ID: 1181637322

View in Genome Browser
Species Human (GRCh38)
Location 22:24180550-24180572
Sequence CACCTTGAGAAGCTGCAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181637310_1181637322 27 Left 1181637310 22:24180500-24180522 CCTGGGGCCACCTCTGACTCCCT No data
Right 1181637322 22:24180550-24180572 CACCTTGAGAAGCTGCAGCTGGG No data
1181637316_1181637322 8 Left 1181637316 22:24180519-24180541 CCCTGCAAGTGTGGCAAGGGTCC No data
Right 1181637322 22:24180550-24180572 CACCTTGAGAAGCTGCAGCTGGG No data
1181637311_1181637322 20 Left 1181637311 22:24180507-24180529 CCACCTCTGACTCCCTGCAAGTG No data
Right 1181637322 22:24180550-24180572 CACCTTGAGAAGCTGCAGCTGGG No data
1181637312_1181637322 17 Left 1181637312 22:24180510-24180532 CCTCTGACTCCCTGCAAGTGTGG No data
Right 1181637322 22:24180550-24180572 CACCTTGAGAAGCTGCAGCTGGG No data
1181637309_1181637322 28 Left 1181637309 22:24180499-24180521 CCCTGGGGCCACCTCTGACTCCC No data
Right 1181637322 22:24180550-24180572 CACCTTGAGAAGCTGCAGCTGGG No data
1181637317_1181637322 7 Left 1181637317 22:24180520-24180542 CCTGCAAGTGTGGCAAGGGTCCC No data
Right 1181637322 22:24180550-24180572 CACCTTGAGAAGCTGCAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181637322 Original CRISPR CACCTTGAGAAGCTGCAGCT GGG Intergenic
No off target data available for this crispr