-69299633 GTCACTTTCCTGCCAACCTGGGG + Intergenic
1113880753 13:113624130-113624152 GCCCTGTTCCTGCCAACCCTGGG + Intronic
1115355195 14:32439381-32439403 TCCCCTTTCCTCCCCACACTGGG - Intronic
1118612920 14:67555455-67555477 GCCCCTTTCCTCTCAGCATTGGG - Intronic
1120825893 14:88955023-88955045 CCTTCTTTCCTCCCAACCCTAGG + Intergenic
1121439900 14:93942050-93942072 GCCCCTCTCCTCCCAACTATGGG + Intronic
1121565217 14:94904260-94904282 GCCCCTTGCCCCCCAGCCTTTGG - Intergenic
1122444969 14:101761623-101761645 GCCCCTCTCCTCCCACCCCCCGG - Intergenic
1122875819 14:104664426-104664448 GCCCCTCTCCTCCCTCCCCTTGG + Intergenic
1123012737 14:105357201-105357223 TCACCTGTCCTCCCAGCCTTGGG + Intronic
1123110935 14:105866571-105866593 CCCCCTTTCCACCCAGCCTCAGG - Intergenic
1124492847 15:30168647-30168669 GACCCATTGCTCCCAGCCTTGGG - Intergenic
1124750687 15:32369678-32369700 GACCCATTGCTCCCAGCCTTGGG + Intergenic
1124795529 15:32774685-32774707 ACCCCTTCCGTCCCTACCTTTGG + Intronic
1126175616 15:45732811-45732833 TCCCCTTTCCTCCCAGCCTCTGG - Intergenic
1126464489 15:48949061-48949083 GCCACTTACCTCAAAACCTTAGG + Intronic
1126689359 15:51275946-51275968 GCCCTTTTCCTTCAAACCTCAGG - Intronic
1130967793 15:88710029-88710051 GCCCCTTCCCCCCCACCCCTGGG - Intergenic
1131223767 15:90607356-90607378 GCCTCTCTCCTCCCCTCCTTAGG + Exonic
1131380182 15:91956912-91956934 GCGCCTGTAGTCCCAACCTTGGG - Intronic
1133235122 16:4384124-4384146 GCCCCTTTCTCCCCACCCATGGG - Intronic
1133286361 16:4692653-4692675 GCCACTTTCCTCCCCACCAGGGG - Intergenic
1133323637 16:4930415-4930437 GCCCCATTCATCCCCACCTCCGG + Intronic
1134245564 16:12537102-12537124 GTCCCTTTCCTCCCAGCTGTTGG + Intronic
1137504069 16:49035784-49035806 GTCCCTTCCCTCCCAAGCCTGGG + Intergenic
1138119480 16:54387637-54387659 TTCCCTTTCCCCACAACCTTTGG + Intergenic
1138419774 16:56891842-56891864 GCCACGTTCATCCCCACCTTGGG - Intronic
1139896913 16:70294944-70294966 GACCCTTTCCTCCCACGTTTAGG + Intronic
1140478035 16:75248738-75248760 GCTCCTATCCTGCCAGCCTTAGG + Intronic
1140636082 16:76915450-76915472 TCCCCATACCTCCCATCCTTGGG - Intergenic
1140689630 16:77469372-77469394 GCCCCTTTACTTCCAGCCTGAGG + Intergenic
1140748032 16:77998337-77998359 GCCCCTTGCATCACAACCTTCGG + Intergenic
1141387582 16:83636431-83636453 GCTCCTTCCCTCCCCACTTTTGG + Intronic
1141735122 16:85847145-85847167 GCCGCTTCCCTCCAGACCTTGGG - Intergenic
1143416763 17:6756322-6756344 GCCCCTTTCCCCCAAATGTTAGG + Intronic
1145373243 17:22324541-22324563 GCCCCTACCCTCCCACCCCTGGG + Intergenic
1146007539 17:29170193-29170215 ACCCCTCTCATCCCAACCCTGGG + Intronic
1146399625 17:32492930-32492952 GGTTCTTTCCTCCCAGCCTTTGG - Exonic
1146500551 17:33360847-33360869 TCCTCTTTCCTCCCATCCCTAGG - Intronic
1146783375 17:35696334-35696356 TCCCCTCACCTCCCATCCTTTGG - Intronic
1147280044 17:39352196-39352218 GCCCTTTTCCACCCAACCTCTGG - Intronic
1148755397 17:49970381-49970403 GCGACTTTCCTACCAGCCTTTGG - Intronic
1150122208 17:62613532-62613554 GCCCATTTTCTGCCTACCTTTGG - Intronic
1151077986 17:71296367-71296389 GTCCCTTTCCTCCTAACTCTTGG + Intergenic
1151649376 17:75456775-75456797 GCCCCCTTGCTCCCCACTTTCGG - Intronic
1155457320 18:26031969-26031991 TCCCTTTTCTTCCCAACCTCTGG - Intronic
1155812540 18:30255667-30255689 TCCCCTTGCCCCCCAAACTTTGG - Intergenic
1156621412 18:38856213-38856235 TCCACTTCCCTCCCTACCTTTGG - Intergenic
1158474160 18:57765246-57765268 CTCCCCTTCCTCCCAACCTTTGG - Intronic
1162585074 19:11553386-11553408 GCCCCTGGCCCCCCAGCCTTGGG - Exonic
1163566958 19:18057679-18057701 GCCTCTTTCCTTCCTACCGTGGG - Intergenic
1164671693 19:30076207-30076229 GCCCCTCTCATCCCCACCTGGGG + Intergenic
1165570325 19:36770299-36770321 GCCCCTACCCTCCCACCCCTGGG - Intronic
1165773042 19:38389359-38389381 GACCCTGGCGTCCCAACCTTAGG - Intronic
1167503157 19:49858427-49858449 TCCCCTGTCCTCCCTACCTCAGG - Intronic
925181090 2:1817307-1817329 GCCCCTATCCCCCCACCCATGGG - Intronic
925872934 2:8286261-8286283 ACCCCTTTACTCCAAATCTTTGG - Intergenic
927357367 2:22188247-22188269 GCCCCCTCCCCCCCAACTTTGGG + Intergenic
927432099 2:23035489-23035511 GCTCCATTCCTTCCAGCCTTGGG + Intergenic
928225362 2:29443641-29443663 GCCCCTTTCCAACCATCCTGAGG - Intronic
930166736 2:48210544-48210566 CCCTCTTTCCCCCAAACCTTGGG + Intergenic
931158953 2:59666943-59666965 GATCCTTTCCTCACAGCCTTCGG - Intergenic
931515533 2:63048744-63048766 GCGCCTTTCCTCGGAACCTAAGG + Intergenic
932587574 2:73041327-73041349 GGCCCTTTCCTCCTATCCTGAGG - Intronic
934706855 2:96487503-96487525 ACACCTGTCATCCCAACCTTTGG + Intergenic
935268562 2:101414643-101414665 CCCCCTTTCCACCCATCCTCAGG - Intronic
937986048 2:127638596-127638618 GCCCCTCTCCCCCCGACCTTGGG - Exonic
938296992 2:130184614-130184636 GCCCCTCTCCACCCTCCCTTGGG - Intronic
938584065 2:132671308-132671330 TCCCCTTTCCGCACATCCTTAGG + Intronic
939176520 2:138754344-138754366 TCCCCTTCCCTCTGAACCTTTGG + Intronic
939767070 2:146264104-146264126 GCCCATTTCCAGCCAAACTTTGG + Intergenic
941440428 2:165528873-165528895 GCCCCATTCCTTCCAAGCTGGGG + Intronic
942060124 2:172221518-172221540 CCCCCTTCCCTCCCCACATTGGG - Intergenic
942243546 2:173986366-173986388 GCCCCTTTCCTTACTACCTCAGG + Intergenic
942500557 2:176586011-176586033 TCCCCTTTCTTCCCCATCTTAGG + Intergenic
944688795 2:202140876-202140898 GCCCCCTCCCTCCCTTCCTTGGG + Intronic
946358893 2:219207094-219207116 CACCCTTCCCTCCCAACCTGCGG - Intronic
946509803 2:220343345-220343367 GCCCCTCTTCTCCCCACCCTGGG + Intergenic
948731331 2:239965626-239965648 GCCCTTTGCATCTCAACCTTTGG - Intronic
949036272 2:241816993-241817015 GCCCCAAACCGCCCAACCTTGGG + Exonic
1170703761 20:18727150-18727172 GCCCCTCTGCTCCCACCCATGGG - Intronic
1171529550 20:25843786-25843808 GCCCCTACCCTCCCACCCCTGGG - Intronic
1171547276 20:26012094-26012116 GCCCCTACCCTCCCACCCCTGGG + Intergenic
1173486588 20:43445632-43445654 GCCTCTTTCATCCCACCCTAAGG - Intergenic
1173596310 20:44260775-44260797 GACCATTTCCACCCCACCTTGGG - Intronic
1174369620 20:50077803-50077825 GCCCCTTTCCACCCTGCCTGTGG - Intergenic
1175466615 20:59194056-59194078 GCCCCTTTTCTCCCATCCTGTGG - Exonic
1175609543 20:60339347-60339369 TCCCATTTCCTCCCAACCTCAGG - Intergenic
1175637639 20:60598901-60598923 GCCCCGTTCCTCACACCCTCAGG - Intergenic
1177098562 21:16870158-16870180 GCCGCCTTGCTCCCAACCTTGGG - Intergenic
1177766217 21:25460534-25460556 GCTCTTATCCTCCCCACCTTGGG + Intergenic
1180147428 21:45929179-45929201 GCCCTTCTCCTCCCATCCTCGGG - Intronic
1181522685 22:23458655-23458677 GCCCCTCCCCTCACCACCTTTGG - Intergenic
1181559495 22:23691981-23692003 GCCCCTTCCCTCCTAACCCCAGG + Exonic
1181632220 22:24157218-24157240 GCCCCTTTCCTCCCAACCTTAGG + Intronic
1182986782 22:34725995-34726017 GCCCATTTCCTCCCCAGATTTGG - Intergenic
1184100400 22:42339017-42339039 GCCCCTCTCCTCCCCACCCCTGG + Intronic
1184452318 22:44590537-44590559 GCCCCTTTCCTCCCTCCCGTGGG - Intergenic
949123598 3:418303-418325 ACCTCTTCCCTCCCCACCTTTGG - Intergenic
951072740 3:18351385-18351407 GCCCCTCTCCCACCACCCTTGGG - Exonic
952865099 3:37849961-37849983 TTCCCTTTCCTCCCAGCTTTGGG - Intergenic
954239688 3:49283808-49283830 GTCCCTATCCTCCCATCTTTGGG - Intronic
954318470 3:49814092-49814114 GCCCCATGCCTCCCACCCTCAGG - Intergenic
954408506 3:50358890-50358912 ACCTCTTTCCTCCCAACTTCTGG - Exonic
954455861 3:50599513-50599535 GCCTCTCTCCTCCCACCCTCAGG - Intergenic
954649595 3:52152995-52153017 CCCCATTTTCTCCCAACCCTTGG - Intronic
954668106 3:52270377-52270399 GCGCCTATAATCCCAACCTTTGG - Intronic
954760311 3:52869143-52869165 GCGCCTTTTCTCCCAACTTGAGG - Intronic
955073060 3:55588109-55588131 GCCTCCTTCCTCCCAACTTGTGG + Intronic
956779245 3:72591291-72591313 GCCTTTTTCCTCCCTACCTTAGG + Intergenic
957624618 3:82642242-82642264 GCACCTTTTCTCCCAAGCTTTGG + Intergenic
960143478 3:114173586-114173608 GCCTCTTCTCTCCCAACCTCAGG - Intronic
961726210 3:128932673-128932695 GCCGCCTTCCTCCCCAACTTGGG - Intronic
962073813 3:132059282-132059304 GCCCCTTTCTTCCCATGGTTAGG - Intronic
962316174 3:134360846-134360868 CCATCTTTCCTCCCAATCTTGGG + Intronic
962804225 3:138915643-138915665 GGCCATTTCCTCCCAACTTTCGG + Intergenic
963935505 3:151047935-151047957 GCCCCTTTCCATCCAACAGTAGG - Intergenic
965073581 3:163947522-163947544 GCCCCTTTCCCCCAAACCACTGG - Intergenic
967852959 3:194095812-194095834 TCCCCTCTCCTCCCCACCTCAGG - Intergenic
968758093 4:2427174-2427196 GCTCCTGTCCTCCCATCCCTGGG + Intronic
968916296 4:3498427-3498449 ACCCCTCACCGCCCAACCTTGGG + Intronic
969216775 4:5729440-5729462 CCCACTTTCCTCCCAATCTCTGG - Intronic
972841032 4:42930186-42930208 TCCCCTAGTCTCCCAACCTTTGG - Intronic
973348485 4:49082588-49082610 GCCACTTCTCTCCCAACCTCCGG + Intergenic
974817313 4:67021900-67021922 GCTCCTTTCTCCCTAACCTTGGG - Intergenic
978534774 4:109749433-109749455 GCCCCTTTCCCCCCAAATTTAGG + Intronic
978691892 4:111523750-111523772 GCCCCTTTCCTCCCTTCCCCTGG + Intergenic
983915544 4:173287592-173287614 ACCCCCTTCCTCCCGTCCTTTGG + Intronic
984106227 4:175550154-175550176 GCCCCTTTCCTACCTTCTTTTGG + Intergenic
984882430 4:184422097-184422119 GCCCTTTGCCTCCCATCCTGAGG + Intronic
985802234 5:2012269-2012291 GGCTCCTTCCTCCCAGCCTTAGG - Intergenic
986241555 5:5964688-5964710 ACCCCTAACCTCCGAACCTTTGG + Intergenic
988559852 5:32271046-32271068 GCACCTTTCCTCTCATTCTTGGG - Intronic
991930699 5:71750452-71750474 GCCCCTTGCCCCCCAGCCTCAGG - Intergenic
995029465 5:107464147-107464169 GCCCCTAACCTCCTAACCTCTGG + Intronic
995348160 5:111144465-111144487 TCCCCTTTCCTCCCAGCCTCTGG + Intergenic
997480116 5:134178300-134178322 GCCCCTTTGCTCCCCGCCTATGG + Intronic
999326224 5:150645333-150645355 GCCCCTCTCCTCCCTACTGTGGG - Intronic
1000074339 5:157770882-157770904 ACTCCTTTCCTCCATACCTTTGG - Intergenic
1000444751 5:161305836-161305858 GCTCCTTTTCTCCTAACATTTGG - Intronic
1001994596 5:176146085-176146107 TTACCTTTCCTCCCAAACTTTGG + Intergenic
1002430286 5:179199367-179199389 GCCCCTTTCCTGCCAGCCGTGGG - Intronic
1003209069 6:4043365-4043387 ACCCCTTACCTCCAACCCTTGGG + Intronic
1003357780 6:5390704-5390726 GCCCCTTTCCTCTTAAACTAAGG - Intronic
1003889369 6:10550424-10550446 GTCCCTTGACTCCCAAACTTTGG + Intronic
1005593976 6:27360255-27360277 GCTTCTTTTCTCCCAACATTTGG - Intergenic
1006059312 6:31408570-31408592 TCCCCATTCCTCCCTACCTCTGG + Intronic
1006071795 6:31503451-31503473 TCCCCATTCCTCCCTACCTCTGG + Intronic
1006304975 6:33213389-33213411 GCCCCTGTCCCCCCAGCCTCAGG - Intergenic
1006871834 6:37258224-37258246 TCCCCTTTACGCCCAATCTTCGG - Intronic
1010159803 6:72840004-72840026 TTCCCTTCCCTCCCAACCTCTGG + Intronic
1012522252 6:100135820-100135842 TCCCCTTTCCTCCCAGCCCCTGG - Intergenic
1016788218 6:148036734-148036756 GCCCCTCTCCTGCCAGCCCTCGG - Intergenic
1017758367 6:157549010-157549032 ACCCCTTTCCTCCCAAGCACTGG - Intronic
1018365140 6:163112378-163112400 GACCCTTTCCTCCAAAACTTGGG + Intronic
1018670451 6:166172601-166172623 GCCCCTTTCATAGCCACCTTGGG + Intergenic
1019368359 7:647037-647059 GCCCCTTTCTTCCCCACCTCTGG - Intronic
1019449171 7:1087971-1087993 GCCCTTTTTCTCCCACACTTTGG - Intronic
1019503981 7:1381371-1381393 GCCTCTTCCCTCCCAGCCTGGGG + Intergenic
1019563021 7:1667299-1667321 GCGCCCTTCCTCCCAACCCACGG + Intergenic
1019588641 7:1817882-1817904 GCCCCTCCCCTCACCACCTTTGG + Intronic
1023214942 7:37851886-37851908 GCCCCTTTCAACCCAAACATTGG + Intronic
1024187266 7:46963112-46963134 CCCCCTTCCCTCCCTACTTTTGG - Intergenic
1024573671 7:50746876-50746898 GCCCATGTCCTCCCTCCCTTGGG + Intronic
1024612341 7:51078356-51078378 GACCCATTGCTCCCAGCCTTAGG + Intronic
1024743957 7:52386043-52386065 CCCCCTTCCCTCCCAGTCTTTGG - Intergenic
1026448090 7:70503046-70503068 GCTCCTTTCCTCCCCACCCTGGG - Intronic
1026454802 7:70561711-70561733 GCCCTTTTCCTTCCCTCCTTGGG - Intronic
1027372393 7:77519811-77519833 GCTCATTTCCTCCCCTCCTTCGG - Intergenic
1029572194 7:101377369-101377391 AGCCCTTTCCCCCCAACCTTAGG - Intronic
1032188858 7:129751112-129751134 GCCTCTCTCCTCCCCATCTTGGG - Intronic
1032403019 7:131637014-131637036 GCCTCTTTTCTCCCATCCTCAGG - Intergenic
1032668027 7:134056773-134056795 GCAACTTTGCTCCCCACCTTTGG - Intronic
1034162459 7:149003247-149003269 GCCCCTTTGCCCCCAGCCCTTGG + Exonic
1035721518 8:1796743-1796765 GCCCCTTTCCTCCAGATCTGGGG - Intergenic
1037179141 8:15983365-15983387 GCCTCATTGCTCCCAAGCTTAGG - Intergenic
1037981152 8:23255285-23255307 GCCCCTCTCCTCCCACCCCGTGG + Exonic
1038591960 8:28847328-28847350 CCCCCTTTCCTCCCAACCCTTGG - Intronic
1038630173 8:29234500-29234522 TCCCCATTCCTCCCACCCCTAGG - Intronic
1039228990 8:35422178-35422200 GCCCCTTTCCTGCAAACTTAGGG + Intronic
1045479598 8:102581521-102581543 GCCCTGTTCCTCCAAACCTCAGG - Intergenic
1045636720 8:104199797-104199819 GTTTCTTTCCTCCCAACCCTAGG - Intronic
1048663211 8:136631061-136631083 GACCCTTTAATCCTAACCTTTGG + Intergenic
1048722756 8:137345312-137345334 TGCCCTTCCCTCCCATCCTTAGG + Intergenic
1048753437 8:137705249-137705271 GCCCCTCTCCTCCACACCATGGG - Intergenic
1049040261 8:140107493-140107515 GCCCCTTTCATAGCATCCTTCGG - Intronic
1049245461 8:141560035-141560057 GCCCCTGACCTCCCAAGCCTGGG - Intergenic
1049748907 8:144274417-144274439 GCCTCTTTCCTGCCCACCTGTGG + Intronic
1050303784 9:4286042-4286064 GCCCTTTTCCTCCAAATCCTGGG - Exonic
1050325308 9:4491827-4491849 GCTTGTTTCCTCCCAACCTCAGG + Intronic
1051385483 9:16503481-16503503 TCCCCTTTCCTCACTGCCTTTGG - Intronic
1052041962 9:23748962-23748984 CCTCCTTTGCTCCCAGCCTTTGG - Intronic
1052057230 9:23919408-23919430 CCCCTTTTCCTCCCCACCTATGG - Intergenic
1052968164 9:34358152-34358174 TCCCCATTCCTCCCAGCCTCTGG + Intergenic
1053567592 9:39269421-39269443 TCCCCTCTCCTTCCATCCTTAGG - Intronic
1053590618 9:39510887-39510909 GCCTCTCTCCTCCCATCTTTGGG - Intergenic
1053797526 9:41740084-41740106 GCCCCTACCCTCCCACCCCTGGG - Intergenic
1053833604 9:42110370-42110392 TCCCCTCTCCTTCCATCCTTAGG - Intronic
1053848478 9:42266276-42266298 GCCTCTCTCCTCCCATCTTTGGG - Intergenic
1054129551 9:61349577-61349599 TCCCCTCTCCTTCCATCCTTAGG + Intergenic
1054185938 9:61952136-61952158 GCCCCTACCCTCCCACCCCTGGG - Intergenic
1054467410 9:65505906-65505928 GCCCCTAACCTCCCACCCCTGGG + Intergenic
1054575686 9:66854402-66854424 GCCTCTCTCCTCCCATCTTTGGG + Intergenic
1059247089 9:112857572-112857594 TCCCCTTTCCTCCACACTTTGGG + Intronic
1059312218 9:113396483-113396505 GCCCCTTTCTTCCCTTCCTAAGG - Intronic
1059565917 9:115382803-115382825 GCACCTTTTATCCCAAACTTTGG + Intronic
1060261015 9:122073533-122073555 GCTCCTTCCTTCCCCACCTTGGG - Intronic
1061162174 9:128901853-128901875 GCTCCTTTCCCCACACCCTTGGG + Intronic
1061751829 9:132783544-132783566 GCCCCTTTCCTTCCATTTTTTGG - Intronic
1062367938 9:136220642-136220664 GCCCCGCTCCTCCTCACCTTGGG - Intronic
1062538720 9:137032165-137032187 GCCCCTGCCCCCACAACCTTTGG + Exonic
1190597856 X:52065095-52065117 GGCACTTTCCTCCGAAGCTTTGG + Intronic
1190610968 X:52188978-52189000 GGCACTTTCCTCCGAAGCTTTGG - Intronic
1192248988 X:69395598-69395620 TCCCCTTTCCTTGCAACCTTGGG + Intergenic
1192264595 X:69530007-69530029 GCCCCCTCCCCCCCAACCTGGGG - Exonic
1197761297 X:130030301-130030323 GCCCCTGTCCTCCCACTCTAGGG - Intronic
1197772166 X:130096099-130096121 CCCCATTTTCTCCCAACCCTTGG - Intronic
1201337043 Y:12892580-12892602 ACCCCTTTCCACCCAGCCTCTGG - Intergenic