ID: 1181632233

View in Genome Browser
Species Human (GRCh38)
Location 22:24157237-24157259
Sequence TAGGGGAGGAACAGGACTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 269}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181632225_1181632233 -7 Left 1181632225 22:24157221-24157243 CCTTTCCTCCCAACCTTAGGGGA 0: 1
1: 0
2: 0
3: 18
4: 178
Right 1181632233 22:24157237-24157259 TAGGGGAGGAACAGGACTGCGGG 0: 1
1: 0
2: 0
3: 30
4: 269
1181632214_1181632233 28 Left 1181632214 22:24157186-24157208 CCTAGGGGTGTTCAACCTGGCCT 0: 1
1: 0
2: 2
3: 5
4: 96
Right 1181632233 22:24157237-24157259 TAGGGGAGGAACAGGACTGCGGG 0: 1
1: 0
2: 0
3: 30
4: 269
1181632219_1181632233 8 Left 1181632219 22:24157206-24157228 CCTGCTTCTGGGGCCCCTTTCCT 0: 1
1: 1
2: 3
3: 40
4: 457
Right 1181632233 22:24157237-24157259 TAGGGGAGGAACAGGACTGCGGG 0: 1
1: 0
2: 0
3: 30
4: 269
1181632218_1181632233 13 Left 1181632218 22:24157201-24157223 CCTGGCCTGCTTCTGGGGCCCCT 0: 1
1: 2
2: 5
3: 60
4: 454
Right 1181632233 22:24157237-24157259 TAGGGGAGGAACAGGACTGCGGG 0: 1
1: 0
2: 0
3: 30
4: 269
1181632221_1181632233 -5 Left 1181632221 22:24157219-24157241 CCCCTTTCCTCCCAACCTTAGGG 0: 1
1: 0
2: 0
3: 26
4: 257
Right 1181632233 22:24157237-24157259 TAGGGGAGGAACAGGACTGCGGG 0: 1
1: 0
2: 0
3: 30
4: 269
1181632213_1181632233 29 Left 1181632213 22:24157185-24157207 CCCTAGGGGTGTTCAACCTGGCC 0: 1
1: 0
2: 0
3: 5
4: 66
Right 1181632233 22:24157237-24157259 TAGGGGAGGAACAGGACTGCGGG 0: 1
1: 0
2: 0
3: 30
4: 269
1181632223_1181632233 -6 Left 1181632223 22:24157220-24157242 CCCTTTCCTCCCAACCTTAGGGG No data
Right 1181632233 22:24157237-24157259 TAGGGGAGGAACAGGACTGCGGG 0: 1
1: 0
2: 0
3: 30
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181632233 Original CRISPR TAGGGGAGGAACAGGACTGC GGG Intronic
900505296 1:3027381-3027403 TAGGGGAGGATCAGGCCAGGAGG + Intergenic
900600893 1:3502226-3502248 GAGGGGAGGGGCAGGGCTGCTGG + Intronic
901364923 1:8738567-8738589 TAGAGGATGACCAGGGCTGCAGG - Intronic
901880553 1:12191427-12191449 TCGGGGAGGAGCGGCACTGCGGG + Intronic
901880557 1:12191445-12191467 GCGGGGAGGAGCAGGACTGCAGG + Intronic
901880575 1:12191499-12191521 TCGGGGAGGAGCGGGACTGCGGG + Intronic
902470951 1:16647356-16647378 TAGGGAAGGTCCAGGACTCCAGG + Intergenic
902487852 1:16760092-16760114 TAGGGAAGGTCCAGGACTCCAGG - Intronic
902793444 1:18784689-18784711 AAGGGGAGGAACAGTGCTGCTGG + Intergenic
903867373 1:26409620-26409642 TGGTGGAGGAACAGGACTGGGGG - Intergenic
904873145 1:33634418-33634440 CAGGGGAGGAGCAGGACGGAGGG - Intronic
905370558 1:37480468-37480490 TTGGGGAGAACCAGGGCTGCTGG - Intronic
906033325 1:42736586-42736608 CAGGGGAGGCACAGGAGTGGTGG - Intronic
906167124 1:43694727-43694749 AAGCGGAGGAAAAGAACTGCTGG + Exonic
907110842 1:51924908-51924930 TAGGAGAAGAAAAGGACTGGGGG - Intronic
907845208 1:58199143-58199165 TATGGGATCAATAGGACTGCAGG - Intronic
912723749 1:112041483-112041505 TAGGGGAAGATCAGCACTGAGGG + Intergenic
912948596 1:114105295-114105317 CAGGGGGGGAACAGGGCTGTAGG - Intronic
913275813 1:117136832-117136854 TATGGGAAGAAGAGGCCTGCAGG - Intergenic
915163848 1:153937497-153937519 ACGGCGAGGAGCAGGACTGCTGG + Exonic
916744048 1:167670707-167670729 GAGGGGAGGAGCAGGACTGGAGG - Intronic
916757821 1:167790249-167790271 TAAGGGAGGAACAGGCCTCCAGG - Exonic
917142750 1:171853843-171853865 AAGGGGAGGGAGGGGACTGCAGG - Intronic
918491669 1:185088019-185088041 TAGGGGAGGAGCAGGTTTGAAGG + Intronic
922362178 1:224833391-224833413 GAGGGGAGAAGCAGGAGTGCTGG + Intergenic
923015007 1:230120057-230120079 CAGGGGAGGAACAGGAAAGCAGG - Intronic
924257365 1:242195717-242195739 TAGGGCAGTAACAGGAATTCAGG + Intronic
1063927693 10:10996736-10996758 TGGAGGAGGACCAGAACTGCGGG - Intergenic
1065935273 10:30515459-30515481 TAGGGGAGCACCAGTACTGCTGG + Intergenic
1066499465 10:35975909-35975931 TAGGGGGAGAAAAGGACTGTTGG - Intergenic
1067453846 10:46399019-46399041 TGGGGGAGGGACAGGAGTGCAGG + Intergenic
1067583352 10:47460255-47460277 TGGGGGAGGGACAGGAGTGCAGG - Intronic
1067633355 10:47985611-47985633 TGGGGGAGGGACAGGAGTGCAGG - Intergenic
1068769816 10:60808570-60808592 TAGAAGAGGAACAGGGCTACAGG - Intergenic
1069030366 10:63589568-63589590 TAGGGGAGGAAAAGGCTTCCTGG - Intronic
1069756569 10:70777378-70777400 GAGGGGAGGAAGAGGGCTGAGGG + Intronic
1070018454 10:72559263-72559285 TGGGGGAGGAAAGGGACTGAAGG + Intronic
1071502891 10:86216025-86216047 TAGGGGAGGAAGAGCATTTCAGG - Intronic
1071813162 10:89205580-89205602 TAGGGGAAGAACAGAATTGGAGG - Intergenic
1072733263 10:97862612-97862634 AAGAGGAGGAACAGGACAGGTGG + Intronic
1073577629 10:104639566-104639588 AAGGGGAGGAGCAGGGCTGGAGG + Intergenic
1074157796 10:110813319-110813341 TACTGGACGAACAGGACTACAGG - Intronic
1077077605 11:708563-708585 TAGGGGAGGGACTGGAGGGCAGG - Intronic
1077697935 11:4412066-4412088 TAGGGAAATAACAGGTCTGCTGG - Intergenic
1078135709 11:8649973-8649995 TGGTGGAGGAATAGGCCTGCAGG - Intronic
1078468116 11:11565343-11565365 AAGGGCTGGAACAGGACTGGCGG + Intronic
1079597803 11:22272634-22272656 TAGAGGAGGAACTGGACAGACGG + Intronic
1080307638 11:30853922-30853944 CAGGAGAGAAACAGGACTGAGGG + Intronic
1084405978 11:68973752-68973774 AAGGGGCAGAAAAGGACTGCAGG - Intergenic
1089050787 11:115544065-115544087 TAGGGGAGAAAAAGGACCTCAGG + Intergenic
1089528081 11:119109780-119109802 TAGGGGATGAAAGGGATTGCAGG + Intronic
1089538985 11:119178565-119178587 TAGTGGGGGAACTGGTCTGCGGG + Intronic
1089707390 11:120289551-120289573 TAGGGGAGGGAGAGGACAGGCGG - Intronic
1091205661 11:133819111-133819133 TGAGGGAGGAGCAGGCCTGCTGG + Intergenic
1091281931 11:134386686-134386708 TGGGGGAGGAATAGGATTTCTGG - Intronic
1093068349 12:14682574-14682596 TAGGGGAGAAACAGGAATAATGG - Intronic
1096614066 12:52821828-52821850 GAGGGCAGGGACAGGATTGCAGG + Exonic
1096651586 12:53064541-53064563 TGGGCTAGGAACAGGACTGCTGG - Exonic
1096797884 12:54089943-54089965 GAGGGGAGAAACAGTCCTGCTGG + Intergenic
1096975613 12:55697860-55697882 CAGGGGAGGCAGAGGCCTGCGGG - Intronic
1101031349 12:100663448-100663470 TAGGGGAGAAGCAGGAGAGCTGG - Intergenic
1101624439 12:106425276-106425298 TAGGGGAGGAGCAGGAAACCTGG - Intronic
1102043470 12:109815417-109815439 TTGATGAGGAAAAGGACTGCCGG - Intronic
1103581063 12:121915921-121915943 CTGGGCAGGAAAAGGACTGCTGG + Exonic
1103917868 12:124385275-124385297 TTGGGGAGGGACAGGTCTGGGGG - Intronic
1104895839 12:132163223-132163245 CAGGGGAGGAACAGACATGCAGG - Intergenic
1106072226 13:26423928-26423950 TGAGAGAGGAGCAGGACTGCAGG - Intergenic
1106930142 13:34654412-34654434 TAGGGGAGTAACTTGACTGTGGG - Intergenic
1109426788 13:62175123-62175145 TAGGGGAAAAACAGGACTAATGG + Intergenic
1113764010 13:112869608-112869630 TGGGGGAGGAAGAGGAGAGCTGG + Intronic
1115403327 14:32989018-32989040 GTGGGGAGGAACAGGAATGGAGG + Intronic
1116842031 14:49828115-49828137 TAGGGGAGGAGCAGTCCTGGGGG + Intronic
1117025249 14:51612959-51612981 AAGGGGAGGAAAAGGAATTCAGG + Intronic
1118186810 14:63544935-63544957 GAGGGTAGGAACTAGACTGCTGG - Intergenic
1119226218 14:72946437-72946459 TAGGGAAAGAAAAGGACTCCAGG + Intronic
1119740673 14:77012026-77012048 TAGGGGAGGAACAGCCCGGGAGG - Intergenic
1119862297 14:77944984-77945006 TAGGGGTGGATCTGGCCTGCAGG - Intergenic
1120314895 14:82879086-82879108 AAGGGGTGGAGCAGAACTGCTGG + Intergenic
1121597223 14:95173574-95173596 CAGGGCAGGGACAGGACAGCAGG - Intergenic
1121613626 14:95298190-95298212 AAGGGAAGGGAGAGGACTGCAGG - Intronic
1122327857 14:100893215-100893237 TCGAGGAGGGACAGGACAGCTGG + Intergenic
1122782250 14:104148675-104148697 GAGGGGAGGGGCAGGGCTGCAGG + Intronic
1123145455 14:106125523-106125545 GAGGGGAGAAACAGGACTGGGGG - Intergenic
1123218049 14:106830906-106830928 AAGGGGAGGATCAGGACACCAGG - Intergenic
1123218168 14:106831499-106831521 AAGGGGAGGATCAGGACACCAGG - Intergenic
1126533530 15:49735275-49735297 TCGGGCAGGAGCAGGACTGCTGG - Intergenic
1127235623 15:57048209-57048231 CAGGGGAGGAATATGAGTGCTGG - Intronic
1127642666 15:60930540-60930562 TAGGGGAGGCTGAGGACTCCTGG - Intronic
1128662681 15:69513708-69513730 ATGGGGAGGAACAAGACTGTGGG + Intergenic
1129407221 15:75327740-75327762 AAGGGGAGGAAGAGGTGTGCTGG + Intergenic
1130641126 15:85676426-85676448 AGGAGGAGGAACAGGTCTGCAGG + Intronic
1131229992 15:90652841-90652863 TGGGGGAGAAACAGGAGTCCAGG - Intergenic
1131519331 15:93101470-93101492 CAGGGGAAGTACAGGGCTGCTGG + Intergenic
1131760501 15:95617685-95617707 TAGGGGAGAAAAAGGAGAGCTGG + Intergenic
1132577248 16:669817-669839 TGGGGAAGAAAGAGGACTGCCGG - Intronic
1132721800 16:1320240-1320262 TAGAGGAGGACAAGGACTGGAGG + Exonic
1132804575 16:1769592-1769614 TCTGGGAGGGACAGGACTCCAGG - Exonic
1133500513 16:6361837-6361859 TAGGGAAGGAAAAGGAATACAGG + Intronic
1135228838 16:20685875-20685897 TAGGGGTGGAGCGGGACTTCTGG + Intronic
1136360898 16:29779080-29779102 TCAGAGAGGAACAGGACTACAGG + Intronic
1136664881 16:31801818-31801840 CAGGGGAGGACCTGGACGGCAGG + Intergenic
1136693654 16:32056260-32056282 GAGGGGAGAAACAGGACTGGGGG + Intergenic
1136794144 16:32999495-32999517 GAGGGGAGAAACAGGACTGGGGG + Intergenic
1138096561 16:54216574-54216596 TAGGGGAGGAAAAGCCATGCCGG - Intergenic
1141204805 16:81925478-81925500 TAGCAGAGACACAGGACTGCGGG - Intronic
1141361220 16:83396786-83396808 TAGGGGAGGAGCAGGAGTAGGGG + Intronic
1141648238 16:85378702-85378724 CAGGGCAGGCACAGGGCTGCAGG - Intergenic
1142073286 16:88103160-88103182 TAGAGCAGGAACAGGACAGATGG + Intronic
1203096408 16_KI270728v1_random:1261176-1261198 GAGGGGAGAAACAGGACTGGGGG + Intergenic
1143064310 17:4232347-4232369 TAGGCAATGAGCAGGACTGCTGG + Intronic
1143136913 17:4717278-4717300 TACGGGAGGAACAGCTCTGAGGG + Intronic
1143973175 17:10810577-10810599 TGGAAGAGGAACAGGGCTGCAGG - Intergenic
1144322721 17:14145751-14145773 TAGGGGAGGATCAATACTGGAGG + Intronic
1146803723 17:35848433-35848455 TAGGGAAGGAACAGCTTTGCAGG + Intronic
1146942866 17:36855799-36855821 AAAGGGAGGAACTGGAATGCTGG - Intergenic
1147339148 17:39743535-39743557 GAGGGGAGGCACAGGACTTAAGG - Intronic
1148645808 17:49219260-49219282 TGGGGGAGGGACAGGGGTGCTGG + Intronic
1148694455 17:49550496-49550518 GAGGGCAGGAACAGGAGGGCTGG + Intergenic
1149659540 17:58327108-58327130 GAGGGAAGGAACAGGACTTTGGG - Intronic
1150641628 17:66953446-66953468 CAGGGGAGGGACAGGCCTGCTGG - Intergenic
1151817585 17:76478903-76478925 GAGGTGAGGGACAGGACTCCGGG + Exonic
1152007309 17:77690810-77690832 AAGGAGAGGAGCAGGTCTGCAGG - Intergenic
1152560396 17:81075767-81075789 GAGGGGAGGAGCAGGACTTGAGG - Intronic
1153958030 18:10114905-10114927 AAGCAGAGGAACAGGAATGCTGG - Intergenic
1154077191 18:11214883-11214905 CAGGGGAAGAACGGGACTGGGGG + Intergenic
1154154945 18:11936662-11936684 CTGGGGAGGAGCAGGAATGCCGG + Intergenic
1154253898 18:12766674-12766696 TCGGGAAGGGGCAGGACTGCGGG - Intergenic
1155405295 18:25481176-25481198 TGTGGGAGGACCAGGACTGTGGG - Intergenic
1157109173 18:44803579-44803601 GAGGGGAAGAACAGGAAAGCTGG - Intronic
1160467694 18:79095398-79095420 TAGGGGGAAAACAGGACTGGGGG - Intronic
1160741084 19:686139-686161 CAGGGCAGGAACAGGTCTCCAGG - Intronic
1160915103 19:1492723-1492745 TTGGGGGGGAACTGGACTCCTGG - Intronic
1161058155 19:2200830-2200852 GAGGGGAGGACGAGGAATGCGGG - Intronic
1161058187 19:2200956-2200978 GAGGGGAGGACGAGGAATGCGGG - Intronic
1161058234 19:2201136-2201158 GAGGGGAGGACGAGGAATGCGGG - Intronic
1161058244 19:2201172-2201194 GAGGGGAGGACGAGGAATGCGGG - Intronic
1161058259 19:2201226-2201248 GAGGGGAGGACGAGGAATGCAGG - Intronic
1161860241 19:6792481-6792503 TAGGGGAGGAACAGGTCTTGGGG + Intronic
1162761413 19:12890952-12890974 TAGGGGCGGAAGACGAGTGCGGG - Intergenic
1163737457 19:18990242-18990264 GAGGGGAGGAGCCAGACTGCAGG - Intergenic
1163846390 19:19640552-19640574 CAGGGGAGGAACTGGACTTGCGG - Exonic
1164301577 19:23966950-23966972 TAGGCCAGGAACATTACTGCTGG - Intergenic
1164315866 19:24087508-24087530 CAGGGAAGAAACAGGACTCCTGG - Intronic
1165232129 19:34393847-34393869 GAGGGGAGGGACAGGACAGTGGG - Intronic
1165829651 19:38724133-38724155 TAGGGGAGGAGCTGGAGTGAGGG - Intronic
1166615136 19:44237015-44237037 TAGGGGAGAAATAGGGCTGGTGG + Exonic
1166971683 19:46572919-46572941 TGTGAGAGGAACAGGACTGGTGG + Intronic
1167348655 19:48962172-48962194 TAAGGGAAGAACAGCACGGCCGG + Intergenic
1168273986 19:55266040-55266062 AAGGGGAGGAACAGGCATCCCGG - Intronic
1202703347 1_KI270713v1_random:4148-4170 TAGGGAAGGTCCAGGACTCCAGG + Intergenic
925155626 2:1647388-1647410 TGGGGTAGGATCAGGGCTGCCGG - Intronic
925412481 2:3647902-3647924 TAGGGGAGAAACAGACCTGGAGG + Intergenic
925659839 2:6190694-6190716 CAGGGGATGACCAGGAATGCGGG + Intergenic
926122858 2:10254259-10254281 TGGGGGAGGAAGAGGGCTGACGG + Intergenic
927623074 2:24682632-24682654 TTGGGGAGGAAGAGGATTGAAGG - Intronic
928680732 2:33699907-33699929 GATGGTAGGAACAGGACTCCAGG + Intergenic
929009125 2:37423838-37423860 CAAGAGAGGAAGAGGACTGCTGG + Intergenic
931786082 2:65620576-65620598 GAGGGGAAGAACAGGACAGAAGG - Intergenic
931853294 2:66275514-66275536 TAGAGGAGGAAGAGCATTGCAGG - Intergenic
934938727 2:98484112-98484134 CAGGGGAGGGACAGGAGTGGAGG - Intronic
936392116 2:112084810-112084832 TTGGAGAGGAACAAAACTGCAGG - Intronic
938120841 2:128632060-128632082 TGCGGGAGGAGCAGGAGTGCAGG - Intergenic
938378867 2:130825631-130825653 TTGGGGTGGAACAGGTTTGCAGG - Intergenic
938386463 2:130870475-130870497 AAGGGAAGGAACAGGGCTGAGGG - Intronic
942298269 2:174537797-174537819 GAGGTGAGGAGCAGGACTGGGGG + Intergenic
946155310 2:217803185-217803207 GAGGGGAGGATAAGGACTCCAGG + Exonic
946404735 2:219486358-219486380 TGGGGGAAGAACAGGACTGGTGG - Intronic
948594986 2:239074017-239074039 GAGGGGAGCAGCAGGACTGAGGG + Intronic
948725150 2:239929898-239929920 CAGTGGAGGAGCAGGACTGGTGG - Intronic
948725180 2:239930017-239930039 CAGTGGAGGAGCAGGACTGGTGG - Intronic
948725205 2:239930119-239930141 CAGTGGAGGAGCAGGACTGGTGG - Intronic
948902691 2:240964384-240964406 TAGGGGAGGCAGAGACCTGCTGG + Intronic
1169478468 20:5953971-5953993 TAGGGGAGCAATGGGAGTGCTGG - Intronic
1169653710 20:7898141-7898163 TAGGGTGGGAGCAGGATTGCTGG + Intronic
1169914642 20:10673400-10673422 GAGGGGAGGGAGAGGACGGCTGG + Intronic
1170311376 20:14996457-14996479 TAGAGGAGGAAGATGATTGCTGG - Intronic
1170471117 20:16669299-16669321 TAAGGGAGGTCCAGGACTTCTGG - Intergenic
1171060129 20:21948796-21948818 AAGGGGAGGAACAGGAGTAATGG - Intergenic
1171780850 20:29416402-29416424 AAGGCCGGGAACAGGACTGCTGG - Intergenic
1171966255 20:31533143-31533165 GAGGGGAGGAAAAGGGCTGAGGG - Intronic
1173184554 20:40830671-40830693 TGGGGGTGGAGCAGGGCTGCTGG + Intergenic
1173312818 20:41915913-41915935 AAGGGGAGGATCAGGAATGGTGG + Intergenic
1174787815 20:53449050-53449072 CAGGGGAGGGACATGACTGGAGG - Intronic
1174838106 20:53877019-53877041 CAGGGGAGGATCAGGACAGGAGG - Intergenic
1175366803 20:58461397-58461419 CGGGTGAGGAACAGGACTGCTGG + Exonic
1176230768 20:64031799-64031821 GAGGGGAGCACCAGGGCTGCGGG + Intronic
1176959500 21:15143305-15143327 TAGGGAAGGAACAGGTTTGCAGG - Intergenic
1179044388 21:37831702-37831724 TAGGTGAGCTACAGGACTGGAGG - Intronic
1180724959 22:17940004-17940026 TAGGAGTGGTACAGGACTGCCGG - Intronic
1180840541 22:18956982-18957004 GAGGGGAGGAACAGCCCTGCTGG + Intergenic
1181060952 22:20281792-20281814 GAGGGGAGGAACAGCCCTGCTGG - Intronic
1181515093 22:23405601-23405623 GAGGGGAGGAACAGCCCTGCTGG - Intergenic
1181632233 22:24157237-24157259 TAGGGGAGGAACAGGACTGCGGG + Intronic
1182003000 22:26936447-26936469 TAAGGAAGGAAGAGGACTACAGG - Intergenic
1182362337 22:29754105-29754127 CAGGGGAGGAAGGGGACAGCTGG + Intronic
1183598627 22:38827100-38827122 CAGGGGAGGGACAGGTCTGGTGG - Intronic
1183671912 22:39278077-39278099 CAGGGGTGGACCAGGACTGAAGG - Intergenic
1184074067 22:42165006-42165028 TAGAGAAGGGACAGGACTGGAGG + Intronic
1184557991 22:45243547-45243569 GAGGGCAGGAGCAGGACTTCTGG + Intergenic
1184875308 22:47270529-47270551 TAGGGGGGGGACAAGACTCCAGG + Intergenic
950024150 3:9809399-9809421 AAGGGGAGGAACTGCACTTCAGG - Intronic
950855560 3:16101493-16101515 TAGGGGAAGGACAGGGCAGCAGG - Intergenic
951565017 3:24004453-24004475 TAGGGGAGGAACAGGTCACAAGG + Intergenic
952209133 3:31211738-31211760 CAGGTGAGAAACAGGACTGTGGG + Intergenic
953508105 3:43506697-43506719 TAGTGGAGGAAGAGCAGTGCAGG - Intronic
954298485 3:49686887-49686909 TAGGGAAGGTCCAGGACTCCAGG - Intronic
954390767 3:50267044-50267066 TAGGGGAGGGAGAGGAGGGCAGG - Intergenic
955390618 3:58519885-58519907 TAGGACAGGAAAAGGAGTGCGGG - Intronic
957654094 3:83049486-83049508 TAGTGGAGTAACAGGATTGGTGG + Intergenic
961150187 3:124631420-124631442 TATAGGAGGAACAGGACTCAGGG - Intronic
961378580 3:126482804-126482826 GAGGGAAGAAAGAGGACTGCAGG - Intronic
962118846 3:132541106-132541128 GAGGGGAGGACAAGGACTTCGGG + Intergenic
963841108 3:150107294-150107316 TGGGGGTGGCACAGGACTCCAGG - Intergenic
964447202 3:156771998-156772020 TAGGGGGACAACATGACTGCGGG - Intergenic
967448762 3:189598278-189598300 GAGGGGAGGAAAGGGACAGCAGG + Intergenic
967613566 3:191537565-191537587 TAGGGGAGGAACCTGGGTGCAGG + Intergenic
968584703 4:1410757-1410779 CAGGGGAGGAAGAGGGCGGCAGG + Intergenic
970176892 4:13348593-13348615 CAGGGGAGAAACATGTCTGCAGG - Intergenic
975197404 4:71541708-71541730 TGGGGGAGGAACAAGAGTGGAGG + Intronic
978904850 4:113993835-113993857 CTGGGGAGAAACAGGACTGGAGG + Intergenic
979099782 4:116599671-116599693 GAGTGGAGGAACGGGACTGTGGG - Intergenic
982297455 4:153844278-153844300 TATGAGAGGAACAGCACTGTAGG + Intergenic
984412006 4:179407226-179407248 CAGGGGAGGAACAGGAAAGAAGG - Intergenic
985117293 4:186604897-186604919 TAGGAGAAGAAGAGGACTGGAGG + Intronic
991973724 5:72165541-72165563 TTGGCCAGGAACAGGACTGTTGG - Intronic
992068031 5:73125063-73125085 GAGGGGAGGAACTGGGTTGCTGG + Intronic
992406914 5:76467948-76467970 TAGGGGAAGAAGAGAAATGCTGG + Intronic
996442333 5:123506229-123506251 TAGGGGAGTCACAGAACTGACGG + Intergenic
996502336 5:124230719-124230741 TTGGGCAGGAACTGGAGTGCAGG - Intergenic
996645166 5:125805300-125805322 CTGGGGAGAAACAAGACTGCAGG - Intergenic
997844929 5:137277768-137277790 TAGGGGTGGATCAGGAATCCAGG - Intronic
998371520 5:141664991-141665013 TGGGGGCGGCACAGGGCTGCAGG - Exonic
998529466 5:142871440-142871462 TGGGGGAGGCACAGGATTGTCGG + Intronic
1001164033 5:169347234-169347256 TAGATGAGGAACAGGACACCAGG - Intergenic
1001740296 5:174047617-174047639 TAGGGGAGCAGCATGACTGCAGG + Intronic
1002163740 5:177332317-177332339 TGGGGATGGAACAGGACAGCCGG + Intronic
1003266456 6:4568624-4568646 TAGGGGAGCTTCAGGTCTGCCGG - Intergenic
1003989995 6:11476749-11476771 TAGGGGAGGAACAGGTTAGAAGG + Intergenic
1004020172 6:11770065-11770087 TAGCTCAAGAACAGGACTGCTGG - Exonic
1005797773 6:29385930-29385952 TAGGGGAAGAAAAGAACTGTAGG - Intronic
1006405465 6:33842438-33842460 GGGGGCAGGCACAGGACTGCAGG - Intergenic
1006603640 6:35241923-35241945 TAGGGTGGGAACAGGGCTTCTGG - Intronic
1007477106 6:42126000-42126022 TAGGCGAGGGGCAGGACAGCAGG + Intronic
1007679535 6:43624854-43624876 TAGGGCAGGGACAGGGCTGAAGG - Intronic
1007742727 6:44022673-44022695 TAGGGCAAGATAAGGACTGCTGG - Intergenic
1008516823 6:52326357-52326379 TAAAGGAGGAAAAGGACTACAGG - Intergenic
1011263788 6:85494820-85494842 AAGGGGAAGAACAGGACTCCAGG + Exonic
1015005891 6:128281388-128281410 GAGGGGAGAAAAAGGAGTGCGGG - Intronic
1021743453 7:23712322-23712344 TTGGGGAGGAACTGGATTGGGGG - Intronic
1022568608 7:31428539-31428561 TAGGCGAGGAACAGATCTCCAGG + Intergenic
1022628438 7:32062144-32062166 TAAGGGAGGAACATGTTTGCAGG - Intronic
1022773854 7:33503804-33503826 TGGGGGAGGAACACGATTCCAGG + Intronic
1023058584 7:36309242-36309264 CAGGGGAGGAAGGGGCCTGCAGG - Intergenic
1026881183 7:73907810-73907832 GAGGGGAGGAACAGGGCTGGGGG - Intergenic
1028049497 7:86164145-86164167 AAGGGAAGGAACAAGACTGCTGG + Intergenic
1028198620 7:87934928-87934950 TAGGGGAGACGTAGGACTGCAGG + Intronic
1028796893 7:94912884-94912906 TTGGGGAGGAATAGGAAGGCAGG - Intronic
1029265797 7:99339158-99339180 GGGGAGAGGAATAGGACTGCTGG - Intronic
1029519648 7:101051994-101052016 GAGGGGAGGACCAGGACGTCTGG - Intronic
1029738682 7:102479156-102479178 TAGGGGCAGAACAGCCCTGCCGG - Intergenic
1029755808 7:102572813-102572835 TAGGGGCAGAACAGCCCTGCCGG - Intronic
1029773750 7:102671886-102671908 TAGGGGCAGAACAGCCCTGCTGG - Intergenic
1030272606 7:107686331-107686353 AAGGGGAGGAAAGGGAGTGCAGG - Intronic
1033129980 7:138737516-138737538 TCTCTGAGGAACAGGACTGCAGG + Intronic
1033718198 7:144025221-144025243 TAGGAAAGAAACAGGGCTGCAGG - Intergenic
1037691203 8:21183167-21183189 TAGGGGAGGAGGAGGACCGGAGG - Intergenic
1041869326 8:62615453-62615475 TAGGGCAGCAAAAGGAGTGCTGG - Intronic
1047926378 8:129686862-129686884 TTGGGAAGGAAGAGGACTGTGGG - Intergenic
1049233372 8:141495669-141495691 TAGGTAAGGAGCAGGAGTGCAGG + Intergenic
1049786013 8:144451211-144451233 GAGGGGAGCACCAGGTCTGCAGG + Intronic
1049873903 8:145002992-145003014 CCGGGAAGGAGCAGGACTGCCGG - Intergenic
1051174255 9:14347367-14347389 TAGGGGAGGGAGAGGACGGGAGG + Intronic
1051176366 9:14364884-14364906 TAATGGAGGAACAAGACAGCAGG + Intronic
1051448877 9:17172536-17172558 TAGGGGAGGAAGACGAAGGCTGG + Intronic
1052337501 9:27335375-27335397 TAGTGGCAGAACTGGACTGCTGG + Intronic
1052986408 9:34491200-34491222 TGGGGGATGAACAGACCTGCAGG - Intronic
1054175773 9:61874402-61874424 GAGGGGAGAAACAGTCCTGCTGG + Intergenic
1054661766 9:67706408-67706430 GAGGGGAGAAACAGTCCTGCTGG - Intergenic
1057561530 9:96131563-96131585 CAGGGGAGGCACAGGCCTGTGGG + Intergenic
1057829794 9:98397734-98397756 GAGGGGAGGAACAGTACTCAGGG - Intronic
1058603097 9:106692314-106692336 TAGGGTATCAACAGAACTGCTGG - Intergenic
1059107510 9:111524469-111524491 TAGGGAAGGAGCAGGTCAGCCGG + Intergenic
1060879359 9:127107287-127107309 TGGGGGAGGAATGGGATTGCTGG - Intronic
1060950553 9:127599440-127599462 TTGGGGAGGAACAGGCCTCAGGG - Intergenic
1061747743 9:132752734-132752756 GAGGGGAGGAAGAGTTCTGCAGG - Intronic
1062070767 9:134553960-134553982 AAGGGGAGGAAGAGGAAGGCTGG + Intergenic
1185505378 X:629723-629745 TACGGGAGGAAGGGGACTCCGGG + Intronic
1186084763 X:5975053-5975075 TTGGGAGGGAGCAGGACTGCTGG + Intronic
1188444829 X:30245501-30245523 TAGGGCTGGAACTAGACTGCTGG + Intronic
1190398876 X:50011852-50011874 AAGAGGGGGAACAGGACTGAAGG - Intronic
1190411018 X:50137187-50137209 TAGGGTAGGAGCAGGGCTCCTGG + Intergenic
1192239630 X:69319106-69319128 TGGGGGAGGGGCAGAACTGCTGG - Intergenic
1192483978 X:71509233-71509255 TAGAAGAGGAACAAGACTGGAGG + Intronic
1192619733 X:72666663-72666685 TAATGGAGCAACAGGACTGTGGG - Intronic
1200758992 Y:7018818-7018840 TTGGGGAGGAGCAGGCCTGGTGG + Intronic
1200907379 Y:8498025-8498047 TAGGGGAGTCACAGCACTACAGG - Intergenic
1201511067 Y:14763771-14763793 TTGGGAGGGAGCAGGACTGCTGG - Intronic
1202268090 Y:23042035-23042057 TAGGGGAGTCACAGCACCGCAGG - Intergenic
1202421082 Y:24675779-24675801 TAGGGGAGTCACAGCACCGCAGG - Intergenic
1202449704 Y:24994303-24994325 TAGGGGAGTCACAGCACCGCAGG + Intergenic