ID: 1181632232

View in Genome Browser
Species Human (GRCh38)
Location 22:24157236-24157258
Sequence TTAGGGGAGGAACAGGACTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181632214_1181632232 27 Left 1181632214 22:24157186-24157208 CCTAGGGGTGTTCAACCTGGCCT No data
Right 1181632232 22:24157236-24157258 TTAGGGGAGGAACAGGACTGCGG No data
1181632219_1181632232 7 Left 1181632219 22:24157206-24157228 CCTGCTTCTGGGGCCCCTTTCCT No data
Right 1181632232 22:24157236-24157258 TTAGGGGAGGAACAGGACTGCGG No data
1181632221_1181632232 -6 Left 1181632221 22:24157219-24157241 CCCCTTTCCTCCCAACCTTAGGG No data
Right 1181632232 22:24157236-24157258 TTAGGGGAGGAACAGGACTGCGG No data
1181632218_1181632232 12 Left 1181632218 22:24157201-24157223 CCTGGCCTGCTTCTGGGGCCCCT No data
Right 1181632232 22:24157236-24157258 TTAGGGGAGGAACAGGACTGCGG No data
1181632223_1181632232 -7 Left 1181632223 22:24157220-24157242 CCCTTTCCTCCCAACCTTAGGGG No data
Right 1181632232 22:24157236-24157258 TTAGGGGAGGAACAGGACTGCGG No data
1181632225_1181632232 -8 Left 1181632225 22:24157221-24157243 CCTTTCCTCCCAACCTTAGGGGA No data
Right 1181632232 22:24157236-24157258 TTAGGGGAGGAACAGGACTGCGG No data
1181632213_1181632232 28 Left 1181632213 22:24157185-24157207 CCCTAGGGGTGTTCAACCTGGCC No data
Right 1181632232 22:24157236-24157258 TTAGGGGAGGAACAGGACTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181632232 Original CRISPR TTAGGGGAGGAACAGGACTG CGG Intronic