ID: 1181632222

View in Genome Browser
Species Human (GRCh38)
Location 22:24157219-24157241
Sequence CCCCTTTCCTCCCAACCTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181632214_1181632222 10 Left 1181632214 22:24157186-24157208 CCTAGGGGTGTTCAACCTGGCCT 0: 1
1: 0
2: 2
3: 5
4: 96
Right 1181632222 22:24157219-24157241 CCCCTTTCCTCCCAACCTTAGGG No data
1181632213_1181632222 11 Left 1181632213 22:24157185-24157207 CCCTAGGGGTGTTCAACCTGGCC 0: 1
1: 0
2: 0
3: 5
4: 66
Right 1181632222 22:24157219-24157241 CCCCTTTCCTCCCAACCTTAGGG No data
1181632218_1181632222 -5 Left 1181632218 22:24157201-24157223 CCTGGCCTGCTTCTGGGGCCCCT 0: 1
1: 2
2: 5
3: 60
4: 454
Right 1181632222 22:24157219-24157241 CCCCTTTCCTCCCAACCTTAGGG No data
1181632211_1181632222 16 Left 1181632211 22:24157180-24157202 CCTGTCCCTAGGGGTGTTCAACC 0: 1
1: 0
2: 0
3: 6
4: 70
Right 1181632222 22:24157219-24157241 CCCCTTTCCTCCCAACCTTAGGG No data
1181632219_1181632222 -10 Left 1181632219 22:24157206-24157228 CCTGCTTCTGGGGCCCCTTTCCT 0: 1
1: 1
2: 3
3: 40
4: 457
Right 1181632222 22:24157219-24157241 CCCCTTTCCTCCCAACCTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181632222 Original CRISPR CCCCTTTCCTCCCAACCTTA GGG Intronic
No off target data available for this crispr