ID: 1181639007

View in Genome Browser
Species Human (GRCh38)
Location 22:24187187-24187209
Sequence GAACATTCCTGGGCTCAAGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 172}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181639007_1181639020 2 Left 1181639007 22:24187187-24187209 CCCCCTTGAGCCCAGGAATGTTC 0: 1
1: 0
2: 0
3: 14
4: 172
Right 1181639020 22:24187212-24187234 GTCGGTGGCTGCCGGGGACAGGG 0: 1
1: 0
2: 1
3: 20
4: 191
1181639007_1181639022 17 Left 1181639007 22:24187187-24187209 CCCCCTTGAGCCCAGGAATGTTC 0: 1
1: 0
2: 0
3: 14
4: 172
Right 1181639022 22:24187227-24187249 GGACAGGGTCTCCATCATGCTGG 0: 1
1: 0
2: 5
3: 38
4: 288
1181639007_1181639017 -4 Left 1181639007 22:24187187-24187209 CCCCCTTGAGCCCAGGAATGTTC 0: 1
1: 0
2: 0
3: 14
4: 172
Right 1181639017 22:24187206-24187228 GTTCCTGTCGGTGGCTGCCGGGG 0: 1
1: 0
2: 0
3: 8
4: 98
1181639007_1181639015 -6 Left 1181639007 22:24187187-24187209 CCCCCTTGAGCCCAGGAATGTTC 0: 1
1: 0
2: 0
3: 14
4: 172
Right 1181639015 22:24187204-24187226 ATGTTCCTGTCGGTGGCTGCCGG 0: 1
1: 0
2: 1
3: 12
4: 107
1181639007_1181639024 25 Left 1181639007 22:24187187-24187209 CCCCCTTGAGCCCAGGAATGTTC 0: 1
1: 0
2: 0
3: 14
4: 172
Right 1181639024 22:24187235-24187257 TCTCCATCATGCTGGCATCAGGG 0: 1
1: 0
2: 0
3: 27
4: 206
1181639007_1181639023 24 Left 1181639007 22:24187187-24187209 CCCCCTTGAGCCCAGGAATGTTC 0: 1
1: 0
2: 0
3: 14
4: 172
Right 1181639023 22:24187234-24187256 GTCTCCATCATGCTGGCATCAGG 0: 1
1: 0
2: 2
3: 13
4: 177
1181639007_1181639025 26 Left 1181639007 22:24187187-24187209 CCCCCTTGAGCCCAGGAATGTTC 0: 1
1: 0
2: 0
3: 14
4: 172
Right 1181639025 22:24187236-24187258 CTCCATCATGCTGGCATCAGGGG 0: 1
1: 0
2: 0
3: 8
4: 200
1181639007_1181639027 30 Left 1181639007 22:24187187-24187209 CCCCCTTGAGCCCAGGAATGTTC 0: 1
1: 0
2: 0
3: 14
4: 172
Right 1181639027 22:24187240-24187262 ATCATGCTGGCATCAGGGGCCGG 0: 1
1: 0
2: 1
3: 29
4: 239
1181639007_1181639016 -5 Left 1181639007 22:24187187-24187209 CCCCCTTGAGCCCAGGAATGTTC 0: 1
1: 0
2: 0
3: 14
4: 172
Right 1181639016 22:24187205-24187227 TGTTCCTGTCGGTGGCTGCCGGG 0: 1
1: 0
2: 1
3: 18
4: 158
1181639007_1181639019 1 Left 1181639007 22:24187187-24187209 CCCCCTTGAGCCCAGGAATGTTC 0: 1
1: 0
2: 0
3: 14
4: 172
Right 1181639019 22:24187211-24187233 TGTCGGTGGCTGCCGGGGACAGG 0: 1
1: 0
2: 0
3: 20
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181639007 Original CRISPR GAACATTCCTGGGCTCAAGG GGG (reversed) Exonic
900682166 1:3923063-3923085 TGGCATTCCTGGGCTCACGGAGG - Intergenic
900934030 1:5754131-5754153 GAATCTTCCTGTGCTCACGGAGG + Intergenic
902188116 1:14740706-14740728 GGCCATTCCTGGGATCAAGAGGG + Intronic
902868427 1:19296626-19296648 GAACATGCCTAGCCTCCAGGGGG + Intergenic
903739567 1:25550843-25550865 GAACATTTCAGGGGTCAGGGAGG + Intronic
903760605 1:25695513-25695535 GAACATTCCTGGGGCCCAAGGGG + Intronic
904529598 1:31159600-31159622 TTGAATTCCTGGGCTCAAGGAGG - Intergenic
905601353 1:39254571-39254593 GAACATTCTTCCTCTCAAGGAGG - Intronic
908362013 1:63377959-63377981 TCAAACTCCTGGGCTCAAGGGGG + Intronic
914353046 1:146856738-146856760 AAACATTTCTGGGCTGAAGCGGG - Intergenic
914801667 1:150966958-150966980 TGACATTCCTGGGACCAAGGAGG - Intronic
919067108 1:192706399-192706421 GAAGAGGCCTGCGCTCAAGGTGG + Intergenic
920340853 1:205274364-205274386 CCACATTCCTGGGCCCCAGGTGG + Intergenic
920568159 1:206992883-206992905 AGACATTCCAGGGCTCCAGGAGG - Intergenic
922169029 1:223139636-223139658 GTAGATTTGTGGGCTCAAGGTGG + Intronic
923048406 1:230372478-230372500 GAACATTCGTGGGATGATGGCGG - Intronic
923941318 1:238830819-238830841 TAACATTCCTGTGATCATGGGGG + Intergenic
924130875 1:240906742-240906764 AAACATTTCTTGGCTCAAAGAGG + Intronic
1062890634 10:1057036-1057058 GGACACTGCAGGGCTCAAGGGGG + Intronic
1063107013 10:3001097-3001119 GAACATACGTGTGCCCAAGGTGG + Intergenic
1063947968 10:11195818-11195840 CAATATTCCTGGCCTCAAGTGGG - Intronic
1064368622 10:14730762-14730784 GAACATTCCTGGGCAAACTGGGG - Intronic
1064887398 10:20125104-20125126 GGACATTACTGGGATCAAGCTGG - Intronic
1068157717 10:53222925-53222947 GGCCATCCCTGGGCTAAAGGTGG + Intergenic
1068520349 10:58070686-58070708 GAACTCTCCTGAGCTCAATGGGG - Intergenic
1068919243 10:62465447-62465469 GAGCATTCCTGGCTTGAAGGTGG - Intronic
1069303716 10:66941476-66941498 GAAGATTCCTGCGTTCAAAGTGG - Intronic
1069669894 10:70193423-70193445 GACCATGCCTGACCTCAAGGTGG - Intergenic
1070380906 10:75879405-75879427 GCAGATTCCAGGGCTCAAGGCGG - Intronic
1073420909 10:103423012-103423034 GAACATTCCTGGGGTCATCTCGG - Exonic
1074288404 10:112120019-112120041 GAAACCTCCTGGGCTCATGGTGG - Intergenic
1077472266 11:2769595-2769617 GGACATTCCTCGGATGAAGGCGG + Intronic
1078133186 11:8630315-8630337 GAACAATCCTGGGGTCTAGAGGG - Intronic
1080596609 11:33778778-33778800 GAATATTCCTGGGCTCCACAGGG - Intergenic
1083139569 11:60710859-60710881 GAACATTCCAGGCCCAAAGGTGG - Intronic
1083183957 11:61007000-61007022 GTACAATCCTGGGCTAAAAGGGG + Intronic
1083319075 11:61834355-61834377 GCAAAGTCCTGGGCTCCAGGTGG - Intronic
1084206848 11:67599938-67599960 GAACATTCCAGGGATTAAGAGGG + Intergenic
1085507752 11:77069827-77069849 AAACTTTCCTGGGCTCACCGTGG + Intronic
1085897954 11:80662430-80662452 GAACTTTCCTGGGCTAAAGCAGG + Intergenic
1087536283 11:99450371-99450393 GAACATTACTGGGCATAATGAGG - Intronic
1088738827 11:112750319-112750341 GAAGATTCCTGAACTCAAGGTGG + Intergenic
1089919300 11:122193268-122193290 TAAGATTCCTGTTCTCAAGGTGG - Intergenic
1092272064 12:7031237-7031259 GGACATCCCTGGCCTGAAGGTGG + Intronic
1092684042 12:11020823-11020845 GGAAATTCAGGGGCTCAAGGTGG + Intronic
1094863903 12:34505347-34505369 GGACATTTCTGAGCTCAATGAGG - Intergenic
1100083326 12:90878393-90878415 GTACATGACAGGGCTCAAGGAGG + Intergenic
1101280291 12:103247558-103247580 GAATATTCCTGGGCACTAGAGGG - Intronic
1108928051 13:55777799-55777821 GAGCATTCTTGGGCACCAGGCGG - Intergenic
1111485694 13:88895861-88895883 GACCATCCCTGGTCTGAAGGTGG - Intergenic
1114260203 14:21031114-21031136 GAACATTTATGGACTCATGGAGG + Exonic
1114415814 14:22543304-22543326 GAAAATACCTGGGTTCAAGTTGG - Intergenic
1120118894 14:80654071-80654093 GAACATTCATGGGCAGTAGGAGG + Intronic
1120312013 14:82841050-82841072 GGACATTCTTGGGATAAAGGTGG - Intergenic
1125134661 15:36327755-36327777 TCAAATTCCTGGGCTCAAGCAGG + Intergenic
1125961217 15:43831357-43831379 TAAAACTCCTGGGCTCAAGCAGG + Intronic
1126744051 15:51807292-51807314 GTACAGTGCTGGCCTCAAGGAGG + Intronic
1127496258 15:59515156-59515178 TGACCTTCCTGGGCTCAAGGTGG - Intronic
1129597046 15:76973492-76973514 CCACCTTCCTGGGCTCTAGGAGG + Intergenic
1129972041 15:79787307-79787329 GAGCATTCCTGTTCTCCAGGGGG + Intergenic
1130119686 15:81037122-81037144 GAATATTCCTGTGTTCTAGGAGG - Intronic
1132250426 15:100331837-100331859 GCACATTCTTGGGCTCCAGCAGG - Intronic
1132382277 15:101374529-101374551 GAACATTCATGGGCCCAGTGAGG - Intronic
1132415513 15:101616022-101616044 GAGCCTTCCTGGGCTCAGGGAGG - Intergenic
1132671737 16:1104750-1104772 GAATGTGCCTGGACTCAAGGGGG + Intergenic
1136777821 16:32881091-32881113 GAACATACCTGCCCGCAAGGGGG - Intergenic
1136892802 16:33980423-33980445 GAACATACCTGCCCGCAAGGGGG + Intergenic
1137046792 16:35672105-35672127 GAACATTCCTGAGCCCATTGAGG + Intergenic
1137917477 16:52448546-52448568 TACCATTCCTGGGCCCAATGGGG + Intronic
1139980980 16:70858780-70858802 AAACATTTCTGGGCTGAAGTGGG + Intronic
1140555226 16:75914185-75914207 TAAAATTGCTGGGCTAAAGGGGG - Intergenic
1141348076 16:83266849-83266871 CACCATTCCTGGTCTCAAGTCGG + Intronic
1142191681 16:88721039-88721061 GCACCTTCCTGGGATCCAGGTGG + Intronic
1203080236 16_KI270728v1_random:1143200-1143222 GAACATACCTGCCCGCAAGGGGG - Intergenic
1143141258 17:4743021-4743043 TCAAATTCCTGGGCTCAAGTTGG - Intronic
1143379547 17:6487501-6487523 GAGCATGCCAGGGCTCAGGGAGG - Intronic
1144878221 17:18414029-18414051 TAACATTCCTGGGTTCCAGCTGG - Intergenic
1145154008 17:20530379-20530401 TAACATTCCTGGGTTCCAGCTGG + Intergenic
1155001196 18:21688553-21688575 TAAGGTTCCTGGCCTCAAGGAGG + Intronic
1155145576 18:23080710-23080732 GTACTTTGGTGGGCTCAAGGTGG - Intergenic
1155956106 18:31958291-31958313 TAAAACTCCTGGGCTCAAGCAGG - Intergenic
1157157231 18:45280193-45280215 GAACCTTCCTGACCTCAATGGGG + Intronic
1159257115 18:65961128-65961150 GAACAATGCTGGGGTAAAGGAGG + Intergenic
1159561653 18:70001602-70001624 GCAGATTCCTGGGCTCAATGAGG - Intergenic
1159948220 18:74459016-74459038 TCAAATTCCTGGGCTCAAGCAGG - Intergenic
1161251595 19:3283568-3283590 TCAAATTCCTGGGCTCAAGCAGG + Intronic
1163895044 19:20051440-20051462 GATCATTCCTGGGCAAAATGTGG - Intergenic
1164378861 19:27714422-27714444 GAACATTTCTGAGCTCATTGAGG - Intergenic
1166314540 19:41981718-41981740 CAACATCCCTGTGCTCAAGGTGG - Exonic
1167775766 19:51553578-51553600 AAACATTCCTGGGGTAAAGAAGG - Intergenic
1167821767 19:51934852-51934874 TAACATTCCTGGGCAGGAGGTGG - Intronic
925143051 2:1563256-1563278 GAACATTCGTGGCATCCAGGAGG - Intergenic
926578936 2:14613657-14613679 GAACATTGCAGGGCTGAAGCAGG - Intergenic
932595355 2:73089797-73089819 GTTCTTTCCTGGGCTCACGGTGG - Intronic
935152578 2:100450883-100450905 CATAATTCCTGAGCTCAAGGAGG - Intergenic
935367980 2:102314842-102314864 GATAGTTCCTGGGCTCCAGGGGG + Intronic
936051608 2:109228213-109228235 GCACATTCCTGGGGACTAGGAGG - Intronic
936501933 2:113073417-113073439 GAGCAGTCCTGGTCTCAAGGAGG + Intronic
936885731 2:117308652-117308674 GTACAGTTCTGGGCTCAATGGGG - Intergenic
936932304 2:117802703-117802725 TAACATTCCTGTCCTCAAGTAGG + Intergenic
937340453 2:121087587-121087609 GAACATCCCTAAGCCCAAGGAGG + Intergenic
943719844 2:191192257-191192279 GAACATTCAATGGCGCAAGGTGG + Intergenic
946510456 2:220350059-220350081 GAACATTCCTGGTCAAAAGAGGG + Intergenic
1172214858 20:33227967-33227989 GAATACTCCTGGGCTCCAAGAGG + Intergenic
1172790674 20:37503296-37503318 GACCAGTCCAGGGCTCCAGGGGG - Intronic
1173019097 20:39252427-39252449 GAATAAACCTGGGCTCAAGGAGG + Intergenic
1173798180 20:45877305-45877327 GCACTTTGCTGTGCTCAAGGCGG + Exonic
1174671558 20:52312807-52312829 GCAACCTCCTGGGCTCAAGGGGG + Intergenic
1175941639 20:62540041-62540063 CCCCATTCCTGGGCCCAAGGAGG - Intergenic
1178558808 21:33618441-33618463 CAACAATGCTGGGCACAAGGAGG - Intronic
1178684415 21:34700075-34700097 GAACATACCTGGCCCCCAGGTGG + Intronic
1179971657 21:44839173-44839195 GGACTTTCCTGGGCTCCAAGAGG - Intergenic
1180687062 22:17677509-17677531 TCAAATTCCTGGGCTCAAGCAGG - Intronic
1180953200 22:19730043-19730065 GGACAATGCTGGGATCAAGGTGG - Intergenic
1181109283 22:20591837-20591859 GCACCTGCCTGGGCTCAGGGAGG - Intergenic
1181639007 22:24187187-24187209 GAACATTCCTGGGCTCAAGGGGG - Exonic
1184132103 22:42522991-42523013 GAATATGGCTGGGCTCAAGTGGG + Intergenic
1184685975 22:46096538-46096560 CAACACTCCTGGCCTCAAGTTGG - Intronic
1184885956 22:47344663-47344685 GAGCATCCCTGGGCACAAGCTGG - Intergenic
950087059 3:10266782-10266804 GAACATTTCTAGGCTAAAGATGG - Intronic
951736706 3:25874158-25874180 GAACACTCCTGGGCTCTGGCTGG + Intergenic
952356018 3:32584768-32584790 GAACATTGCTGTTATCAAGGAGG + Intergenic
953741267 3:45541259-45541281 GAGCTTTCCTTGGCTCAGGGTGG - Intronic
953944277 3:47132591-47132613 GAATATTCCTGTCCTCAAGGTGG + Intronic
958636212 3:96750423-96750445 GCAGATTCCTGGGCAGAAGGGGG + Intergenic
960012321 3:112847735-112847757 GTACATTCCAGGGTTCAAGGTGG + Intergenic
963733148 3:148991721-148991743 GAACACTCCGGGGCTGAGGGCGG - Intronic
964770626 3:160221238-160221260 GAACTTTCCTGGTCTCCAAGGGG + Intergenic
964791839 3:160460321-160460343 ACAGATTCCTGGGCTGAAGGGGG - Intronic
966632640 3:182095478-182095500 GAGAATACCTGGGCTCAGGGAGG - Intergenic
968456649 4:703933-703955 GAACAGTCCTGGGCTGAGTGTGG - Intergenic
969313785 4:6369694-6369716 GAAGCTCCCTGGGCTCGAGGAGG - Intronic
969415095 4:7052879-7052901 GGAGATTCCTGGGCCCCAGGTGG + Intronic
972264280 4:37444106-37444128 GTACATTGCAAGGCTCAAGGAGG + Exonic
972637570 4:40897782-40897804 GAACCTTCCTGGCCACACGGGGG - Intronic
979962481 4:127037044-127037066 GAACAATTCTGGGCTCTTGGTGG + Intergenic
982657159 4:158164045-158164067 GAACCTTCCCAAGCTCAAGGAGG - Intronic
982764814 4:159333691-159333713 AAACATTCCTAGACTCAAGAAGG - Intronic
982957693 4:161792440-161792462 GGCCATTCCTGGGTTGAAGGTGG - Intronic
984435525 4:179705633-179705655 AAACATTCCTAGATTCAAGGGGG - Intergenic
991128689 5:63096148-63096170 TAACATTTCTGGGGTCAAAGAGG + Intergenic
992687980 5:79216623-79216645 GTGCATGCCTGGGCCCAAGGAGG + Intronic
992890555 5:81200183-81200205 TCAAATTCCTGGGCTCAAGGGGG - Intronic
999926436 5:156383697-156383719 GAACATACATGGGCTCAAAATGG + Intronic
1001020007 5:168174777-168174799 GTACATTCCTGGGTTCACTGAGG + Intronic
1003007816 6:2398062-2398084 GGACAGTCCTGAGCTCAAGCAGG + Intergenic
1003681902 6:8265266-8265288 GAACATTCCTGGTTACAAGAAGG + Intergenic
1005439193 6:25847115-25847137 GAGCATTCATGGACACAAGGAGG - Intronic
1007144094 6:39609851-39609873 GCACATTCCTGGGCTCCACATGG + Intronic
1008285849 6:49649126-49649148 GCACATCCCTGGGCTAAAGAAGG - Intergenic
1013420421 6:109961969-109961991 AAAGCTTCCTGGGCTCCAGGGGG - Intergenic
1013547391 6:111171567-111171589 AAAAATTTCTGGGCTCAAGGTGG + Intronic
1018494176 6:164331533-164331555 TAACATTCCCCGGCTCAAAGTGG + Intergenic
1019191129 6:170251585-170251607 GAATGTTCCTGGGCTCAAGCAGG - Intergenic
1021630211 7:22637602-22637624 TCAAACTCCTGGGCTCAAGGGGG + Intergenic
1022045342 7:26618133-26618155 GCTCATGCCTGGGGTCAAGGAGG + Intergenic
1022380660 7:29856541-29856563 AAGCAATCCTGGGCTCAAGCTGG - Intronic
1022719299 7:32928444-32928466 GAACATGCCTTGGCTCTAAGAGG + Intergenic
1022953949 7:35364359-35364381 GAACATCCCAGGGTTCAAAGGGG + Intergenic
1023962402 7:44937823-44937845 CAACATTGCTGGGCCCCAGGTGG + Intergenic
1034337337 7:150332054-150332076 TAGCTTTCCTGGGCTCCAGGCGG + Exonic
1035327167 7:158072662-158072684 GAACTTTCCTGGGCTCACCAAGG + Intronic
1037284606 8:17284982-17285004 GAACAGTCCTGGTCAGAAGGGGG + Intronic
1040391059 8:46950849-46950871 TCAAACTCCTGGGCTCAAGGGGG - Intergenic
1042200789 8:66278059-66278081 GACCCAGCCTGGGCTCAAGGAGG - Intergenic
1045187249 8:99851658-99851680 CAACATGCCTGGCATCAAGGAGG + Intronic
1045743430 8:105388107-105388129 GAATACTCCTGCCCTCAAGGTGG + Intronic
1047384623 8:124397295-124397317 TACCAACCCTGGGCTCAAGGAGG + Intergenic
1048977375 8:139680471-139680493 GCACAGTCCTGGGCTGGAGGAGG + Intronic
1049278474 8:141731847-141731869 GAGCTTGCCAGGGCTCAAGGAGG + Intergenic
1054905486 9:70411254-70411276 GAAAATGCCTTTGCTCAAGGTGG + Intronic
1055425639 9:76193242-76193264 GAAGAGTCCTGGGCGGAAGGAGG + Intronic
1056350363 9:85742461-85742483 GACCTTTCCTGACCTCAAGGAGG + Intergenic
1056598881 9:88030450-88030472 GCACAATCATGGGATCAAGGAGG - Intergenic
1057015433 9:91646986-91647008 GTATAGTCTTGGGCTCAAGGTGG + Intronic
1061802983 9:133122129-133122151 GGACATCCCTGGTCTCAGGGTGG + Intronic
1062058049 9:134479028-134479050 GAACCTACCTTGGCTCAAGTGGG - Intergenic
1185488453 X:500450-500472 GAACAGTCCTGGGCAGGAGGAGG - Intergenic
1187018509 X:15354741-15354763 GAAGATTCCTGGGGTCATTGGGG - Intronic
1187995506 X:24922157-24922179 TCAAATTCCTGGACTCAAGGAGG + Intronic
1188896363 X:35673501-35673523 GTACAATCAGGGGCTCAAGGAGG - Intergenic
1189852657 X:45192694-45192716 GAAGCTACCTGGGCTCCAGGAGG + Intronic
1190438593 X:50453168-50453190 GATCATTTCTAGGCTCAAAGAGG + Intronic
1190830432 X:54054393-54054415 AAACATGCCTGGGCACAAAGAGG - Intergenic
1199670925 X:150147609-150147631 GAATATTCCTGTGCTCAGGTGGG - Intergenic
1200102016 X:153692946-153692968 GAACATACCTGCCCGCAAGGGGG + Intronic
1202079673 Y:21071457-21071479 GATCATTCCTGGCTTGAAGGTGG - Intergenic