ID: 1181634514

View in Genome Browser
Species Human (GRCh38)
Location 22:24168370-24168392
Sequence CTACATACACAGACAGGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 193}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181634509_1181634514 -3 Left 1181634509 22:24168350-24168372 CCTACCTAGGCTGGTCTGTGCTA 0: 1
1: 0
2: 0
3: 6
4: 103
Right 1181634514 22:24168370-24168392 CTACATACACAGACAGGGCTGGG 0: 1
1: 0
2: 1
3: 16
4: 193
1181634501_1181634514 18 Left 1181634501 22:24168329-24168351 CCCGAGCCACAGGGCATGCCCCC 0: 1
1: 0
2: 3
3: 44
4: 742
Right 1181634514 22:24168370-24168392 CTACATACACAGACAGGGCTGGG 0: 1
1: 0
2: 1
3: 16
4: 193
1181634502_1181634514 17 Left 1181634502 22:24168330-24168352 CCGAGCCACAGGGCATGCCCCCT 0: 1
1: 0
2: 1
3: 17
4: 253
Right 1181634514 22:24168370-24168392 CTACATACACAGACAGGGCTGGG 0: 1
1: 0
2: 1
3: 16
4: 193
1181634507_1181634514 -1 Left 1181634507 22:24168348-24168370 CCCCTACCTAGGCTGGTCTGTGC 0: 1
1: 0
2: 1
3: 9
4: 150
Right 1181634514 22:24168370-24168392 CTACATACACAGACAGGGCTGGG 0: 1
1: 0
2: 1
3: 16
4: 193
1181634503_1181634514 12 Left 1181634503 22:24168335-24168357 CCACAGGGCATGCCCCCTACCTA 0: 1
1: 0
2: 1
3: 3
4: 157
Right 1181634514 22:24168370-24168392 CTACATACACAGACAGGGCTGGG 0: 1
1: 0
2: 1
3: 16
4: 193
1181634510_1181634514 -7 Left 1181634510 22:24168354-24168376 CCTAGGCTGGTCTGTGCTACATA 0: 1
1: 0
2: 0
3: 7
4: 140
Right 1181634514 22:24168370-24168392 CTACATACACAGACAGGGCTGGG 0: 1
1: 0
2: 1
3: 16
4: 193
1181634508_1181634514 -2 Left 1181634508 22:24168349-24168371 CCCTACCTAGGCTGGTCTGTGCT 0: 1
1: 0
2: 1
3: 6
4: 166
Right 1181634514 22:24168370-24168392 CTACATACACAGACAGGGCTGGG 0: 1
1: 0
2: 1
3: 16
4: 193
1181634506_1181634514 0 Left 1181634506 22:24168347-24168369 CCCCCTACCTAGGCTGGTCTGTG 0: 1
1: 0
2: 0
3: 13
4: 184
Right 1181634514 22:24168370-24168392 CTACATACACAGACAGGGCTGGG 0: 1
1: 0
2: 1
3: 16
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181634514 Original CRISPR CTACATACACAGACAGGGCT GGG Intronic
900113028 1:1016964-1016986 CTATAAATACAGACAGGGCACGG - Intergenic
902066405 1:13691854-13691876 ACACACACACAGGCAGGGCTTGG + Intergenic
902169294 1:14598080-14598102 CTGGATGCACACACAGGGCTAGG + Intergenic
904297932 1:29534379-29534401 CCACATACTCACATAGGGCTGGG + Intergenic
906137774 1:43511874-43511896 CTAGATACTCAGAAATGGCTGGG - Intergenic
906925349 1:50109996-50110018 ACACACACACACACAGGGCTGGG - Intronic
907571593 1:55488906-55488928 CTTTATACACAGACAGGGTGGGG - Intergenic
909799469 1:79787940-79787962 CTACAAACAGATACAGGGATTGG + Intergenic
913557601 1:119983780-119983802 CTACATATACATAAAAGGCTTGG - Intronic
915088503 1:153405233-153405255 CCGCATACACAGACAGTGCTAGG - Intergenic
915096391 1:153465599-153465621 CCGCATACACAGACAGTGCTGGG + Intergenic
916623745 1:166530581-166530603 TTAAAAACACATACAGGGCTGGG - Intergenic
917908110 1:179609734-179609756 CTCCAAACTCACACAGGGCTAGG - Intronic
921163802 1:212491491-212491513 CTACATACACAGATTGGAATGGG + Intergenic
922707446 1:227796786-227796808 CTACAGAGACAGCCTGGGCTAGG - Intergenic
922728929 1:227940118-227940140 CTGCAGACACAGACAGGGCAGGG - Intronic
923431018 1:233920494-233920516 CTACATACACATCCAGGAGTGGG + Intronic
1064770615 10:18718709-18718731 TTACATACACAGAATGGGCCAGG - Intergenic
1066964625 10:42251562-42251584 CAACATAAACATACAGAGCTGGG + Intergenic
1067064241 10:43094674-43094696 CTGCCTCCACAGACAGGGCCAGG + Intronic
1067253598 10:44611777-44611799 TTAAATACACTGACAGAGCTAGG + Intergenic
1067690242 10:48497152-48497174 CTGCCTGCACATACAGGGCTAGG + Intronic
1069082678 10:64104992-64105014 CTTCATAGAAAGACAGAGCTTGG + Intergenic
1070782677 10:79146696-79146718 CACCAGACACAGGCAGGGCTGGG + Intronic
1070927555 10:80235869-80235891 CTAAAGACACAGAGAGGACTTGG - Intergenic
1072283119 10:93888198-93888220 GTACACACACACACAGTGCTTGG - Intergenic
1075072975 10:119331148-119331170 CTAGAAGGACAGACAGGGCTGGG - Intronic
1075339500 10:121634648-121634670 ATACATACACAAACAAGACTGGG + Intergenic
1075845140 10:125539289-125539311 CCACATATACAGACAGAGGTGGG + Intergenic
1077445448 11:2588540-2588562 CTTCACACAGAGACAGGGCAGGG - Intronic
1078911691 11:15738680-15738702 CTACATTCACAGACACTTCTGGG - Intergenic
1079713013 11:23709588-23709610 GAAAATACACAGTCAGGGCTGGG + Intergenic
1080520681 11:33065602-33065624 CTAAGAACACAGACAGGCCTGGG - Intronic
1081430992 11:42976545-42976567 ACACACACACAGACAGTGCTAGG - Intergenic
1082855923 11:57806560-57806582 CTACATGCATAGACAGGGAAAGG - Intronic
1087959347 11:104328298-104328320 CCAGAAACACAGCCAGGGCTTGG + Intergenic
1089754857 11:120679238-120679260 CTCCAGAGGCAGACAGGGCTTGG - Intronic
1091576180 12:1737981-1738003 CTACATACTAAGGCAGGGGTGGG + Intronic
1092848352 12:12605050-12605072 CAACAGACACACACAGGGCCAGG + Intergenic
1093878525 12:24377216-24377238 CAACATACACTGACAGGGAAAGG + Intergenic
1095492051 12:42745142-42745164 CTAGAGACGAAGACAGGGCTGGG - Intergenic
1096388496 12:51211445-51211467 CTAAAAACGCAGGCAGGGCTGGG + Intronic
1096493622 12:52026604-52026626 CCACATAGATAGACAGGGCTGGG + Intronic
1096538671 12:52291038-52291060 CCACCTACACAGCCAGGGCCGGG - Intronic
1096540106 12:52302322-52302344 CCACCTACACAGCCAGGGCCGGG + Intronic
1096694209 12:53338546-53338568 ATAAATGGACAGACAGGGCTGGG + Intronic
1098167099 12:67709980-67710002 ATAGATACATTGACAGGGCTTGG - Intergenic
1099534104 12:83824390-83824412 ATCCATAGACAGATAGGGCTTGG - Intergenic
1099780609 12:87190538-87190560 ATACACACACAGATAGGGCTTGG - Intergenic
1104193285 12:126504691-126504713 CTGCATACAAAGACTTGGCTGGG - Intergenic
1104662890 12:130624463-130624485 CTACACACACACACACGTCTTGG - Intronic
1112416725 13:99209075-99209097 CCACATGCACAGCCAGGGCAAGG - Intronic
1113370950 13:109725023-109725045 CTGCATTCACAGGCTGGGCTGGG + Intergenic
1114678188 14:24459628-24459650 TTACATACTCTGACAGTGCTGGG + Intergenic
1114719506 14:24865603-24865625 CTCCATGCTCACACAGGGCTGGG + Intronic
1119298595 14:73552888-73552910 CTGCCCACACAGACAGGCCTGGG - Intronic
1119302889 14:73585064-73585086 CTGCCCACACAGACAGGCCTGGG - Intergenic
1119328141 14:73774452-73774474 CTTCACACAGAGACAGAGCTGGG - Intronic
1119461483 14:74808173-74808195 CTATATAGACAGAAAGTGCTGGG - Intronic
1121119332 14:91366188-91366210 ACACACACACACACAGGGCTGGG + Intronic
1123865031 15:24510363-24510385 ATACATAACCAGACAGGACTAGG - Intergenic
1124631177 15:31338572-31338594 CTGCCTACACAGCCACGGCTGGG - Intronic
1126257711 15:46647482-46647504 ATACACACACAGGCAGGTCTGGG - Intergenic
1127247453 15:57192681-57192703 TTAAAAGCACAGACAGGGCTGGG - Intronic
1127658811 15:61080897-61080919 CTACATAAAGAGACAAGGATGGG + Intronic
1127965784 15:63921844-63921866 CTTCAGACAGAGACAGGGATGGG + Intronic
1128776406 15:70323625-70323647 CTGCAGACAGAGGCAGGGCTTGG - Intergenic
1131817066 15:96233081-96233103 GTACATATACAGACAGAGCAAGG - Intergenic
1133147414 16:3799792-3799814 CCACAAATTCAGACAGGGCTTGG - Intronic
1133619128 16:7509383-7509405 ACACACACACACACAGGGCTTGG - Intronic
1134417050 16:14053219-14053241 ATACACACACACAGAGGGCTGGG - Intergenic
1134694414 16:16212603-16212625 CTAAATACACCGTCAGGGCTGGG - Intronic
1134896288 16:17889780-17889802 CAAGATGCACAGACAGAGCTTGG - Intergenic
1134977419 16:18582027-18582049 CTAAATACACCGTCAGGGCTGGG + Intergenic
1136730319 16:32405554-32405576 CGACATAAACATACAGAGCTGGG + Intergenic
1139359707 16:66389914-66389936 CTATATCCAGAGCCAGGGCTGGG + Intronic
1139874253 16:70132782-70132804 CTAAACACACACAAAGGGCTAGG - Intronic
1140251077 16:73294916-73294938 CAACATCCACAGCCACGGCTGGG + Intergenic
1202996082 16_KI270728v1_random:111753-111775 CGACATAAACATACAGAGCTGGG - Intergenic
1203022769 16_KI270728v1_random:424095-424117 CGACATAAACATACAGAGCTGGG - Intergenic
1142934632 17:3318104-3318126 CCACAGAGACAGCCAGGGCTAGG + Intergenic
1143092840 17:4459204-4459226 CTAAACTCACAGACAGGGCTGGG - Intronic
1144584797 17:16481707-16481729 GGACAAGCACAGACAGGGCTCGG - Intronic
1144734523 17:17547616-17547638 CCAGACACACAGGCAGGGCTGGG - Intronic
1145910691 17:28540398-28540420 CTTCCTACACAGCCAGGGCCAGG - Intronic
1150680018 17:67277078-67277100 CTACAAAGACAGACTGGGATGGG - Intergenic
1151522025 17:74637061-74637083 CTCCAAACACAGACAGGACTTGG + Intergenic
1151774902 17:76193907-76193929 CCACATCCACAGACAGCCCTGGG + Intronic
1152393442 17:80016780-80016802 GGAAATACACAAACAGGGCTGGG - Intronic
1152447126 17:80352146-80352168 ATAAATACACTGACTGGGCTGGG - Intronic
1152678830 17:81655387-81655409 CTCCAGACACAGAGAGGGCCTGG - Intronic
1158251987 18:55499501-55499523 CTACATAAACAGATGGAGCTAGG - Intronic
1159756135 18:72368722-72368744 CTACATATGCACACAGTGCTGGG - Intergenic
1162620074 19:11835900-11835922 CTCCACACACAGACAGGGTTTGG - Intergenic
1162624189 19:11871088-11871110 CTCCACACACAGACAGGGCTTGG - Intronic
1162629352 19:11914790-11914812 CTCCACACACAGACAGGGTTTGG - Intergenic
1162634046 19:11952648-11952670 CTCCACACACAGATAGGGTTTGG - Intronic
1162637413 19:11980861-11980883 CTCCACACACAGACAGGGTTTGG - Intergenic
1162699443 19:12502642-12502664 CTAAATACACAGATAGGTCCTGG - Intronic
1164527299 19:29021737-29021759 CTACAACCAGGGACAGGGCTGGG + Intergenic
1164671260 19:30073424-30073446 CCACATACACAGCCAGCCCTTGG - Intergenic
1164716601 19:30395405-30395427 CTACATCCACCAGCAGGGCTGGG - Intronic
1165080909 19:33305498-33305520 CTGGATCCGCAGACAGGGCTGGG + Intergenic
1165097730 19:33418770-33418792 CGACAAACACAGACAAAGCTAGG + Intronic
1165354790 19:35296968-35296990 CTACACACACACACACTGCTTGG + Intronic
1166185919 19:41138820-41138842 TTCCAAACACACACAGGGCTGGG + Intergenic
927284851 2:21346024-21346046 CTAGATACACAGAATGGGCCTGG + Intergenic
927637093 2:24824537-24824559 CTACAGACACAGACAAGGCGAGG + Intronic
929533292 2:42765254-42765276 CTCCATATGCAGACAGGCCTGGG + Intergenic
929934801 2:46286686-46286708 CTAGATACAGGAACAGGGCTAGG + Intergenic
934105859 2:88693864-88693886 CCACAGAAACAGACAGAGCTGGG - Intronic
934186625 2:89683605-89683627 CAACATAAACATACAGAGCTGGG + Intergenic
934315394 2:91913622-91913644 CAACATAAACATACAGAGCTGGG - Intergenic
934856672 2:97734181-97734203 CTGCATACGCAGACAGGGACGGG + Intronic
935439509 2:103075894-103075916 CCACCTACAAAAACAGGGCTAGG - Intergenic
936071177 2:109372326-109372348 CTACATACACACACAGCCCCAGG - Intronic
938114659 2:128594980-128595002 CAGCATACACAGCCAGGACTGGG + Intergenic
940459396 2:153943958-153943980 CTTCATAGACAGACACGTCTGGG - Intronic
940560142 2:155284693-155284715 CTACAAGCAGAGACATGGCTTGG + Intergenic
943551757 2:189349228-189349250 CTACATAAACATAAAGGGCAGGG + Intergenic
945278290 2:208010707-208010729 CAAGATACCCAGAAAGGGCTGGG + Intronic
946599890 2:221348249-221348271 GTACATTCAAAGACAAGGCTTGG - Intergenic
946643209 2:221806109-221806131 ATTAATACACATACAGGGCTTGG + Intergenic
1168896435 20:1326926-1326948 CTGCAAACACAGACAGGCATGGG - Intronic
1169887065 20:10411277-10411299 CTAAAAAAACAGAAAGGGCTGGG - Intronic
1171243090 20:23587181-23587203 CAACATACAAAGGCAGTGCTGGG - Intergenic
1171258922 20:23713803-23713825 CCAAATGCACAGAGAGGGCTGGG - Intergenic
1171267722 20:23785868-23785890 CCAAACACACAGAGAGGGCTGGG - Intergenic
1175512616 20:59542560-59542582 GAAAATACACAGTCAGGGCTGGG - Intergenic
1177906624 21:26979253-26979275 GTACATGCACTGACTGGGCTAGG - Intergenic
1179478879 21:41665419-41665441 CTGCAGGCTCAGACAGGGCTGGG + Intergenic
1180542164 22:16459506-16459528 CAACATAAACATACAGAGCTGGG - Intergenic
1181583986 22:23842902-23842924 CTACAGACACTGAGAGGGCCTGG - Intergenic
1181634514 22:24168370-24168392 CTACATACACAGACAGGGCTGGG + Intronic
1184430008 22:44437200-44437222 CTGCATGCACTGGCAGGGCTGGG + Intergenic
1185204693 22:49531114-49531136 CTCCATCCACAGGCAGGGGTGGG - Intronic
949387595 3:3520490-3520512 CTACAGACACAAACAAGCCTGGG - Intergenic
950447162 3:13045005-13045027 CCTCAGACACAGACAGGGCCAGG - Intronic
953106012 3:39879793-39879815 CCACACACACACACAGGTCTGGG + Intronic
953839063 3:46374014-46374036 TTTCATACACAGCCTGGGCTGGG + Exonic
954891295 3:53931764-53931786 ATACATAAACAAACAGGGCAGGG - Intergenic
960323138 3:116262512-116262534 CTAGAATCCCAGACAGGGCTTGG - Intronic
960644753 3:119867016-119867038 CATCATCCACAGACATGGCTGGG + Intronic
964311591 3:155399549-155399571 CCACAGACACAGAGAGGGGTGGG + Intronic
970048410 4:11882647-11882669 TTACATACAAACAGAGGGCTTGG - Intergenic
971863656 4:32141037-32141059 ACACATACACACACAGGACTGGG - Intergenic
972433491 4:39007750-39007772 ATAAATAGACAGAAAGGGCTGGG - Intronic
975613447 4:76223249-76223271 CTCCAAACACATACAGTGCTTGG + Intronic
976852359 4:89561910-89561932 CTACATTCCCAGACTGGTCTCGG + Intergenic
984652601 4:182286539-182286561 CTGCATCTACAGAAAGGGCTGGG - Intronic
985651591 5:1110156-1110178 CTACTTCCACAGAAAGGGCCCGG - Intronic
985975102 5:3413098-3413120 AGACATACACAGAGAGAGCTGGG - Intergenic
998177894 5:139913054-139913076 ATACATCCACAGACTGGGCTTGG - Intronic
999106343 5:149074697-149074719 CTACATACACACATATGGTTGGG - Intergenic
999380328 5:151117029-151117051 CTTCACTCACAGACAGGGCCCGG + Intronic
1001519498 5:172381100-172381122 CTTGATACACATACAGTGCTTGG + Intronic
1002630780 5:180575160-180575182 CTGCATGCACAGGCAGTGCTTGG - Exonic
1002914818 6:1520382-1520404 CCACATACACACACAGAGATGGG - Intergenic
1005806056 6:29475485-29475507 CTGCATACAAAGAAAGGGCCAGG + Intergenic
1006669435 6:35720425-35720447 CTCCTTGCACACACAGGGCTGGG + Exonic
1011981995 6:93390585-93390607 GTTTATACACATACAGGGCTGGG + Intronic
1012685331 6:102240630-102240652 CTATATACAGAGAGAGTGCTGGG - Intergenic
1012907539 6:105085493-105085515 TTATAGACACAGACAGGGGTAGG - Intergenic
1015386769 6:132633570-132633592 ATACATGCACTGACAGGGATGGG + Intergenic
1015503435 6:133956581-133956603 CAAAATACACACACAGGGCAGGG - Intronic
1016527364 6:145017283-145017305 GCACAGACACAGACAGGGCAAGG - Intergenic
1019305142 7:330686-330708 CTGCTCACACAGCCAGGGCTTGG + Intergenic
1023851012 7:44150402-44150424 CTACAGAGACAGAGAGGGCCAGG - Intronic
1023964555 7:44956219-44956241 CTACCTACACAGACAGAGAACGG + Intergenic
1024044883 7:45579594-45579616 CTGCCTACAGCGACAGGGCTAGG + Intronic
1025064476 7:55841437-55841459 TTAGATACACAGACAAGGCTGGG + Intronic
1026517111 7:71082491-71082513 ATACATACACAGACCAGGCAAGG + Intergenic
1028432880 7:90767854-90767876 CTACATTCACAGCAAGAGCTGGG - Intronic
1030583653 7:111390197-111390219 CGACATCCTCAGACAGGGCAGGG + Intronic
1032617459 7:133490032-133490054 CTTCACACACAGGCTGGGCTGGG - Intronic
1035399146 7:158553446-158553468 CTACACACACACACAGGCTTGGG + Intronic
1037426916 8:18766029-18766051 CTATTTACAAATACAGGGCTGGG + Intronic
1037523640 8:19703600-19703622 CTAAAAACAAAGAGAGGGCTGGG - Intronic
1037780498 8:21865192-21865214 CAACAGAAACAGACAGGGGTTGG + Intergenic
1038591109 8:28838806-28838828 TTACACAGACAGACCGGGCTTGG - Intronic
1042600991 8:70499448-70499470 CTACATAGACAGAGAGGGTGAGG - Intergenic
1043855524 8:85260947-85260969 CTACATACTCAGAGAGGCTTAGG + Intronic
1044426937 8:92062800-92062822 CTGCCTAAAGAGACAGGGCTGGG - Intronic
1044954796 8:97468768-97468790 GTACATACACAGAGAAAGCTAGG - Intergenic
1047013993 8:120702954-120702976 CTTAATACACACAAAGGGCTTGG + Intronic
1047364942 8:124203163-124203185 TTACAGACAGAGCCAGGGCTGGG - Intergenic
1048215073 8:132486685-132486707 CTACCTAAAAAGACAGGGCTGGG + Intergenic
1048951277 8:139498909-139498931 CTACACACACAGATGGGGCAAGG - Intergenic
1049185532 8:141250169-141250191 GTACATACGCAGACAGGTCCTGG + Intronic
1049760209 8:144328781-144328803 GTCCATACTCAGACAGGTCTGGG - Intergenic
1052735518 9:32338482-32338504 CTACACACATAGGCAGGGCCGGG + Intergenic
1053553552 9:39109563-39109585 CCACAGACACAGGCATGGCTGGG + Intronic
1053817664 9:41929710-41929732 CCACAGACACAGGCATGGCTGGG + Intronic
1054107918 9:61073382-61073404 CCACAGACACAGGCATGGCTGGG + Intergenic
1054612939 9:67257743-67257765 CCACAGACACAGGCATGGCTGGG - Intergenic
1055113449 9:72582923-72582945 ACAAATAAACAGACAGGGCTGGG + Intronic
1056761909 9:89421386-89421408 CAAAGTACACAGACAGGGCCCGG + Intronic
1060514856 9:124258973-124258995 CCACATACACAGGCAAGTCTAGG - Intronic
1060841445 9:126796270-126796292 CTACATTCCCAGAGAGGGTTGGG - Intergenic
1188344517 X:29047045-29047067 CTCCATACACCCACATGGCTTGG + Intronic
1191792098 X:64981872-64981894 CTGCTTACATAGACAGTGCTAGG + Intronic
1193184274 X:78493873-78493895 CTACATGCCCAGAAATGGCTGGG + Intergenic
1193668144 X:84349673-84349695 ACACACACACACACAGGGCTAGG - Intronic
1194142048 X:90219789-90219811 ATACATACAGAGTAAGGGCTTGG + Intergenic
1194291286 X:92074976-92074998 TTAGTTACAGAGACAGGGCTTGG - Intronic
1196282130 X:113834078-113834100 CTACATAGACTCACAGGACTCGG - Intergenic
1199942163 X:152637698-152637720 CTCCAGACACAGGCAGGGCGGGG - Intergenic
1200487803 Y:3788888-3788910 ATACATACAGAGTAAGGGCTTGG + Intergenic
1200608801 Y:5299561-5299583 TTAGTTACAGAGACAGGGCTTGG - Intronic
1201183059 Y:11368441-11368463 CAACATAAACATACAGAGCTGGG - Intergenic
1201694731 Y:16812239-16812261 CTACATACACAGGCAGGTGCAGG - Intergenic