ID: 1181632226

View in Genome Browser
Species Human (GRCh38)
Location 22:24157223-24157245
Sequence TTTCCTCCCAACCTTAGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 99}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181632218_1181632226 -1 Left 1181632218 22:24157201-24157223 CCTGGCCTGCTTCTGGGGCCCCT 0: 1
1: 2
2: 5
3: 60
4: 454
Right 1181632226 22:24157223-24157245 TTTCCTCCCAACCTTAGGGGAGG 0: 1
1: 0
2: 0
3: 12
4: 99
1181632219_1181632226 -6 Left 1181632219 22:24157206-24157228 CCTGCTTCTGGGGCCCCTTTCCT 0: 1
1: 1
2: 3
3: 40
4: 457
Right 1181632226 22:24157223-24157245 TTTCCTCCCAACCTTAGGGGAGG 0: 1
1: 0
2: 0
3: 12
4: 99
1181632211_1181632226 20 Left 1181632211 22:24157180-24157202 CCTGTCCCTAGGGGTGTTCAACC 0: 1
1: 0
2: 0
3: 6
4: 70
Right 1181632226 22:24157223-24157245 TTTCCTCCCAACCTTAGGGGAGG 0: 1
1: 0
2: 0
3: 12
4: 99
1181632214_1181632226 14 Left 1181632214 22:24157186-24157208 CCTAGGGGTGTTCAACCTGGCCT 0: 1
1: 0
2: 2
3: 5
4: 96
Right 1181632226 22:24157223-24157245 TTTCCTCCCAACCTTAGGGGAGG 0: 1
1: 0
2: 0
3: 12
4: 99
1181632213_1181632226 15 Left 1181632213 22:24157185-24157207 CCCTAGGGGTGTTCAACCTGGCC 0: 1
1: 0
2: 0
3: 5
4: 66
Right 1181632226 22:24157223-24157245 TTTCCTCCCAACCTTAGGGGAGG 0: 1
1: 0
2: 0
3: 12
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181632226 Original CRISPR TTTCCTCCCAACCTTAGGGG AGG Intronic
902166680 1:14577799-14577821 TTTCCTGACAACCCTAGGAGAGG + Intergenic
903304993 1:22407021-22407043 ATTCCTCCCAGGCTTTGGGGTGG + Intergenic
904299081 1:29542573-29542595 CTTCCTCCCACCCTGAGGAGGGG + Intergenic
908249667 1:62255269-62255291 ATTCCTCCCCACCTAAGGAGAGG + Intronic
909710543 1:78644595-78644617 TTTTCTACCACCCTGAGGGGTGG + Exonic
912866630 1:113263426-113263448 ATTCCTCCCAAGTGTAGGGGAGG - Intergenic
916415686 1:164589950-164589972 TTTCATCCCAACATTTTGGGAGG + Intronic
916658293 1:166897550-166897572 GGACCTCCCAACCTTAGGGAGGG + Intergenic
916687597 1:167161394-167161416 TTTCCTCTCTACCTTTGTGGTGG + Intergenic
919861685 1:201742875-201742897 ATTCCTCCCAAGCTCAGGGCAGG - Intronic
919984982 1:202667183-202667205 TTTCCTCCCAGCCCTAGGAGTGG - Intronic
921146778 1:212365986-212366008 TTTCCTCCCAAACTCAGAGGAGG + Intronic
1063601902 10:7489758-7489780 CTTCCACCCAACCTTATAGGTGG + Intergenic
1063915469 10:10877757-10877779 TTTACTGCCATCCTTAGAGGAGG + Intergenic
1064225610 10:13481747-13481769 TTTCCTTCCAAAATTAGGGATGG - Intronic
1064864544 10:19864890-19864912 TACCCTCCCAAACTCAGGGGAGG - Intronic
1070972386 10:80578333-80578355 TTTCCTGAGAACCTAAGGGGAGG + Intronic
1079344589 11:19640978-19641000 TTTCCTCCTAACCTCTAGGGAGG + Intronic
1079782312 11:24623019-24623041 TTTCCTCCATACCATCGGGGCGG - Intronic
1081851079 11:46275709-46275731 TTTCCAGCCAACCTCAGGCGGGG + Intergenic
1083454502 11:62769681-62769703 TTTGCTCCCAATCTGAGTGGAGG - Intergenic
1084174433 11:67416012-67416034 ATCCCTCCCTACCTTCGGGGTGG + Intronic
1085175732 11:74486746-74486768 TTTCCTGCCAGCCTCAGTGGGGG + Intergenic
1090003899 11:122983894-122983916 TTTGCACCCAGCCTTGGGGGCGG + Intergenic
1090540969 11:127704043-127704065 TCTTCTTCCAATCTTAGGGGGGG + Intergenic
1090804912 11:130196826-130196848 TTTCCTCCCAAAGCTACGGGAGG - Intronic
1091273304 11:134332548-134332570 TTTCCTCCCAAGCCTCTGGGAGG + Intronic
1091651504 12:2313687-2313709 TTCCCTCCCTGCCTTAGGGAAGG + Intronic
1092263661 12:6965401-6965423 TCTCCTCCCAGCCTTGAGGGAGG + Exonic
1095177995 12:39115265-39115287 TTTCCTCTCAACCTCAGAGAAGG - Intergenic
1097237436 12:57549873-57549895 TTATCTCCGAACGTTAGGGGTGG + Intergenic
1097858119 12:64489101-64489123 TTTCCTCCCAGCCATTGGGCAGG + Intronic
1100456256 12:94754452-94754474 TTTCCTCCAAAACTTGGGGTAGG + Intergenic
1104208875 12:126667676-126667698 TTTTCCCCCAACCTCAGAGGTGG - Intergenic
1117521190 14:56552864-56552886 CTCCCTGCCATCCTTAGGGGAGG + Intronic
1121063068 14:90934766-90934788 TTACCCCCCAACCTTTGGAGGGG + Intronic
1124864146 15:33472635-33472657 TTTCCTCTCCACCTCAGGGAGGG + Intronic
1125599311 15:40906802-40906824 CCCCCTCCCAACCTTTGGGGTGG - Intergenic
1128480243 15:68031286-68031308 TTTTCTCCCAGCCCTAGGGGTGG - Intergenic
1131012487 15:89030533-89030555 TTTCCTCCCAAGCTCCTGGGTGG + Intergenic
1132933335 16:2469515-2469537 GTTCCTCCCACCCTTAGGGTGGG + Intergenic
1145113948 17:20190797-20190819 TTGCCTCCCTCCCTTGGGGGTGG + Intronic
1149046721 17:52255023-52255045 TGGCCTCCCCACCTTAAGGGAGG + Intergenic
1150229479 17:63542222-63542244 TTTCCTGCCAGCCAGAGGGGTGG - Exonic
1151564559 17:74890535-74890557 TTTCCTCCCCAGCTTCGAGGGGG + Intronic
1153018505 18:606106-606128 CTTCCTGCCACCCTTAGGGGAGG - Intronic
1155338168 18:24785964-24785986 TTCCTCCCCAACCTTAGGGTTGG - Intergenic
1157551611 18:48585674-48585696 TTTCATCCCATCCCTAGGAGGGG + Intronic
1161036743 19:2089276-2089298 TTACCTCCCACCCTCAGGCGAGG - Intronic
1161424511 19:4195492-4195514 TCTCCTTCCACCCTTGGGGGTGG - Intronic
1161509890 19:4664531-4664553 GTTCGTCTCACCCTTAGGGGAGG + Intronic
1165661777 19:37587045-37587067 TTTGCTCCCAATCTTAGGAAGGG + Intronic
925903777 2:8527090-8527112 TTTCCTCACTGCCTTGGGGGTGG - Intergenic
929479923 2:42295943-42295965 CTTCTTCCCAACCTTAGTGTAGG + Intronic
935940006 2:108228430-108228452 TGTTCTACCAACCTTAGGTGTGG - Intergenic
936945928 2:117930676-117930698 TTTCCTGCCAATCTTAGGGTGGG - Intronic
941693724 2:168528382-168528404 CTTCCTCCCAGCCCTAGGGCTGG + Intronic
943518853 2:188922296-188922318 ATTCCTGCCAACCTGTGGGGTGG - Intergenic
944310289 2:198225502-198225524 TTTGCCCCCAGCCTTAGTGGAGG - Intronic
946652647 2:221910303-221910325 TTTCCTCCCATACTCAAGGGAGG - Intergenic
1169342943 20:4810108-4810130 TTTCCTCCCAACTTGAGAGTGGG - Intronic
1169857049 20:10114176-10114198 TTTCTTCCCAGCCTCAGGGGTGG + Intergenic
1170759723 20:19239011-19239033 CTGCATCCCAACCTTAGGAGTGG - Intronic
1173021648 20:39272480-39272502 TTTCCTGACAACCTTGGGGCTGG - Intergenic
1173353011 20:42262226-42262248 TTTCCATCCATCCTTTGGGGAGG - Intronic
1180922032 22:19525931-19525953 TTTCCTTCCAGCCTCAGGGCTGG - Intronic
1181632226 22:24157223-24157245 TTTCCTCCCAACCTTAGGGGAGG + Intronic
1183043171 22:35198589-35198611 TTTCCTCCCAACCACAGAGATGG + Intergenic
1184483620 22:44762972-44762994 GTCCCTCACAACCTTTGGGGAGG + Intronic
949320755 3:2807876-2807898 TTTCCTCCCAAGCTTCTTGGAGG + Intronic
950266683 3:11578432-11578454 GTTCCTACCAACCTTAGGGCTGG - Intronic
951484100 3:23192987-23193009 TTTCCTACAAGCCTTAGGAGCGG + Intergenic
952624361 3:35386324-35386346 TTTCCTCCAAATCTCATGGGTGG - Intergenic
954538235 3:51377183-51377205 TTTCCTTCCACACCTAGGGGTGG - Intronic
955046597 3:55366886-55366908 TTCTCTCCCAACGTTAGGAGTGG + Intergenic
962565652 3:136656455-136656477 TTTTTTCCCAACATTAGCGGTGG + Intronic
962814171 3:138983606-138983628 TTCCCTCCCAAACTAAGAGGTGG - Intergenic
962867578 3:139460542-139460564 TTTCCTCCCCACCCCAGGAGAGG + Intronic
967868080 3:194206585-194206607 TTTCCTCACATCCGCAGGGGCGG - Intergenic
972353619 4:38260135-38260157 ACTCCTCCCAGCCCTAGGGGTGG + Intergenic
975405737 4:73987350-73987372 TTTCCTCCCATCCTTCAGTGTGG + Exonic
976020235 4:80614575-80614597 TTTGCTCCCAACCTTTTAGGAGG - Intronic
977659880 4:99572013-99572035 TTTCCTTCCAACCTTTAGTGGGG + Intronic
977785366 4:101027237-101027259 TATCCTCCCAACCTTATTTGGGG + Intronic
980049113 4:128021252-128021274 TTTCCACCCAACATTGGTGGTGG + Intronic
983357199 4:166678567-166678589 TATCCTCCTGACCTTAGGGTTGG + Intergenic
985757039 5:1725343-1725365 GTCCCTCCCAACTTTAGAGGTGG - Intergenic
985980969 5:3462894-3462916 TTTCCTTGGAGCCTTAGGGGAGG - Intergenic
990202356 5:53390590-53390612 TTTTTTTCCCACCTTAGGGGAGG - Intergenic
992212930 5:74497851-74497873 TCTCCTCCCTTTCTTAGGGGTGG - Intergenic
992627763 5:78649587-78649609 TTTGCTCCCAGCCCTGGGGGCGG - Intronic
998931599 5:147187469-147187491 TTACCTCCCACCCCCAGGGGAGG - Intergenic
999101766 5:149031268-149031290 TTCCCTCCTAATCTTGGGGGAGG - Intronic
1004752329 6:18575304-18575326 TTTTCTCCCATCCTTTGGGTTGG + Intergenic
1005838427 6:29724501-29724523 TTTCCTCCCAACCTTGTGCGAGG - Intronic
1006672774 6:35739893-35739915 TTTGCTCCCAACTTCTGGGGAGG - Intronic
1007762374 6:44140559-44140581 ATTCCCCACAACCTTGGGGGAGG - Intronic
1011002111 6:82602498-82602520 TATCTTCACAACCTTAGGGTAGG + Intergenic
1012440525 6:99257955-99257977 TCTTCTCCCAACCTTGGGGTAGG - Intergenic
1023938161 7:44754392-44754414 CTTCCTCACACCCTCAGGGGAGG - Intronic
1024964586 7:55012632-55012654 TTTTCTCCCAACATTTTGGGAGG + Intergenic
1027366178 7:77460824-77460846 TGTCATCCCAACATTTGGGGAGG + Intergenic
1036582291 8:10086585-10086607 TTTCCTCCAAAGCTTAGGTGAGG + Intronic
1041610560 8:59842499-59842521 TTTCCTCTCAACCTTGGGATAGG - Intergenic
1043114503 8:76233431-76233453 TTTCCTCACAACATTAGGTCTGG - Intergenic
1052904125 9:33818227-33818249 TTTCCACCCACCCTCAGCGGGGG - Intronic
1055577135 9:77671546-77671568 GGGCCTACCAACCTTAGGGGTGG - Intergenic
1058398475 9:104584864-104584886 TTTACTTACAACCTTAGGGACGG + Intergenic
1192600719 X:72461002-72461024 TTTTCTCCTAACCTCAGGTGAGG - Intronic
1194250507 X:91569199-91569221 TTTTCAACCAACCTTAGGGGTGG + Intergenic
1197887204 X:131230995-131231017 TTTCCTGGCAGCCTAAGGGGTGG + Intergenic
1200569458 Y:4810448-4810470 TTTTCAACCAACCTTAGGGGTGG + Intergenic