ID: 1181632229

View in Genome Browser
Species Human (GRCh38)
Location 22:24157229-24157251
Sequence CCCAACCTTAGGGGAGGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 122}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181632219_1181632229 0 Left 1181632219 22:24157206-24157228 CCTGCTTCTGGGGCCCCTTTCCT 0: 1
1: 1
2: 3
3: 40
4: 457
Right 1181632229 22:24157229-24157251 CCCAACCTTAGGGGAGGAACAGG 0: 1
1: 0
2: 1
3: 12
4: 122
1181632214_1181632229 20 Left 1181632214 22:24157186-24157208 CCTAGGGGTGTTCAACCTGGCCT 0: 1
1: 0
2: 2
3: 5
4: 96
Right 1181632229 22:24157229-24157251 CCCAACCTTAGGGGAGGAACAGG 0: 1
1: 0
2: 1
3: 12
4: 122
1181632213_1181632229 21 Left 1181632213 22:24157185-24157207 CCCTAGGGGTGTTCAACCTGGCC 0: 1
1: 0
2: 0
3: 5
4: 66
Right 1181632229 22:24157229-24157251 CCCAACCTTAGGGGAGGAACAGG 0: 1
1: 0
2: 1
3: 12
4: 122
1181632218_1181632229 5 Left 1181632218 22:24157201-24157223 CCTGGCCTGCTTCTGGGGCCCCT 0: 1
1: 2
2: 5
3: 60
4: 454
Right 1181632229 22:24157229-24157251 CCCAACCTTAGGGGAGGAACAGG 0: 1
1: 0
2: 1
3: 12
4: 122
1181632211_1181632229 26 Left 1181632211 22:24157180-24157202 CCTGTCCCTAGGGGTGTTCAACC 0: 1
1: 0
2: 0
3: 6
4: 70
Right 1181632229 22:24157229-24157251 CCCAACCTTAGGGGAGGAACAGG 0: 1
1: 0
2: 1
3: 12
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181632229 Original CRISPR CCCAACCTTAGGGGAGGAAC AGG Intronic
903102171 1:21040169-21040191 CCCAACCTCAGGGGAAGGAGAGG + Intronic
904985626 1:34546139-34546161 CCCAACCCTGGGGGAAGAAAGGG - Intergenic
905301701 1:36990185-36990207 CCCAAGCCTAAGGGAGGCACTGG - Intronic
908373822 1:63512613-63512635 CCCAACCTTAGGGAAGAATTTGG - Intronic
910830152 1:91452866-91452888 CCAAACATTAGGGGAAGAACTGG - Intergenic
916195607 1:162219447-162219469 CCCCACCTCAGTAGAGGAACAGG - Intronic
917716815 1:177746774-177746796 GCCAACCTTATGCAAGGAACTGG + Intergenic
919450425 1:197766183-197766205 CCCAACATTTTGGGAGGAAGAGG - Intronic
922617847 1:226973661-226973683 CCCAGCCTCAGGGGAGGACAGGG - Intronic
1063413933 10:5857940-5857962 CCCAACCTGTGGAGGGGAACAGG - Intergenic
1065021069 10:21501792-21501814 CCCAACCTGAAGAGAGGAATGGG + Intergenic
1068734624 10:60398888-60398910 CCCCACCCTAGGGGAGGAACTGG - Intronic
1071828998 10:89353443-89353465 CCCAACCCAAGGGAAGAAACAGG + Intronic
1075452382 10:122560402-122560424 CCCAAGGTTTGGGGAAGAACAGG - Intergenic
1075850388 10:125581652-125581674 CTCAACCTTAGGGGGGAAAAAGG - Intronic
1077077610 11:708571-708593 GCCAAGCCTAGGGGAGGGACTGG - Intronic
1083625550 11:64070279-64070301 CCCAGCCTTGGGGAAGGAATCGG + Intronic
1087242625 11:95797099-95797121 CCTGACCTTAGGGGAGGTAAGGG - Intronic
1087640276 11:100749084-100749106 CCCTTCCCTAGGGGAGGGACCGG + Intronic
1093708141 12:22297941-22297963 CCCAAACTGTGGGGAGGAAAGGG + Intronic
1096151070 12:49313104-49313126 CCCAACCTTAGGTGATCCACCGG - Intergenic
1096461975 12:51826778-51826800 CCCAACCTAAGGGCGGGAAGAGG + Intergenic
1096836283 12:54353350-54353372 CCCAGCCAAAGGGGAGGAAGGGG - Intergenic
1097194689 12:57236905-57236927 GGCAACCTTAGGGGAAGAATAGG + Intronic
1101131675 12:101697379-101697401 CCGACCCCTAGGAGAGGAACCGG + Intronic
1106114919 13:26809189-26809211 CCCAACCTCTGGGAAGGAAGAGG - Intergenic
1106885555 13:34181141-34181163 CCCAAATTTAGGGAAGGAAATGG - Intergenic
1107835104 13:44406548-44406570 ACCAACCGTAGAGGATGAACGGG + Intergenic
1108779270 13:53808591-53808613 CACAACCTCTGGGGCGGAACAGG + Intergenic
1118992628 14:70809669-70809691 CCCAACCACGGCGGAGGAACCGG - Intergenic
1119261531 14:73240794-73240816 CCCCACCTTTGGGGAGGAGGGGG + Intronic
1124416282 15:29475430-29475452 CCCAACCTCAGAGCAGGATCTGG + Intronic
1129465831 15:75723745-75723767 CCCAACCTTAGGGCACCCACTGG + Intergenic
1129674772 15:77626597-77626619 CCCAGACTTGGGGGAGGAACTGG + Intronic
1131575366 15:93584805-93584827 CCCCACCTTAGGGTAGGGAGAGG - Intergenic
1131949670 15:97667933-97667955 CCCAACATTTTGGGAGGAAAAGG + Intergenic
1132542224 16:515902-515924 CCCCACCCTAGAGGAGGAATCGG + Intronic
1133158295 16:3891236-3891258 CCCAGCCTTCGGGGATGAAATGG + Intergenic
1136139933 16:28281962-28281984 TCCACCCTCAGAGGAGGAACAGG - Intergenic
1137039687 16:35599348-35599370 TCCTTCCTTAGGGGAGGGACAGG + Intergenic
1143291160 17:5830192-5830214 TCCAACCTTTGGGCAGGAACTGG + Intronic
1143723400 17:8828979-8829001 CCCCACCCCAGGGAAGGAACTGG - Exonic
1145249483 17:21289453-21289475 GCCAAGCTGAGGGGAGCAACTGG + Intronic
1147945461 17:44077932-44077954 TCCAGCCTCAGGGGAGGATCTGG - Exonic
1152009333 17:77701359-77701381 GCCAACATTAGTGGAGAAACTGG + Intergenic
1156590965 18:38487737-38487759 CCCAAGCATAGGACAGGAACTGG + Intergenic
1158346688 18:56523424-56523446 CCTAAGTTTAGAGGAGGAACTGG - Intergenic
1158677498 18:59534515-59534537 CCCAAAAGTAGGGGAGGCACTGG - Intronic
1158704877 18:59783377-59783399 TCCACTCTTAGGGGAGGGACAGG + Intergenic
1164758692 19:30710508-30710530 CCCAGCCTGAGATGAGGAACGGG + Intronic
1167037657 19:47003607-47003629 CCTAGCGTTTGGGGAGGAACAGG + Exonic
1167250043 19:48394698-48394720 CGCAACCTTGGGGGAGAGACAGG + Intergenic
926056224 2:9775680-9775702 CCCTACCTCAGGTGAGGAAACGG - Intergenic
928836698 2:35555957-35555979 CCCAAAGTTGAGGGAGGAACTGG - Intergenic
932776832 2:74533252-74533274 CCTAAACTTAGGGGAGATACTGG + Exonic
932881505 2:75506465-75506487 CCCCTCCTTAGGGGTGGTACTGG + Intronic
933368510 2:81386429-81386451 CCCACCCTAAGGGAAGAAACAGG + Intergenic
935498450 2:103809511-103809533 CCCAACGTTGGGGGAGGGATCGG + Intergenic
935814681 2:106836675-106836697 CCCAACACTTTGGGAGGAACAGG + Intronic
937406643 2:121635949-121635971 CCCAACCCTTTGGGAGGCACAGG + Intronic
937873499 2:126803172-126803194 CCCATCCTTATGGGAGAAAACGG - Intergenic
940241080 2:151563790-151563812 CTCAAACTTAGGAGAGGAAAAGG + Intronic
943334684 2:186599618-186599640 CCCAACTTTGGGGGTGGAGCTGG - Intronic
945248912 2:207746727-207746749 CCCAACATTTTGGGAGGATCTGG + Intronic
947159625 2:227199299-227199321 CCCAATCCTGGGGGAGGAATGGG - Intronic
948371593 2:237493066-237493088 CCCAACCCTAGGTGAGGGAGAGG + Intronic
1169299589 20:4430649-4430671 CACAACCCTGGGGGAGGAGCAGG - Intergenic
1173401411 20:42729449-42729471 TCCAACAATAGGGGAAGAACAGG + Intronic
1173426838 20:42950555-42950577 CCCAACCTGAGAGGCAGAACTGG + Intronic
1173587881 20:44198016-44198038 CCCAAGCTTAGAGTTGGAACAGG - Intronic
1174019722 20:47520407-47520429 CCTTCCCCTAGGGGAGGAACCGG + Intronic
1175319689 20:58076522-58076544 CCCAGCTGTAGGGGAGGAAAGGG - Intergenic
1176174008 20:63709187-63709209 GCCAACCTTAGGGGCGTAAGGGG + Intronic
1177169196 21:17637375-17637397 CCCAGCCTTCAGGGAGGACCAGG - Intergenic
1178406041 21:32324034-32324056 CCCCATCTTAGAGGAGGAAACGG + Intronic
1180067452 21:45419663-45419685 ACCATGCTTAGGGGAGGACCTGG + Intronic
1181632229 22:24157229-24157251 CCCAACCTTAGGGGAGGAACAGG + Intronic
949427351 3:3932710-3932732 CCCTACGTAAGGGGAGGAAAAGG + Intronic
953136110 3:40183155-40183177 CCCAACCTGTGGACAGGAACTGG + Intronic
954396427 3:50295714-50295736 CCCATCCTTACAGGAGGAGCTGG + Intronic
956663213 3:71619244-71619266 CCCAACCTCAGGTGTGGAACTGG + Intergenic
957027016 3:75193444-75193466 CCCAACCTTCTGGGAAGAAAGGG - Intergenic
963343135 3:144061921-144061943 ACAAACCTCAGAGGAGGAACAGG - Intergenic
968285728 3:197507703-197507725 CACAACCCCAGGGGAGGAAAGGG - Intergenic
972942747 4:44217325-44217347 CCCAAAATTAAGGGTGGAACTGG + Intronic
975637210 4:76462535-76462557 CCCAATATTGGGGGAGGGACTGG + Intronic
980034553 4:127868777-127868799 CCCAACCTTCAGGGAGGAGTAGG + Intergenic
980439093 4:132817679-132817701 CCCTTCCCTAGAGGAGGAACTGG + Intergenic
981704921 4:147648844-147648866 CCCAACCTAAGGGTAGGGAGGGG - Intronic
985524763 5:396239-396261 CCCATCCTCAGGGGAGGCATGGG + Intronic
985901957 5:2803450-2803472 CCACACCTCAGGGGAGGAAACGG + Intergenic
987898458 5:23979711-23979733 CCCAACCTAAGGGAAGAATCAGG + Intronic
989144205 5:38232589-38232611 CCAAACCCTAGAGGAGGAAAGGG + Intergenic
991517861 5:67459275-67459297 CCCAAGCTTAGGGTTGGGACAGG - Intergenic
991622744 5:68562392-68562414 CCTAACCTCAGGGCAGGAAAGGG + Intergenic
992179418 5:74182166-74182188 CCCAACCCTAGGGCCAGAACCGG + Intergenic
997831046 5:137150366-137150388 CCAAAACTTAGGAGAGGAAGAGG - Intronic
1001070232 5:168579381-168579403 CCCGGCCTGAGGGGAGGAACCGG - Exonic
1001597739 5:172908842-172908864 CCCATCCGTAGGGGCAGAACCGG - Intronic
1005680550 6:28203349-28203371 CCCTACCTCAGGGGAGGGAGAGG - Intergenic
1006788946 6:36686320-36686342 CCCAACCTTAGAGGAGGTGAGGG - Exonic
1010186185 6:73146016-73146038 CCCAATGTTGGGGGAGGGACTGG - Intronic
1013306016 6:108847869-108847891 CCCATCCACAGGAGAGGAACTGG - Intergenic
1013412450 6:109893869-109893891 CCCAACCTGAGAAGAAGAACTGG - Intergenic
1014158393 6:118138011-118138033 TCCAACCTTAGGGGAGGGTCAGG + Intronic
1014647357 6:123990840-123990862 CCCAACCTTTGGTGACAAACTGG - Intronic
1014846609 6:126285310-126285332 CCCAAACTTGGGGGTGGAAATGG + Intergenic
1016951822 6:149587796-149587818 CCCAACCTTGGGGAAGGGAACGG - Intronic
1018620802 6:165727578-165727600 TTCAGCCTTAGGGAAGGAACTGG - Intronic
1019416857 7:931879-931901 CCCACCCCTAAGGGAGAAACGGG - Intronic
1020451286 7:8323262-8323284 CCCCACCTCAGTGGAGGAAAGGG + Intergenic
1021372696 7:19869627-19869649 CCCAAAGGTAGGGGATGAACTGG - Intergenic
1021688959 7:23213942-23213964 CCCAACCTAAGGGAAGGATCAGG - Intergenic
1022473510 7:30695575-30695597 CCCAACATAGGGGCAGGAACTGG + Intronic
1024272687 7:47654582-47654604 CCCAATCTGGGGGGAGGAACAGG + Intergenic
1026826034 7:73582165-73582187 CACAATCTTGGGGGAGGAAATGG + Intergenic
1029344944 7:99971630-99971652 CCCAATCCCAGGGGAAGAACAGG - Intronic
1029346636 7:99983498-99983520 CCCAATCCCAGGGGAGGAACAGG + Intergenic
1029558582 7:101287367-101287389 CCCAATCCCAGAGGAGGAACAGG - Intergenic
1030261717 7:107572128-107572150 CCGAACCTAATGGGAGAAACAGG - Intronic
1034987005 7:155522469-155522491 GCCAACCTCAGGGTAGGAACTGG - Intronic
1037763610 8:21758163-21758185 CCAAAGCTTAGGGGAGGAGCAGG + Intronic
1040673110 8:49716150-49716172 CCCACCCCAAGGGAAGGAACAGG + Intergenic
1041285579 8:56257951-56257973 CCTAAACTTAGGGTAGGAGCTGG - Intergenic
1042104187 8:65307219-65307241 CCCAATGTTGGGGGAGGGACTGG - Intergenic
1044847855 8:96399397-96399419 CCAAAACTTGGGGGAGGAAGTGG - Intergenic
1045533602 8:103006611-103006633 CCCAACCTATGGGGAGGCAGAGG - Intergenic
1049540857 8:143208165-143208187 CCCAGCCTTGGGGGTGGCACAGG - Intergenic
1060223311 9:121775599-121775621 CCCAACCATCAGGGAGGAGCAGG - Intronic
1060797654 9:126523289-126523311 CCCAACCGTGGGAGGGGAACAGG + Intergenic
1061273979 9:129558896-129558918 CCCACCCTCCGGGGAGGAACTGG + Intergenic
1061859799 9:133462118-133462140 GCCAGCCTTGGGGGAGGACCAGG - Intronic
1062241787 9:135544893-135544915 CCCATCCTTAGGGCGGGGACTGG - Intergenic
1193437369 X:81492322-81492344 ACCAACCTAAGGGGTGGCACAGG + Intergenic
1194474731 X:94344750-94344772 GCCAACCTTGGGGAAGAAACTGG + Intergenic
1199637845 X:149830206-149830228 CCTTCCCTTAGGGGAGGGACCGG - Intergenic