ID: 1181632226

View in Genome Browser
Species Human (GRCh38)
Location 22:24157223-24157245
Sequence TTTCCTCCCAACCTTAGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181632218_1181632226 -1 Left 1181632218 22:24157201-24157223 CCTGGCCTGCTTCTGGGGCCCCT No data
Right 1181632226 22:24157223-24157245 TTTCCTCCCAACCTTAGGGGAGG No data
1181632219_1181632226 -6 Left 1181632219 22:24157206-24157228 CCTGCTTCTGGGGCCCCTTTCCT No data
Right 1181632226 22:24157223-24157245 TTTCCTCCCAACCTTAGGGGAGG No data
1181632211_1181632226 20 Left 1181632211 22:24157180-24157202 CCTGTCCCTAGGGGTGTTCAACC No data
Right 1181632226 22:24157223-24157245 TTTCCTCCCAACCTTAGGGGAGG No data
1181632213_1181632226 15 Left 1181632213 22:24157185-24157207 CCCTAGGGGTGTTCAACCTGGCC No data
Right 1181632226 22:24157223-24157245 TTTCCTCCCAACCTTAGGGGAGG No data
1181632214_1181632226 14 Left 1181632214 22:24157186-24157208 CCTAGGGGTGTTCAACCTGGCCT No data
Right 1181632226 22:24157223-24157245 TTTCCTCCCAACCTTAGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181632226 Original CRISPR TTTCCTCCCAACCTTAGGGG AGG Intronic