ID: 1181632232

View in Genome Browser
Species Human (GRCh38)
Location 22:24157236-24157258
Sequence TTAGGGGAGGAACAGGACTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 355
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 319}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181632225_1181632232 -8 Left 1181632225 22:24157221-24157243 CCTTTCCTCCCAACCTTAGGGGA 0: 1
1: 0
2: 0
3: 18
4: 178
Right 1181632232 22:24157236-24157258 TTAGGGGAGGAACAGGACTGCGG 0: 1
1: 0
2: 2
3: 33
4: 319
1181632221_1181632232 -6 Left 1181632221 22:24157219-24157241 CCCCTTTCCTCCCAACCTTAGGG 0: 1
1: 0
2: 0
3: 26
4: 257
Right 1181632232 22:24157236-24157258 TTAGGGGAGGAACAGGACTGCGG 0: 1
1: 0
2: 2
3: 33
4: 319
1181632219_1181632232 7 Left 1181632219 22:24157206-24157228 CCTGCTTCTGGGGCCCCTTTCCT 0: 1
1: 1
2: 3
3: 40
4: 457
Right 1181632232 22:24157236-24157258 TTAGGGGAGGAACAGGACTGCGG 0: 1
1: 0
2: 2
3: 33
4: 319
1181632213_1181632232 28 Left 1181632213 22:24157185-24157207 CCCTAGGGGTGTTCAACCTGGCC 0: 1
1: 0
2: 0
3: 5
4: 66
Right 1181632232 22:24157236-24157258 TTAGGGGAGGAACAGGACTGCGG 0: 1
1: 0
2: 2
3: 33
4: 319
1181632214_1181632232 27 Left 1181632214 22:24157186-24157208 CCTAGGGGTGTTCAACCTGGCCT 0: 1
1: 0
2: 2
3: 5
4: 96
Right 1181632232 22:24157236-24157258 TTAGGGGAGGAACAGGACTGCGG 0: 1
1: 0
2: 2
3: 33
4: 319
1181632223_1181632232 -7 Left 1181632223 22:24157220-24157242 CCCTTTCCTCCCAACCTTAGGGG No data
Right 1181632232 22:24157236-24157258 TTAGGGGAGGAACAGGACTGCGG 0: 1
1: 0
2: 2
3: 33
4: 319
1181632218_1181632232 12 Left 1181632218 22:24157201-24157223 CCTGGCCTGCTTCTGGGGCCCCT 0: 1
1: 2
2: 5
3: 60
4: 454
Right 1181632232 22:24157236-24157258 TTAGGGGAGGAACAGGACTGCGG 0: 1
1: 0
2: 2
3: 33
4: 319

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181632232 Original CRISPR TTAGGGGAGGAACAGGACTG CGG Intronic
900890696 1:5447746-5447768 TCAGGGAAGGGACAGGACAGGGG + Intergenic
900957982 1:5899488-5899510 TTGGGGGAGGTGAAGGACTGCGG + Intronic
901880552 1:12191426-12191448 TTCGGGGAGGAGCGGCACTGCGG + Intronic
901880574 1:12191498-12191520 TTCGGGGAGGAGCGGGACTGCGG + Intronic
902082161 1:13828666-13828688 TCAGTGGAGAAACAGGACAGCGG + Intergenic
903085218 1:20851285-20851307 TGTGGAGAGGAACAGCACTGAGG - Exonic
903612063 1:24622465-24622487 TTAGAGGAGGAGCAAGACTGTGG - Intergenic
903867374 1:26409621-26409643 CTGGTGGAGGAACAGGACTGGGG - Intergenic
904304003 1:29575320-29575342 TCAGGGGAAGAGCAGGAGTGGGG - Intergenic
904873146 1:33634419-33634441 CCAGGGGAGGAGCAGGACGGAGG - Intronic
905121388 1:35684675-35684697 TGAGAGGAGGAACAGGAAGGTGG - Intergenic
905477634 1:38240041-38240063 TGATGGGAGTAACAGGGCTGGGG - Intergenic
905624142 1:39475867-39475889 CTAAGGGGAGAACAGGACTGTGG + Intronic
905671211 1:39791459-39791481 CTAAGGGGAGAACAGGACTGTGG - Intergenic
906057134 1:42926184-42926206 TTAGGTAAGTAACAGGAGTGAGG + Exonic
906300203 1:44675975-44675997 TTAGTGCAGGAACTGGATTGAGG + Intronic
906380960 1:45331949-45331971 TTAGAGGAAGAACTGGAATGGGG + Intronic
906656439 1:47551862-47551884 TTAGGGGAGGGCCAGGCCAGTGG - Intergenic
906907465 1:49911574-49911596 TTATGGGAGCCACAGGATTGAGG + Intronic
907110843 1:51924909-51924931 TTAGGAGAAGAAAAGGACTGGGG - Intronic
907279926 1:53340638-53340660 GTAGGGGAGGAATAGCTCTGTGG + Intergenic
907516403 1:54995991-54996013 TTATGGGAGGGGCAGGCCTGGGG + Intergenic
911212001 1:95151115-95151137 TTAGAGGAGCCACAGGAGTGTGG + Intronic
912683543 1:111744054-111744076 GTAGGGGAGGAACTGGACTGAGG + Intronic
912723748 1:112041482-112041504 TTAGGGGAAGATCAGCACTGAGG + Intergenic
912903384 1:113676985-113677007 TTACTGGGTGAACAGGACTGGGG + Intronic
914879559 1:151537050-151537072 TTTGGGGAGGTACAGGATGGTGG - Intronic
915518648 1:156428761-156428783 TTAGGGGAGGACAAAGTCTGAGG - Intronic
916069824 1:161163432-161163454 TTAGGGAAGGAGCAGGGGTGTGG + Intronic
917517916 1:175723232-175723254 TTTTGGGAGGAACATGACAGAGG + Intronic
918396499 1:184118498-184118520 TGAGGGGTGGAACAGGAGTCAGG + Intergenic
918720530 1:187846856-187846878 TTAGGGGAGAAAAATGAATGTGG - Intergenic
920167560 1:204046332-204046354 TTAGGGGAGGGAGAGAACTTGGG + Intergenic
921164500 1:212496784-212496806 TTAGGGGAAGAGCAGGATTTTGG - Intergenic
921512640 1:216050970-216050992 TTGAGGGAGGATAAGGACTGAGG - Intronic
921639064 1:217529690-217529712 TTGGTGGAGGAACAGGAATCTGG - Intronic
921773061 1:219066293-219066315 TCAGAGGAGGAACAGAAATGTGG + Intergenic
923355365 1:233149850-233149872 TAAGTGGAGGAAGAGGATTGAGG - Intronic
923438881 1:233996523-233996545 TCAGGGGAGGATGAGGACTTGGG + Intronic
923796869 1:237165215-237165237 ATAGGGCAGGAACAAGAGTGAGG + Intronic
924239980 1:242031314-242031336 TTGGGGGAGGAGGAGGAATGAGG + Intergenic
924363791 1:243268127-243268149 TTACGGAAGAAACAGGAGTGTGG - Intronic
924449402 1:244164009-244164031 TGGGGAGAGGAACAGGTCTGGGG - Intergenic
924648589 1:245902774-245902796 TTTGGGTAGGAACAGTACTGTGG - Intronic
1067508886 10:46878532-46878554 TGAGGGGAGGAAGATGAGTGTGG + Intergenic
1067653363 10:48173318-48173340 TGAGGGGAGGAAGATGAGTGTGG - Intronic
1067672421 10:48334976-48334998 TTAAGTGAGGAAGGGGACTGGGG - Intronic
1069756568 10:70777377-70777399 AGAGGGGAGGAAGAGGGCTGAGG + Intronic
1069874211 10:71551817-71551839 TTGTGGGAGGAACAGGGCAGAGG - Intronic
1072411945 10:95210914-95210936 TGAGAGAAGGAACAGGGCTGAGG + Intronic
1072640498 10:97207565-97207587 GTAGGGGGGGCACAGGTCTGAGG - Intronic
1073261420 10:102193381-102193403 TTAAGTGAGGAAGGGGACTGGGG - Intergenic
1075093712 10:119457625-119457647 TCAGGGAAGGGACAGGACTGGGG - Intronic
1076361679 10:129894078-129894100 TAAGAACAGGAACAGGACTGGGG - Intronic
1077053624 11:579222-579244 TGGGGGGAGGAGCAGGGCTGGGG - Intronic
1077053632 11:579240-579262 TGGGGGGAGGAGCAGGGCTGGGG - Intronic
1077631918 11:3816787-3816809 TTGGGTAAGGAACAGGAATGTGG + Intronic
1078537559 11:12187143-12187165 TGAGGGCAGGAAGAGGACAGAGG - Intronic
1079198487 11:18353531-18353553 TTGGGGGAGAAACAGGGCTAAGG - Intronic
1080307637 11:30853921-30853943 TCAGGAGAGAAACAGGACTGAGG + Intronic
1083000408 11:59285977-59285999 TTTGTGGAGGAACATGACAGTGG + Intergenic
1083478144 11:62926912-62926934 TCAGGAGAGGAACCGGGCTGAGG - Intergenic
1085313809 11:75531420-75531442 TGAGGGGAAGAAGAGGACAGAGG + Intergenic
1088051463 11:105520164-105520186 CTATGGGAGGAATAGGATTGTGG + Intergenic
1088271269 11:108036945-108036967 CTAGGGGAGAAACAGGAGTGGGG - Intronic
1089184655 11:116606576-116606598 TTGGGAGAGGAACAGGATGGAGG - Intergenic
1089677895 11:120102441-120102463 TTATGGCAGGAACAGGACCTAGG + Intergenic
1089849236 11:121482152-121482174 TTAGTGCAGGCAGAGGACTGGGG + Intronic
1090049439 11:123364468-123364490 TTAGAGGAGGAAAAGGATAGCGG - Intergenic
1091359434 11:134963966-134963988 TTAGGGGATGACAAGGGCTGAGG - Intergenic
1091481595 12:837883-837905 TTAGGGGTTGCACAGGAGTGGGG - Intronic
1091544726 12:1493984-1494006 TTCTGGGAGGAACAGGACTCTGG - Exonic
1092037238 12:5347211-5347233 TTAGGGGAAGAAAATCACTGTGG + Intergenic
1092204016 12:6604743-6604765 TTAGGAAAGGGACAGGAATGGGG + Intronic
1096257285 12:50071169-50071191 CCAGGGAAGGCACAGGACTGTGG + Intronic
1096975614 12:55697861-55697883 TCAGGGGAGGCAGAGGCCTGCGG - Intronic
1100083877 12:90883526-90883548 TTAGGGGAGGAATACGGCAGAGG - Intergenic
1100606102 12:96153297-96153319 TTAGGGGAGGGACAGTTCTCTGG - Intergenic
1100642363 12:96494209-96494231 TTAGGGGAATAATAGGACTTTGG + Intronic
1100752247 12:97711471-97711493 TTAGGGGAGGAAAACTACAGAGG - Intergenic
1100855226 12:98751952-98751974 TTAGGGAAACAACAGGACAGGGG - Intronic
1100888880 12:99101982-99102004 TTTGGGGATGATCAGGGCTGAGG + Intronic
1101835029 12:108289093-108289115 ATAGGGGAGGGACAGGAGAGGGG - Exonic
1103011740 12:117463304-117463326 TCAGGGGAGGAACAGGAAGTTGG - Exonic
1103917869 12:124385276-124385298 GTTGGGGAGGGACAGGTCTGGGG - Intronic
1104256974 12:127147343-127147365 TTAGGGGAGGAAGACACCTGGGG + Intergenic
1105622495 13:22082340-22082362 GTAGGGGAAGAACAGGAATGAGG - Intergenic
1105680171 13:22718001-22718023 CCAGAGGAGGAACAGGACTGTGG - Intergenic
1106499975 13:30318543-30318565 TTAGTGGAGGAACAGTGATGGGG - Intergenic
1106930143 13:34654413-34654435 CTAGGGGAGTAACTTGACTGTGG - Intergenic
1107980033 13:45726141-45726163 TTAGGGTTGGAATAAGACTGTGG - Intergenic
1108935976 13:55880013-55880035 TTAAGGGAGGAAGGGAACTGGGG - Intergenic
1112029543 13:95444456-95444478 CTCAGGGAGGAACAGGACAGGGG + Intronic
1112211789 13:97385061-97385083 TCATGGGAGAAACAGGAATGGGG - Intronic
1112554776 13:100456781-100456803 TTACGGGAGGAACATGAAAGTGG + Intronic
1113042963 13:106124432-106124454 ATAGGTGAAGAAGAGGACTGAGG - Intergenic
1113443177 13:110345718-110345740 TTAGGGGTGGAGAAGGACAGGGG + Intronic
1116842030 14:49828114-49828136 ATAGGGGAGGAGCAGTCCTGGGG + Intronic
1119388916 14:74276892-74276914 TAAGAGGATGAAGAGGACTGGGG + Intergenic
1119612085 14:76072026-76072048 TGAGAGGAGCAACAGAACTGAGG - Intronic
1120306517 14:82778050-82778072 ATAAGGGAGGAACAGGATTATGG - Intergenic
1121482129 14:94287294-94287316 AAGGGGGAGGAACAGGTCTGGGG - Intronic
1121947474 14:98136915-98136937 TTGGGGGAGTAACAGAGCTGTGG + Intergenic
1122976850 14:105174327-105174349 TCTGGGGAGAAACGGGACTGAGG + Intronic
1123134933 14:106018808-106018830 TGAGAGGAGAAACAGGATTGTGG - Intergenic
1123145456 14:106125524-106125546 GGAGGGGAGAAACAGGACTGGGG - Intergenic
1123585482 15:21756683-21756705 TGAGAGGAGAAACAGGATTGTGG - Intergenic
1123622123 15:22199271-22199293 TGAGAGGAGAAACAGGATTGTGG - Intergenic
1123814358 15:23961773-23961795 TTAGGGGAGGAAGATCACAGAGG + Intergenic
1123829422 15:24119169-24119191 TTAGGAGAGGAAGATGACAGAGG + Intergenic
1123844342 15:24282632-24282654 TTAGGAGAGGAAGATGACAGAGG + Intergenic
1123859430 15:24448900-24448922 TTAGGAGAGGAAGATGACAGAGG + Intergenic
1123863774 15:24496268-24496290 TTAGGGGAGGAAGATGACAGAGG + Intergenic
1124254339 15:28128893-28128915 TTCGTGGAGGAACAGGGCTGGGG - Intronic
1124478915 15:30060655-30060677 TCATGGGAAGAACAGGAATGTGG - Intergenic
1125093527 15:35824730-35824752 TTTGGGGAGGAAGAGCACAGAGG - Intergenic
1125550609 15:40541730-40541752 TTAGGGGGTGAGCAGGAGTGAGG - Intronic
1127006457 15:54576108-54576130 TTGAGGGAGGAACAGCACAGAGG - Intronic
1127979091 15:64021207-64021229 TTTCGGGAGGAACAGGACAGCGG + Intronic
1128662680 15:69513707-69513729 AATGGGGAGGAACAAGACTGTGG + Intergenic
1130900389 15:88202610-88202632 CTAGGACAGGAACAGGTCTGGGG - Intronic
1131084871 15:89567573-89567595 GTTGGGGAGAAAGAGGACTGTGG - Intergenic
1131611624 15:93970325-93970347 TTTCGGGAGGAGCAGGACAGGGG + Intergenic
1133499117 16:6348657-6348679 TCAGAGCAGGAGCAGGACTGAGG + Intronic
1135191758 16:20360215-20360237 CTAGGGGAGAAAGGGGACTGTGG + Intronic
1135623300 16:23974495-23974517 AGAGGGCAGGATCAGGACTGAGG + Intronic
1136693653 16:32056259-32056281 GGAGGGGAGAAACAGGACTGGGG + Intergenic
1136794143 16:32999494-32999516 GGAGGGGAGAAACAGGACTGGGG + Intergenic
1137480385 16:48847694-48847716 GAAGGGGAGGAGCATGACTGAGG - Intergenic
1137720892 16:50626718-50626740 ACAGGGGAGGAAAAGGAATGAGG - Intronic
1137864439 16:51878743-51878765 TTAGGGGATGACCAGCAATGGGG - Intergenic
1138290953 16:55846498-55846520 TTAAGGAAGAAAGAGGACTGTGG + Exonic
1138376588 16:56568493-56568515 TTGGAGCAGGAAGAGGACTGAGG + Intronic
1139630847 16:68231139-68231161 CTAGGGGAGGAGGAGGCCTGTGG - Intronic
1141054064 16:80800434-80800456 TTATGGGAAAAACAGGATTGAGG - Intronic
1141361219 16:83396785-83396807 TTAGGGGAGGAGCAGGAGTAGGG + Intronic
1203096407 16_KI270728v1_random:1261175-1261197 GGAGGGGAGAAACAGGACTGGGG + Intergenic
1143136912 17:4717277-4717299 GTACGGGAGGAACAGCTCTGAGG + Intronic
1143245867 17:5485708-5485730 TTAGTGAAGAAACAGGAATGGGG - Intronic
1143487210 17:7261595-7261617 TTGGGGGAGGAAGAGGAACGTGG + Intronic
1143915157 17:10286245-10286267 TCAGGGGAGGAAGAAGACAGGGG + Intergenic
1144874210 17:18388698-18388720 TGAGGGGAGGGAGAGGTCTGTGG + Intronic
1145158014 17:20555720-20555742 TGAGGGGAGGGAGAGGTCTGTGG - Intergenic
1145977984 17:28995361-28995383 TTAGGTGAGGAATAGGAGTCAGG + Intronic
1146156811 17:30531132-30531154 TGAGGGCAGGAACAGTATTGGGG - Intergenic
1147336241 17:39728234-39728256 TTGGAAGAGGAACAGCACTGGGG + Exonic
1148398595 17:47332547-47332569 TTGGGGGAGGAAGAGGGATGGGG - Intronic
1148790754 17:50171373-50171395 TTGGGAGAGGAAGAGGGCTGGGG - Intronic
1149582026 17:57757283-57757305 ATAGGTGAGGAACAGGACAATGG - Intergenic
1149659541 17:58327109-58327131 AGAGGGAAGGAACAGGACTTTGG - Intronic
1151250827 17:72833512-72833534 TTGGGGGATGAACAGGACAATGG + Intronic
1151395146 17:73818381-73818403 TTAGGGGAGGTGCATGGCTGTGG - Intergenic
1151782163 17:76254280-76254302 TCAGAGGAGGATCAGGACTTGGG + Intergenic
1154077190 18:11214882-11214904 TCAGGGGAAGAACGGGACTGGGG + Intergenic
1155100949 18:22609247-22609269 CTAGGGGAGGAGCAGGGCTGGGG + Intergenic
1155273418 18:24163435-24163457 TTAGGTAGGGAACAGGTCTGTGG + Intronic
1155405296 18:25481177-25481199 CTGTGGGAGGACCAGGACTGTGG - Intergenic
1156401250 18:36742304-36742326 TGAGGGGAGGAGGAGGCCTGGGG + Intronic
1158724212 18:59954032-59954054 TTAGGGGAAAAACAGAACTAGGG - Intergenic
1158876985 18:61743255-61743277 TCAGGGGTGGGAGAGGACTGAGG - Intergenic
1160467695 18:79095399-79095421 TTAGGGGGAAAACAGGACTGGGG - Intronic
1160820888 19:1057237-1057259 TCAGGGTGGGAACAGGGCTGAGG + Intronic
1161058156 19:2200831-2200853 TGAGGGGAGGACGAGGAATGCGG - Intronic
1161058188 19:2200957-2200979 TGAGGGGAGGACGAGGAATGCGG - Intronic
1161058235 19:2201137-2201159 TGAGGGGAGGACGAGGAATGCGG - Intronic
1161058245 19:2201173-2201195 TGAGGGGAGGACGAGGAATGCGG - Intronic
1161454548 19:4363511-4363533 TCAGGGAAGGCACAGGACAGTGG - Intronic
1161860240 19:6792480-6792502 CTAGGGGAGGAACAGGTCTTGGG + Intronic
1163820047 19:19491355-19491377 AAAGGGGAGGAACAGGCCTTAGG + Intronic
1164541211 19:29122799-29122821 GTTGGGGAGGAACAGAGCTGAGG + Intergenic
1165232130 19:34393848-34393870 GGAGGGGAGGGACAGGACAGTGG - Intronic
1165393968 19:35553911-35553933 TGTGAGCAGGAACAGGACTGAGG + Intronic
1165425167 19:35741368-35741390 CTAGGGGACTAACAGGGCTGCGG + Intronic
1165829433 19:38723236-38723258 TCTGGGGAGGAACAGGACATGGG - Intronic
1165829652 19:38724134-38724156 CTAGGGGAGGAGCTGGAGTGAGG - Intronic
1166053434 19:40274716-40274738 GCAGGGGAGGAGCAGGGCTGAGG + Intronic
1166142045 19:40810497-40810519 TGGGGGTAGGAACAGGACGGTGG + Intronic
1166185475 19:41136297-41136319 TGGGGGTAGGAACAGGACGGTGG - Intergenic
1167115626 19:47487710-47487732 TTAGGGAAGGAGCAGGTGTGGGG + Exonic
1167725859 19:51212128-51212150 AGAGAGGAGGACCAGGACTGGGG + Intergenic
1168350712 19:55674248-55674270 TTAGGGCAGGGAGGGGACTGGGG + Exonic
1168719821 19:58548809-58548831 TTGGGGTAGAAACAGCACTGGGG - Intronic
925118205 2:1398143-1398165 TCCGGTGAGGGACAGGACTGTGG + Intronic
926247570 2:11132408-11132430 TTAGAGCAGAAACAGGGCTGAGG + Intergenic
926474184 2:13302065-13302087 TCAGAGCAGGAACAGGGCTGTGG + Intergenic
926766372 2:16325902-16325924 TTCAGGGAGGAGCAGCACTGAGG - Intergenic
927204272 2:20597163-20597185 TAAGGGGATGGCCAGGACTGTGG - Intronic
927678399 2:25123676-25123698 TTAGGGGAGGTATAGGACCATGG + Intronic
928417434 2:31107841-31107863 TTAAAGGAGAAACAGGACCGAGG - Intronic
931593535 2:63913907-63913929 TTAGGTGCTGAACATGACTGAGG - Intronic
934136333 2:88999690-88999712 GTATGGGAGGAACATGAATGTGG + Intergenic
936010535 2:108922518-108922540 GAAGGGGAGGAGCAGGAATGGGG - Intronic
936853342 2:116928528-116928550 TTAGGGGAGGAAGACCACAGAGG - Intergenic
936937425 2:117851754-117851776 TTAGGTGAGGAGAAGGACTAAGG + Intergenic
937048554 2:118868436-118868458 TTTGGGGAGGAAGACCACTGAGG - Intergenic
937803513 2:126108937-126108959 TAAGGGGAGAAATATGACTGAGG + Intergenic
938386464 2:130870476-130870498 AAAGGGAAGGAACAGGGCTGAGG - Intronic
939181479 2:138808015-138808037 TAAAGGGAGAAACAGGATTGTGG - Intergenic
939475045 2:142676076-142676098 TTTGGGGAGGAACATCACAGAGG + Intergenic
941684062 2:168429735-168429757 AAAGGGCAGGAACAGCACTGGGG - Intergenic
942298268 2:174537796-174537818 GGAGGTGAGGAGCAGGACTGGGG + Intergenic
944194785 2:197041072-197041094 TTAGTTGTGGAACAGTACTGAGG - Intronic
947103174 2:226643362-226643384 TAAGGGAAGGAACTGGCCTGAGG + Intergenic
948594981 2:239073998-239074020 TGAGGGGGGCAGCAGGACTGAGG + Intronic
948594985 2:239074016-239074038 TGAGGGGAGCAGCAGGACTGAGG + Intronic
1170698114 20:18678722-18678744 CGAGGGGAGGAAGAGGAATGGGG - Intronic
1171966256 20:31533144-31533166 GGAGGGGAGGAAAAGGGCTGAGG - Intronic
1172034766 20:32003013-32003035 GGAGGGGAGGATCAGGGCTGGGG - Exonic
1172641431 20:36442681-36442703 TTATGGAAGGACCAGGGCTGGGG - Intronic
1172773488 20:37394687-37394709 TCAGGGGAGGGACAGGAGAGGGG - Intronic
1173770060 20:45648484-45648506 GTAGGAGAGGAACAATACTGGGG + Intergenic
1173873494 20:46356088-46356110 TTAGGTAAAGAACAGGACTCAGG - Intronic
1175400675 20:58698363-58698385 TCAGGGGAGAAACAGGACACAGG + Intronic
1175481210 20:59312498-59312520 TTAGGGGAGGAATAGGTCTATGG + Intronic
1175541538 20:59751070-59751092 TCAGGGGAGGATCAGGCTTGAGG + Intronic
1176230767 20:64031798-64031820 TGAGGGGAGCACCAGGGCTGCGG + Intronic
1178972695 21:37195046-37195068 CTAGGGGAAGAGCAGGACTGGGG + Intronic
1179116016 21:38493601-38493623 TTAGGGCAGGAACAGCACCCTGG - Intronic
1181632232 22:24157236-24157258 TTAGGGGAGGAACAGGACTGCGG + Intronic
1183560883 22:38571351-38571373 TTGGGGGAGGAACTGGATAGTGG + Intergenic
1184249246 22:43250896-43250918 TTAGGAGCAGAACAGGCCTGAGG - Intronic
1185354265 22:50357315-50357337 TGAGGGGAGGAAGAGGAAGGGGG + Intronic
950025602 3:9817892-9817914 TTAGGGAAGGATAAGGATTGAGG - Intronic
950878511 3:16301330-16301352 TTAGGCGATGAACTGGATTGAGG - Intronic
952209132 3:31211737-31211759 ACAGGTGAGAAACAGGACTGTGG + Intergenic
952652253 3:35740076-35740098 TTAGGGAGAGAAAAGGACTGTGG - Intronic
952715372 3:36474567-36474589 TGAGGACAGGAACAGGACTAGGG - Intronic
952769796 3:36988376-36988398 TGAGAGGAGGAGCAGGATTGGGG + Exonic
953263108 3:41359168-41359190 GTGAGGGAGGAACAGGCCTGGGG + Intronic
954630834 3:52046915-52046937 TCAAGAGAGCAACAGGACTGGGG + Intergenic
954986616 3:54799905-54799927 TTAGGGGAGGAAAGGGACAGAGG - Intronic
955052170 3:55423534-55423556 TTAAGCGGGGAACAGGGCTGGGG - Intergenic
955390619 3:58519886-58519908 TTAGGACAGGAAAAGGAGTGCGG - Intronic
956567597 3:70656346-70656368 CTAGGGGAGGAAAAGGAATTAGG + Intergenic
956624255 3:71251327-71251349 TCAGGGGAGGGACAGGATGGAGG - Intronic
956925155 3:73979050-73979072 TTAGGGTGAGAACAGGTCTGTGG - Intergenic
958485409 3:94700265-94700287 TTTGGGGAGGAAGAGTACAGAGG - Intergenic
961118291 3:124350505-124350527 TTAGGATAAGAACATGACTGTGG - Intronic
961150188 3:124631421-124631443 ATATAGGAGGAACAGGACTCAGG - Intronic
961329976 3:126132601-126132623 TAAGAGGAGAAACAGGAGTGTGG - Intronic
963668578 3:148222458-148222480 GAAGTGGAGGAACAGGGCTGGGG + Intergenic
964619201 3:158703979-158704001 TTATAGGAGGAACAGAATTGAGG - Intronic
965733763 3:171799781-171799803 TTTGGGGAGGGAGAGGACAGAGG - Intronic
966409205 3:179631242-179631264 TTAGGGGAGGAAGTGAAGTGGGG + Intergenic
967013070 3:185457133-185457155 TCAGGTGAGGAACCCGACTGTGG - Intronic
967699018 3:192569899-192569921 ATTGGGGAAGAACAGGACTAAGG + Intronic
968382594 4:108739-108761 TTTGGGGAGGAGCAGGTCTCCGG - Intergenic
968403331 4:317151-317173 TTTTGGGAGGAGCAGGTCTGGGG + Intergenic
968471505 4:784665-784687 TGAGGAGAGGGACAGGCCTGTGG + Intergenic
971609999 4:28711678-28711700 TTAAGAGAGCGACAGGACTGTGG + Intergenic
976221676 4:82761347-82761369 TTAGTGGAGGAAGAGGACCCAGG - Intronic
979099783 4:116599672-116599694 AGAGTGGAGGAACGGGACTGTGG - Intergenic
979926903 4:126579349-126579371 TTAGTGGTGGAGCAGGACTGAGG - Intergenic
980850959 4:138380766-138380788 TTAGGGGAGGTGCAGGGCTAGGG - Intergenic
981247756 4:142560207-142560229 TTAGGAGAGGCACATGGCTGAGG - Intronic
981548832 4:145921634-145921656 TGAGGGGAGGAAAAGGAAGGGGG + Intronic
981883451 4:149644294-149644316 TTGGGGGAGGAAAAGTACTTTGG - Intergenic
982354098 4:154448007-154448029 TGAGGGTTGAAACAGGACTGAGG - Intronic
982689442 4:158531416-158531438 TCAGGAGAGGATCAGGAGTGAGG - Intronic
983898953 4:173113032-173113054 AGTGAGGAGGAACAGGACTGGGG - Intergenic
984742544 4:183179655-183179677 TTGGGGGAGGAATGGGACTGGGG + Intronic
985301888 4:188498685-188498707 TTTGGGGAGGAAGAATACTGGGG + Intergenic
985611343 5:891367-891389 TCAGGGGAGGGACAGAACTAAGG + Intronic
985936845 5:3103745-3103767 GCAGGAGAGGAACAGGGCTGGGG - Intergenic
987238640 5:15969606-15969628 TTAATTGAGGAAAAGGACTGAGG + Intergenic
994042295 5:95272949-95272971 TCAGGTGAGGAACAGTAATGGGG - Intronic
1000128813 5:158274794-158274816 TGAGGGGAGGTACAGGAGTAAGG - Intergenic
1001115076 5:168932633-168932655 TTAGGAAGGAAACAGGACTGCGG + Intronic
1001319130 5:170665868-170665890 TTTGGGGAGGAAGAGCACAGAGG + Intronic
1001874856 5:175191066-175191088 TTGGGGAAGTAACAGGACTTGGG + Intergenic
1002330459 5:178437166-178437188 GAAGGGCAGGAACAGGAGTGTGG - Intronic
1002429467 5:179194624-179194646 GTAGGGGAGGACCAGCACAGGGG + Intronic
1002617476 5:180464620-180464642 GTGGGGGAGGCACAGGCCTGGGG - Intergenic
1004971542 6:20916151-20916173 TTAGAGGAAGAAAGGGACTGTGG - Intronic
1005195528 6:23279060-23279082 TTGGGGGCGGTACAGGACAGAGG + Intergenic
1006068338 6:31478473-31478495 ATGGGTGAGGCACAGGACTGTGG + Intergenic
1009409223 6:63346399-63346421 TTTGGAGAGCAACTGGACTGCGG + Intergenic
1011079945 6:83478887-83478909 TGAGGGGAACAACAGGATTGGGG + Intergenic
1012532303 6:100252324-100252346 TAAGAGGAGGAGCAGGTCTGAGG + Intergenic
1013027329 6:106289356-106289378 TTAGGGGAGCATCAGGACCTAGG - Intronic
1013289140 6:108705884-108705906 TTAGGAAAGGGACTGGACTGGGG - Intergenic
1014230660 6:118898562-118898584 TTAGGGGTGGCACATGCCTGTGG - Intronic
1014255804 6:119159239-119159261 TTAGAAGAGGAAGAGGAATGAGG + Intergenic
1015005892 6:128281389-128281411 TGAGGGGAGAAAAAGGAGTGCGG - Intronic
1017432807 6:154387178-154387200 TTAGGGGAGGAAGAGGTCCCTGG - Intronic
1020993033 7:15226075-15226097 GAAGGTGATGAACAGGACTGGGG - Intronic
1021235847 7:18141853-18141875 TTAGAGCAGGACCAAGACTGTGG + Intronic
1021743454 7:23712323-23712345 GTTGGGGAGGAACTGGATTGGGG - Intronic
1023729896 7:43180987-43181009 TTAGGGGAGAGAGAGGAATGAGG - Intronic
1023891764 7:44397917-44397939 TCAGGGGAGGAAAAAGGCTGTGG - Intronic
1026881184 7:73907811-73907833 TGAGGGGAGGAACAGGGCTGGGG - Intergenic
1028897590 7:96059803-96059825 TTGTGTGAGGAACAGGACAGAGG + Intronic
1028977320 7:96928708-96928730 TTTGAGGGGGAACAGGAGTGAGG + Intergenic
1032842702 7:135726939-135726961 TTGGGGGAGGAAGAGAACCGTGG - Intronic
1033661769 7:143407809-143407831 TTAGGGGAGAAAAAGGGCTCAGG + Intronic
1035392550 7:158515002-158515024 TTAGGCAAGAAACAGTACTGTGG - Intronic
1037275385 8:17172869-17172891 TTTGGGGAGGAACCGGGCTCTGG - Intronic
1038567746 8:28634064-28634086 TGAGGAGAGAAACAGGGCTGGGG + Intronic
1038668963 8:29566138-29566160 TTAGGGAATGAACAGTACTCTGG - Intergenic
1041206224 8:55500581-55500603 TTAGGGTTGGAAGAGGACAGAGG - Intronic
1041371925 8:57171016-57171038 TTATGGGTGGGGCAGGACTGGGG - Intergenic
1041892843 8:62890717-62890739 ATAGGAGAGGGACAGGATTGAGG + Intronic
1042155698 8:65841992-65842014 GGAGGGGAGGAGCAGGACTCCGG - Intronic
1042750999 8:72157683-72157705 TTAGGTCAGGAAAAAGACTGGGG - Intergenic
1043058021 8:75464918-75464940 TTGGGAGAGGAAAAGGAATGAGG + Intronic
1044848310 8:96403441-96403463 TCAGGGGAGGAACATGATTTTGG - Intergenic
1046830723 8:118742782-118742804 TTGGGGGAGAAACAGGATTTGGG + Intergenic
1047018898 8:120753577-120753599 TGAGGGCAGGAACAGAACTTCGG + Intronic
1047926379 8:129686863-129686885 TTTGGGAAGGAAGAGGACTGTGG - Intergenic
1049443925 8:142621529-142621551 ATAGGGGAGGGATAGGTCTGGGG + Intergenic
1049600591 8:143505627-143505649 CAAGGAGTGGAACAGGACTGGGG + Intronic
1049742255 8:144246830-144246852 GCATGGGAGGAGCAGGACTGAGG + Intronic
1051975630 9:22944183-22944205 TTAGAGCAGGAAAAGGACTGAGG + Intergenic
1053173690 9:35907885-35907907 TTGGGGGAAGACAAGGACTGGGG + Intergenic
1053600909 9:39608680-39608702 TTTGGGGAGGCTGAGGACTGTGG - Intergenic
1054252625 9:62733758-62733780 TTTGGGGAGGCTGAGGACTGTGG + Intergenic
1054566741 9:66768256-66768278 TTTGGGGAGGCTGAGGACTGTGG + Intergenic
1055301413 9:74887192-74887214 TTGGGGAAGGAAGCGGACTGCGG + Intronic
1055649929 9:78397303-78397325 TGAGGGGAGGCTCAGGGCTGGGG - Intergenic
1057561529 9:96131562-96131584 GCAGGGGAGGCACAGGCCTGTGG + Intergenic
1057829795 9:98397735-98397757 GGAGGGGAGGAACAGTACTCAGG - Intronic
1060351307 9:122863079-122863101 TTAGGGCTGGGACAGGAATGGGG - Intronic
1060441376 9:123643035-123643057 GGAGTGGTGGAACAGGACTGGGG + Intronic
1060950554 9:127599441-127599463 TTTGGGGAGGAACAGGCCTCAGG - Intergenic
1061130869 9:128707030-128707052 TTAGGAGAGGGCCAGGGCTGGGG - Intronic
1061753984 9:132799965-132799987 TTACAAAAGGAACAGGACTGTGG + Intronic
1062511207 9:136907186-136907208 TCAGGCGAGGCAGAGGACTGTGG - Intronic
1185505377 X:629722-629744 TTACGGGAGGAAGGGGACTCCGG + Intronic
1186272054 X:7899725-7899747 TTAGGGGAGGAAGATGAGAGGGG + Exonic
1186459110 X:9734363-9734385 TTATGGGAGAAACAGAATTGTGG + Intronic
1186813529 X:13213334-13213356 TTTGGGCAGCAACAGGCCTGTGG - Intergenic
1187055567 X:15738555-15738577 ATAGTGGAGGAAGAGGGCTGGGG - Intronic
1187550425 X:20297436-20297458 TTGTGGGAGAAACAGGAATGAGG + Intergenic
1187713838 X:22081551-22081573 TTTGGGCAGGCACAGCACTGTGG + Intronic
1188289659 X:28371845-28371867 ATAGGGGAGCCACATGACTGAGG - Intergenic
1188511415 X:30940259-30940281 TTTGGAGAGGAAGAGGACAGAGG - Intronic
1191163425 X:57360806-57360828 TGAGGGGAGGAAGAGCACTAGGG - Intronic
1191884847 X:65877848-65877870 TTTTGGCAGAAACAGGACTGGGG + Intergenic
1192619734 X:72666664-72666686 CTAATGGAGCAACAGGACTGTGG - Intronic
1193196081 X:78632950-78632972 TTGGGGGAGGAAGAGGAGAGTGG - Intergenic
1196765750 X:119241030-119241052 TTTGGGGAGAAATAGGAATGAGG + Intronic
1199321706 X:146447371-146447393 TTAAGGGAGGAACTGAGCTGTGG + Intergenic
1199427161 X:147716168-147716190 TTAAGGGAGGAACAGCAAAGAGG + Intergenic
1199599191 X:149531516-149531538 TTAGAGGAGGGAAAGGACAGAGG + Intronic
1200712198 Y:6496610-6496632 GTAGTGGAGGAACAGGAGGGTGG - Intergenic
1200820978 Y:7582121-7582143 TTAGGGGCGTAACAGGACCATGG + Intergenic
1200952258 Y:8910013-8910035 GTAGTGGAGGAACAGGAGGGTGG + Intergenic
1201401511 Y:13608860-13608882 GTAGGGGAGGATCACCACTGTGG - Intergenic
1202160754 Y:21933626-21933648 GTAGTGGAGGAACAAGACCGTGG - Intergenic
1202230602 Y:22652749-22652771 GTAGTGGAGGAACAAGACCGTGG + Intergenic
1202239327 Y:22750621-22750643 TTAGGGGCGTAACAGGACCATGG - Intergenic
1202312555 Y:23543416-23543438 GTAGTGGAGGAACAAGACCGTGG - Intergenic
1202392314 Y:24384383-24384405 TTAGGGGCGTAACAGGACCATGG - Intergenic
1202478470 Y:25285734-25285756 TTAGGGGCGTAACAGGACCATGG + Intergenic
1202558247 Y:26127178-26127200 GTAGTGGAGGAACAAGACCGTGG + Intergenic