ID: 1181639497

View in Genome Browser
Species Human (GRCh38)
Location 22:24189244-24189266
Sequence ATGGAGAGAGAGCCTGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 982
Summary {0: 1, 1: 1, 2: 5, 3: 84, 4: 891}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181639497_1181639513 24 Left 1181639497 22:24189244-24189266 CCCTCCCCAGGCTCTCTCTCCAT 0: 1
1: 1
2: 5
3: 84
4: 891
Right 1181639513 22:24189291-24189313 GGCCGCCTCGTGGGGTGGGGAGG 0: 1
1: 1
2: 2
3: 30
4: 354
1181639497_1181639512 21 Left 1181639497 22:24189244-24189266 CCCTCCCCAGGCTCTCTCTCCAT 0: 1
1: 1
2: 5
3: 84
4: 891
Right 1181639512 22:24189288-24189310 TGTGGCCGCCTCGTGGGGTGGGG 0: 1
1: 0
2: 0
3: 12
4: 165
1181639497_1181639504 -7 Left 1181639497 22:24189244-24189266 CCCTCCCCAGGCTCTCTCTCCAT 0: 1
1: 1
2: 5
3: 84
4: 891
Right 1181639504 22:24189260-24189282 TCTCCATGTATGCAGTGGGATGG 0: 1
1: 0
2: 0
3: 15
4: 164
1181639497_1181639508 15 Left 1181639497 22:24189244-24189266 CCCTCCCCAGGCTCTCTCTCCAT 0: 1
1: 1
2: 5
3: 84
4: 891
Right 1181639508 22:24189282-24189304 GAGAACTGTGGCCGCCTCGTGGG 0: 1
1: 0
2: 0
3: 4
4: 58
1181639497_1181639510 19 Left 1181639497 22:24189244-24189266 CCCTCCCCAGGCTCTCTCTCCAT 0: 1
1: 1
2: 5
3: 84
4: 891
Right 1181639510 22:24189286-24189308 ACTGTGGCCGCCTCGTGGGGTGG 0: 1
1: 0
2: 0
3: 2
4: 124
1181639497_1181639507 14 Left 1181639497 22:24189244-24189266 CCCTCCCCAGGCTCTCTCTCCAT 0: 1
1: 1
2: 5
3: 84
4: 891
Right 1181639507 22:24189281-24189303 GGAGAACTGTGGCCGCCTCGTGG 0: 1
1: 0
2: 0
3: 7
4: 86
1181639497_1181639509 16 Left 1181639497 22:24189244-24189266 CCCTCCCCAGGCTCTCTCTCCAT 0: 1
1: 1
2: 5
3: 84
4: 891
Right 1181639509 22:24189283-24189305 AGAACTGTGGCCGCCTCGTGGGG 0: 1
1: 0
2: 0
3: 2
4: 57
1181639497_1181639506 3 Left 1181639497 22:24189244-24189266 CCCTCCCCAGGCTCTCTCTCCAT 0: 1
1: 1
2: 5
3: 84
4: 891
Right 1181639506 22:24189270-24189292 TGCAGTGGGATGGAGAACTGTGG 0: 1
1: 0
2: 1
3: 33
4: 364
1181639497_1181639511 20 Left 1181639497 22:24189244-24189266 CCCTCCCCAGGCTCTCTCTCCAT 0: 1
1: 1
2: 5
3: 84
4: 891
Right 1181639511 22:24189287-24189309 CTGTGGCCGCCTCGTGGGGTGGG 0: 1
1: 0
2: 0
3: 14
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181639497 Original CRISPR ATGGAGAGAGAGCCTGGGGA GGG (reversed) Intergenic
900332027 1:2140053-2140075 ATAGAGAGTGAGGGTGGGGAAGG + Intronic
900725813 1:4215868-4215890 GTGGAGAGAGAGGCAGGGGGAGG - Intergenic
900725841 1:4215980-4216002 GTGGAGAGAGAGGCAGGGGGTGG - Intergenic
900725878 1:4216136-4216158 GTGGAGAGAGAGGCAGGGGGAGG - Intergenic
900777352 1:4594835-4594857 ACTGAGAGAGAGCCTGGGCCCGG - Intergenic
900899990 1:5509763-5509785 AGGGAGAGACAACTTGGGGACGG + Intergenic
900950274 1:5854686-5854708 GTGGTTAGAGAGCCTGGGGGAGG - Intergenic
901139014 1:7016011-7016033 TTGGAGGAAGAGCCTGGGGGAGG - Intronic
901145455 1:7061749-7061771 GTGGAGAGAGAGGCTGGAGTAGG + Intronic
901165252 1:7216260-7216282 TTGGAGGAAGAGCCTGGGGGAGG - Intronic
901459787 1:9384596-9384618 AAGGGGAGAGAGCGAGGGGAAGG - Intergenic
901762115 1:11478474-11478496 AAGGAGAAAGAGCCTGGGGGAGG - Intergenic
901779626 1:11585104-11585126 GTGGAGAGGGAGCATGGAGAAGG + Intergenic
901920941 1:12537204-12537226 AAGGAGAGAGTGGCTGGGCACGG - Intergenic
902069304 1:13720344-13720366 ATGGAGAGAAGGGCTGGGTAGGG + Intronic
902360050 1:15937430-15937452 ATGGAGACAGACACAGGGGAGGG - Exonic
902441555 1:16433437-16433459 AATGAGAAAGAGGCTGGGGAGGG - Intronic
902480215 1:16707743-16707765 GGGGAGAGAGGGCCGGGGGATGG + Intergenic
902483354 1:16724478-16724500 ATAGAGAGAGAGAGGGGGGAAGG + Intergenic
902511044 1:16967351-16967373 ATAGAGGGACAGGCTGGGGAGGG - Intronic
902729071 1:18356923-18356945 ATGGAGATTGAGGATGGGGAGGG + Intronic
902776172 1:18676388-18676410 CTGGGGAGAGAGGGTGGGGAGGG + Intronic
903220968 1:21869567-21869589 GAGGAGAGAGCCCCTGGGGAGGG + Intronic
903225773 1:21893516-21893538 GTGGGGAGAGAGGATGGGGAGGG + Intronic
903249385 1:22041533-22041555 ATTGGGAGAGGGCCTGAGGAAGG - Intergenic
903328726 1:22586145-22586167 CTGGAGACAGGGCCTGGGGGAGG + Intronic
903390833 1:22962704-22962726 GTGGTGAGGGACCCTGGGGATGG - Intronic
903442377 1:23397772-23397794 ACGGTGAGAGAGCCTGGGCTAGG - Exonic
903984490 1:27215993-27216015 AGGGAGAGAGAGTCAGGGAAGGG - Intergenic
904285229 1:29449660-29449682 ATGGAGTGAGGGGCTGTGGATGG + Intergenic
904366165 1:30012142-30012164 ATGGAGAGGGTGCCTGGGGGCGG - Intergenic
904373587 1:30066115-30066137 GTGGAGGGAGGGCTTGGGGAGGG - Intergenic
904373661 1:30066309-30066331 GTGGAGGGAGGGCTTGGGGAGGG - Intergenic
904379448 1:30101239-30101261 AAGGAGGAAGGGCCTGGGGAGGG + Intergenic
904750188 1:32737144-32737166 AGGGACAGACAGCCTTGGGATGG - Intergenic
904819228 1:33229826-33229848 ATGGACAGAGAGCAGAGGGAGGG - Intergenic
904870845 1:33617131-33617153 AGGGAGAGAGAATTTGGGGAAGG + Intronic
905337252 1:37253506-37253528 AGGGTGAGGGAGCCTGGAGAAGG - Intergenic
905789159 1:40781300-40781322 GTGGAGACAGGGCCTGGGGGTGG + Intergenic
905792573 1:40798028-40798050 ATGGAGGGACACCCTGGCGAAGG + Intronic
906031485 1:42723797-42723819 TTGGAGAGAAAGCCGGGGGCGGG + Intergenic
906070578 1:43013507-43013529 ATGGTGACAAAGCCTGGGGATGG + Intergenic
906127412 1:43435733-43435755 ATAGGGAAAGAGCCAGGGGAGGG + Intronic
906714258 1:47955291-47955313 AAGGAGAAAGGGACTGGGGAAGG - Intronic
907336342 1:53702237-53702259 CTGGAGAGGCAGCCTGGTGAGGG - Intronic
907351782 1:53838077-53838099 GTGGAGAGAACGCGTGGGGAAGG - Intronic
907629842 1:56069478-56069500 ATGGAGGGTGAGTGTGGGGAAGG + Intergenic
907964928 1:59319757-59319779 AGGCAGAGGGAGCCTGTGGAGGG + Intronic
908260743 1:62337843-62337865 AGGGAGGGAGAGCCTGGGGCAGG + Intergenic
908348182 1:63257542-63257564 CAGGAGAGAGAGACTGGGGAGGG - Intergenic
909076802 1:71058799-71058821 AGGGAGAGGGATACTGGGGAAGG + Intergenic
909562868 1:77024985-77025007 ACAGAGAGAGAGCCTGGAGCGGG - Intronic
909840305 1:80312782-80312804 ATGCAGAGAGGGCCAGGTGATGG - Intergenic
909977648 1:82064189-82064211 CTTGAGAGAGAGCCTGAGAAAGG + Intergenic
910015681 1:82520393-82520415 CTGGAGAGAAAGGCTGTGGAGGG + Intergenic
910512311 1:88021155-88021177 AGAGAGAGAGAGGGTGGGGAAGG + Intergenic
911585354 1:99683997-99684019 ATATAGAGAAAGCCTGAGGAGGG - Intronic
912157335 1:106937911-106937933 ATGGAGAGAAAGACTGAGGATGG - Intergenic
912886410 1:113479223-113479245 ATGGAGAGTGAGCCAAAGGAGGG - Intronic
913572586 1:120135873-120135895 AGGGTTAGAGATCCTGGGGATGG - Intergenic
914293430 1:146296787-146296809 AGGGTTAGAGATCCTGGGGATGG - Intergenic
914348721 1:146821519-146821541 GTGGAGGGAGAGACTGGAGATGG + Intergenic
914554474 1:148747570-148747592 AGGGTTAGAGATCCTGGGGATGG - Intergenic
914792401 1:150889849-150889871 ATGGATTCAGTGCCTGGGGAGGG - Intergenic
914901461 1:151713385-151713407 GATGAGAGACAGCCTGGGGATGG - Intronic
914923520 1:151863945-151863967 GTGGAGACAGATCCTGGAGAAGG - Intergenic
914988742 1:152480520-152480542 ATGGAGAGAGAGACTGGGAAAGG - Intergenic
914988890 1:152481406-152481428 AGGGAAAAAGAGCCTGGGGAAGG + Intergenic
915321142 1:155057117-155057139 ATGGAGAGAGGGTGTGGGGCAGG + Intronic
915552076 1:156641217-156641239 AAGCAAAGAGAGCCTGGGAAAGG + Intergenic
915564689 1:156706877-156706899 TGGGAGGGAGAGTCTGGGGAGGG - Intergenic
915914203 1:159931422-159931444 CTGGAGAGAGGGCCAGGGGCTGG - Intronic
916166380 1:161970300-161970322 AGGGAGAGGGAGCCGGGAGAAGG + Intergenic
916192087 1:162189755-162189777 ACGGAGAGTGATTCTGGGGAAGG + Intronic
916839221 1:168583073-168583095 GTGGAGTGAGTTCCTGGGGAAGG - Intergenic
916985964 1:170191689-170191711 TGGGATAGAGTGCCTGGGGATGG - Intergenic
917695603 1:177520088-177520110 AAGCAGAATGAGCCTGGGGAAGG + Intergenic
918283582 1:183029615-183029637 AGAGAGAGAGAAACTGGGGAAGG - Intronic
918658671 1:187062047-187062069 ATGGAGATAGAGACAGGGAAAGG - Intergenic
919747070 1:201015479-201015501 CTGGTGAGACAGCCTAGGGAGGG + Intronic
919943543 1:202304417-202304439 ATGGAGGGAGAGACAGGGCAGGG - Intronic
919944163 1:202307672-202307694 GTGGATAGAGAGGATGGGGATGG - Intronic
920221856 1:204410216-204410238 ATGGAAAAGGAGCCTGGAGAGGG - Exonic
920246039 1:204588560-204588582 AAGGAAAGAGAGGCTGGGGCAGG - Intergenic
920253830 1:204640624-204640646 ATGGAAAGCAAGCATGGGGAAGG - Intronic
920254920 1:204648262-204648284 AGTGAGAGAGGGCCTGGGCAGGG + Intronic
920916725 1:210263679-210263701 GTGGAGAAAGAGCCTTGGCAGGG + Intergenic
921131838 1:212226396-212226418 ATGGAGAGAGGAAGTGGGGAAGG - Intergenic
921221714 1:212978371-212978393 ATGGGGAGAAAGACTGGGGAAGG + Intronic
922187288 1:223286746-223286768 ATCGAGTGAGTGCCTGGGGCTGG + Intronic
922196259 1:223363240-223363262 GTGGTGGGAGGGCCTGGGGATGG - Intronic
922349154 1:224721783-224721805 ATGAAGAGGGGGCCTGTGGAAGG + Intronic
922463890 1:225833503-225833525 AAAGAGAGAGAGGCTGGGCACGG + Intronic
922507280 1:226133857-226133879 AACTAGTGAGAGCCTGGGGAGGG + Intergenic
922801902 1:228368285-228368307 GTGGAGAGGGAGGCTGGGGCTGG + Intronic
923215010 1:231840622-231840644 ATTGGGAGAGGGGCTGGGGAAGG + Intronic
923256260 1:232224008-232224030 ATGAGGAGAGAGCCTGGCGATGG - Intergenic
923597581 1:235372632-235372654 AGAGAGAGAGAGGCTGGGCACGG + Intronic
923759377 1:236826584-236826606 ATGCAGTGAGAGGCTGGGTATGG - Intronic
923856044 1:237846714-237846736 ATGGAGAGAGACCCCTGTGATGG + Intergenic
923872122 1:238006788-238006810 ATGAAGAGAGAAGCTGGGCACGG - Intergenic
924192142 1:241565422-241565444 ATCAAAAGAGAGCATGGGGATGG + Intronic
924579377 1:245310748-245310770 ATGGGGAGAGAGCCCAGGGGAGG + Intronic
924606324 1:245538614-245538636 ATGGAGAGACAGACAGGGGAAGG - Intronic
924823960 1:247521316-247521338 AGGGAGAGGGAGACTGGAGAGGG - Intronic
924824442 1:247524441-247524463 ATGCAGGGTGAGCCTGGAGAAGG - Intronic
1062953715 10:1526195-1526217 TTGGAGAGATGGCCTGGGGCAGG + Intronic
1063550677 10:7029846-7029868 AAAGAGAGAGAGCCTGTGCAGGG - Intergenic
1063673813 10:8121781-8121803 ATGAAGAGAGAGCTTGCGGAGGG - Intergenic
1063790982 10:9447528-9447550 AGGGAGAGAGAGGAAGGGGAAGG - Intergenic
1063876500 10:10484251-10484273 AGGGAGAGAGAGAGGGGGGAGGG - Intergenic
1063876509 10:10484274-10484296 AGGGAGAGAGAGAGGGGGGAGGG - Intergenic
1064050661 10:12056737-12056759 AGAGAGAGAGAGACTGGGCACGG - Intergenic
1064096731 10:12429325-12429347 AAAGAGAGAGAGAATGGGGAAGG - Intronic
1064337379 10:14456252-14456274 TTGGAGAGAGAGCCAGGAGCTGG - Intronic
1064479267 10:15723044-15723066 ATAGAGTGAGAGGCTGGGCATGG + Intergenic
1064529462 10:16292815-16292837 GTGGAGAGAGAGACTGAGAAAGG - Intergenic
1064697078 10:17978033-17978055 ATGGAAAAAGAGTCTGAGGATGG + Exonic
1065920359 10:30387534-30387556 ATGGAGACAGAGACAAGGGAAGG - Intergenic
1066714624 10:38273332-38273354 AGGGAGAGAGAGAGTGGGGGAGG - Intergenic
1066783447 10:38977381-38977403 AAGGAGAGAGAGAGTGGGGGAGG + Intergenic
1067029003 10:42867961-42867983 ATGGAGAGAGTGCCAGAGAATGG + Intergenic
1067196395 10:44123242-44123264 CTGGAGAAAAAGCCTGGAGAGGG + Intergenic
1067238622 10:44472153-44472175 ATGCAGAGAGAGGCCGGGCATGG - Intergenic
1067714232 10:48674217-48674239 AAAGAGAGAGAGGCTGGGCACGG - Intergenic
1068360664 10:55972707-55972729 ATGGGAACAGAGACTGGGGAGGG - Intergenic
1068781631 10:60925085-60925107 AGGGAGAGAGAGCATGGGGTAGG - Intronic
1069595522 10:69667496-69667518 ATGGAGAGAGATGCTTGTGAAGG - Intergenic
1069780647 10:70953292-70953314 ATGGGGAGAGGGCATGGTGATGG - Intergenic
1069944869 10:71978899-71978921 ATGGGGAGGCATCCTGGGGAGGG - Intronic
1070363845 10:75716997-75717019 ATGGGGAGAGAGAAAGGGGATGG - Intronic
1070491577 10:76981610-76981632 ATGGTGGGAGAGCCTGGTGAAGG - Intronic
1070797008 10:79222708-79222730 ATGGAGAGAGTGCTTGGGAGAGG + Intronic
1070914077 10:80141702-80141724 CGGGAGAGAGAGACTGGAGAGGG - Intronic
1070982458 10:80660428-80660450 ATGGTGAGGGAGCCGGGGGCAGG - Intergenic
1071339020 10:84625514-84625536 ATGCAAAGAGAGGCTGAGGAAGG - Intergenic
1071379256 10:85041475-85041497 ATGGAGAGGGATGGTGGGGATGG + Intergenic
1071399723 10:85257376-85257398 TTGGGGAAAGTGCCTGGGGAGGG - Intergenic
1071562878 10:86657017-86657039 ATGGAGAGGGACACTGGGGGTGG - Intronic
1071600019 10:86954471-86954493 AGGGAGAGGGAGCCTGTGGGAGG + Intronic
1071674928 10:87646618-87646640 ATGGATTGAGAGTCTGGTGAAGG - Intergenic
1071899875 10:90108702-90108724 ATGGAGAAAGAGCAGAGGGATGG + Intergenic
1072092096 10:92138441-92138463 AAGGAAAGAGAGCCAAGGGATGG + Intronic
1072157927 10:92740773-92740795 GAGGAGAGAGAGACTGGGCACGG - Intergenic
1072161643 10:92772184-92772206 ATGGGAAAAGGGCCTGGGGAGGG + Intergenic
1073127399 10:101159895-101159917 ATGGAGAGTGGGCCCAGGGAAGG - Intergenic
1073431392 10:103489809-103489831 ATGGAGAGAGAGAAAGAGGAAGG + Intergenic
1073456628 10:103640737-103640759 ATGCTGGGAGAGCCTGGGAAGGG + Intronic
1073756093 10:106582199-106582221 ATCGAAAGACAACCTGGGGATGG - Intronic
1074317520 10:112372946-112372968 GTGGAAAGAGAGGCTGGGCATGG + Intergenic
1074757334 10:116634290-116634312 AGGGACAGAGAGCCGGTGGAGGG - Intronic
1074890408 10:117731349-117731371 TAGGGGAGAGAGCCGGGGGATGG + Intergenic
1074997830 10:118773111-118773133 AAGAAGAGAGAGGCTGGGCATGG - Intergenic
1075391205 10:122093689-122093711 ATAGAGAGAGAAACTGAGGATGG - Intronic
1075918749 10:126191963-126191985 AGGAAGAGAGAGAATGGGGAGGG + Intronic
1075941052 10:126390206-126390228 AGTGAGAGAGAGCTTGTGGAGGG - Intergenic
1076803148 10:132841827-132841849 CTGGGCAGAGAGCCTGTGGAGGG + Intronic
1076812763 10:132897834-132897856 ATGGGGAGAGAGGCTGGGGTGGG + Intronic
1076979107 11:195858-195880 ATGGTGAGGGGGCCTGGTGAGGG + Intronic
1076988925 11:259117-259139 ATGGGAAGAGATCCTGTGGAGGG + Intergenic
1077367937 11:2168714-2168736 ATGGAGAGAGAGGGTGGGGTGGG + Intronic
1077451917 11:2653579-2653601 ATGGATAGAGAGCAAGGGAAAGG - Intronic
1077453356 11:2663970-2663992 GTGGGCAGAGAGCTTGGGGATGG - Intronic
1077652189 11:3983222-3983244 ATGGAGATAGAGGCAGGGCATGG - Intronic
1078250670 11:9614147-9614169 ATGGGGAGATAGCGAGGGGAGGG - Intergenic
1078551743 11:12285948-12285970 CTGGAGAGAAAGGATGGGGACGG - Intronic
1078688406 11:13554543-13554565 AAGGAGAGAGAGCATGTGCAGGG + Intergenic
1078995986 11:16700482-16700504 GTGGAGAATGAGTCTGGGGATGG - Intronic
1079079793 11:17406263-17406285 AGGGAGAGAGAGTGAGGGGAGGG + Intronic
1079096235 11:17512161-17512183 GTGGTGAGAGAGCTGGGGGAGGG - Intronic
1079601503 11:22316640-22316662 GGGGAGAGAGAGGCGGGGGAGGG - Intergenic
1080684513 11:34504137-34504159 GTAGAGAGAGAGCCTGGAGCTGG + Intronic
1081159536 11:39735527-39735549 TTGGAAAGAGAGACTAGGGAGGG - Intergenic
1081641274 11:44755975-44755997 ATGGAGAGAGAGATGGAGGAGGG + Intronic
1081661195 11:44889441-44889463 CTCCAGAGAGAGCCTGGGGCTGG - Intronic
1081675336 11:44965280-44965302 ATGAGGAGGGAGGCTGGGGAGGG + Intergenic
1081781418 11:45715764-45715786 GTGGACAGACAGCCTGGAGAAGG - Intergenic
1081982581 11:47277585-47277607 ATGTAGAAAGAGGCTGGGCACGG - Intronic
1081989455 11:47329921-47329943 AGGGAGAGACAGCCTGGGTATGG + Exonic
1082101075 11:48173447-48173469 TTGGAGAGAGTGCCGTGGGAGGG - Intergenic
1083188924 11:61035642-61035664 ATTGATCGAGACCCTGGGGAGGG - Intergenic
1083567030 11:63727823-63727845 AGTGAGAGAGAGACTGGAGAAGG + Intronic
1083729327 11:64644394-64644416 ATGGAGGGAGAGGTTGGGGCTGG - Intronic
1083738813 11:64696965-64696987 ACCCAGAGAGAGCCTGGGGAAGG + Intronic
1083857700 11:65401311-65401333 CTGGGGAGGGAGGCTGGGGAGGG - Intronic
1083902870 11:65652186-65652208 AAGGAGAGGCAGGCTGGGGATGG + Intergenic
1084425161 11:69080429-69080451 ATGAAGAGACAACCTGGGCAGGG + Intronic
1084448395 11:69217831-69217853 CTGGAGAGAGAGCCCAGGGAGGG + Intergenic
1084709410 11:70834867-70834889 AGGGAGAGAGACCCTGTGGGAGG - Intronic
1084710446 11:70840699-70840721 AGGAAGTGGGAGCCTGGGGAGGG + Intronic
1084726532 11:70945963-70945985 AGGGAGGTAGAGCCTGGGAAGGG - Intronic
1084726542 11:70945999-70946021 AGGGAGGGCGAGCCTGGGAAGGG - Intronic
1084726634 11:70946397-70946419 AGGGAGGGTGAACCTGGGGAAGG - Intronic
1084726664 11:70946507-70946529 AGGGATGGTGAGCCTGGGGAAGG - Intronic
1084726692 11:70946617-70946639 AGGGAGGGTGAGCCTGGGGAAGG - Intronic
1084980274 11:72825164-72825186 GTGGACAGAGAAACTGGGGAGGG + Intronic
1085376893 11:76071875-76071897 ATGGAGAAAGATCCAGGAGATGG + Intronic
1085445316 11:76597439-76597461 CTGGGTAGAGAGCCTGGGCAGGG - Intergenic
1085569729 11:77548878-77548900 ATGAAGAAATAACCTGGGGAAGG + Intronic
1086906463 11:92423673-92423695 CTGTAGAGAGAGGGTGGGGAGGG + Intronic
1086957761 11:92951222-92951244 ATGGAGAGACAGGCTGGGCATGG + Intergenic
1086985523 11:93244819-93244841 GTGGAGAGGGAGGCTGAGGAGGG - Intergenic
1087646559 11:100814664-100814686 AGGGAGAGAGAGATAGGGGAGGG + Intronic
1088423611 11:109675832-109675854 ATGGAGAAGAAGTCTGGGGAGGG + Intergenic
1088543599 11:110937860-110937882 TTGGGGACAGGGCCTGGGGAAGG + Intergenic
1088668204 11:112115801-112115823 AGGGAGAAAGGGGCTGGGGATGG + Intronic
1088736622 11:112732905-112732927 AAGTAAAGAGAGGCTGGGGAGGG - Intergenic
1088827470 11:113507895-113507917 AGAGAGAGAGAGCCTGGCTATGG - Intergenic
1089001302 11:115054502-115054524 AAGGAAAGAGAGAGTGGGGAGGG + Intergenic
1089329897 11:117681917-117681939 GTGGAGAGAGAGACTGGGACAGG - Intronic
1089333868 11:117709300-117709322 ATGGGGTCAGAGACTGGGGAGGG + Intronic
1089358961 11:117873932-117873954 ATGGAGGGAGAGCCTTTGGTCGG - Intronic
1089734591 11:120541021-120541043 CTGGAGAGAGAGGCTGGGGCAGG - Intronic
1089773732 11:120821437-120821459 ATGGAAAGAGAGGCTGGGGAAGG + Intronic
1089780416 11:120869740-120869762 AGGAAGAGGGGGCCTGGGGAGGG + Intronic
1090434842 11:126677965-126677987 ATGAAGCTGGAGCCTGGGGACGG - Intronic
1090568205 11:128018959-128018981 TTGGAGAAAGAGCCTGAGCATGG - Intergenic
1090661665 11:128886610-128886632 AGGAAGAAAGAGCCTTGGGACGG - Intergenic
1091132800 11:133160693-133160715 GTGGACTGAGAGCCTGGTGAGGG + Intronic
1091371483 11:135063731-135063753 AAGGAAAGAGAGAGTGGGGAGGG + Intergenic
1091690293 12:2591643-2591665 AGAGAGAGAGAGCATGAGGAAGG + Intronic
1091768970 12:3139231-3139253 ATGGAGAGAAATCCTTGGCAGGG + Intronic
1092183907 12:6464600-6464622 TTGGAGGGAGACCATGGGGATGG - Intronic
1092231519 12:6778209-6778231 ATGGAGAGAGAGACGGAGGGCGG - Intronic
1092950539 12:13499278-13499300 ATGGATGGGGAGCATGGGGAGGG - Intergenic
1092977821 12:13762756-13762778 ATGGAGTGAGAGACTAGGCATGG + Intronic
1095264523 12:40138472-40138494 ATGGGGAGAGAGACTGGTCAGGG + Intergenic
1095520690 12:43061602-43061624 ATTGAAAGGGAGCCTGTGGAAGG - Intergenic
1095927863 12:47596891-47596913 AGAGAGAGAGAGACTGGGGCTGG + Intergenic
1096650472 12:53059766-53059788 CTGGAGAGGGAGGCTGGAGAAGG + Exonic
1096652098 12:53066820-53066842 ATGGAGAGAGAGGCCGGGCGCGG + Intronic
1096676505 12:53229224-53229246 ATGCAGAGAGACCATGGGGTGGG + Intronic
1096718702 12:53505861-53505883 CTGGGGAGCGAGCCAGGGGATGG + Intronic
1096775918 12:53964051-53964073 CTAGAGAGAGAGCCAGAGGAGGG - Intergenic
1096879185 12:54653690-54653712 ATGGAGAGGGAGGCATGGGATGG + Intergenic
1097459934 12:59849047-59849069 AGAGAGAGAGAGAGTGGGGAAGG - Intergenic
1098145902 12:67497663-67497685 TTGGAGAGAGAGCCAGGTGAAGG + Intergenic
1099352442 12:81590705-81590727 AAAGAGAGAGAGCTTGGGCAGGG - Intronic
1099712052 12:86240649-86240671 TTGGAAAGAGAGTCAGGGGAGGG - Intronic
1100795489 12:98177373-98177395 AGAGAGAGAGAGAGTGGGGAGGG - Intergenic
1101344125 12:103869601-103869623 AGAGAGAGAGAGATTGGGGAAGG - Intergenic
1101691681 12:107088285-107088307 ATGGCGAGAGAGAGAGGGGAGGG - Intronic
1101749356 12:107570765-107570787 CTGGAGAGAGAGGCAGGGGGAGG - Intronic
1102061653 12:109937013-109937035 ATGAAGAGAATGCCTGGGAAAGG + Intronic
1102558051 12:113741925-113741947 ATGGAGAGAGAGAAGGGGAAGGG + Intergenic
1102598823 12:114013126-114013148 ATGGAGAGAGGGGAGGGGGATGG + Intergenic
1102880749 12:116482708-116482730 CTGCAGAGAGAGGCTAGGGATGG + Intergenic
1103019475 12:117522396-117522418 ATGGAGAGAAGGCCAGGGGTGGG + Intronic
1103154121 12:118668720-118668742 ATGGAGTGGGGGCCTGGGGGAGG - Intergenic
1103911852 12:124356325-124356347 ATGGTAGAAGAGCCTGGGGAGGG - Intronic
1104085121 12:125467251-125467273 ATGGAGAGAGATGGTGGGGTTGG + Intronic
1104483402 12:129128432-129128454 AGCGAGAGAGTGACTGGGGAAGG + Intronic
1105218888 13:18307432-18307454 CTGGAGGCAGAGCCTGGGGGAGG - Intergenic
1105287218 13:19014221-19014243 ATGGAGAGAGAGGCAGGTTAGGG - Intergenic
1106371612 13:29139882-29139904 ATGGAGAGAGCGCCAGAGGAAGG - Intronic
1106674262 13:31941185-31941207 ATGGAGAGAGGGGATGGGAAAGG - Intergenic
1107099245 13:36571511-36571533 ATAGAGGGAGAGCGTGGGGCTGG - Intergenic
1107568570 13:41631938-41631960 ATTGAGAGACAGCATGGGTAGGG + Intronic
1108074600 13:46666872-46666894 GGTGAGAGAGAGCCTTGGGAGGG + Intronic
1109749961 13:66677606-66677628 AGAGAGAAAGAGCATGGGGAAGG - Intronic
1111340487 13:86879513-86879535 ATGGAGAGAGAGCTAGGTGTTGG + Intergenic
1111741931 13:92215953-92215975 ATGGTGAGAGGGTCTGGGAATGG + Intronic
1112851263 13:103709143-103709165 GTGGAGAGAGAGCCTTGTGTAGG - Intergenic
1112868937 13:103944475-103944497 AGAGAGAGAGAGCTTGTGGAGGG - Intergenic
1112982620 13:105404538-105404560 ATGGAGAGAGGGACAGGGGAAGG + Intergenic
1113024095 13:105921464-105921486 TCTGAGAGAGAGACTGGGGAGGG + Intergenic
1113088532 13:106593145-106593167 AAGCACAGAGAGCCTGGGGCAGG - Intergenic
1113266381 13:108622598-108622620 ATGGAGAGAGAGACAGGGAGAGG + Intronic
1113541743 13:111115081-111115103 ATGGGGAGGGAGCCGGGGGTGGG - Intronic
1113599475 13:111558328-111558350 ATGGTGGGAGAGCCGGGAGAGGG + Intergenic
1113654389 13:112058714-112058736 ATGAAGAGAGAGCCTTCAGATGG + Intergenic
1113665716 13:112140961-112140983 ATGGTGACAGAGCCAGTGGAAGG - Intergenic
1113857533 13:113456203-113456225 CTGGAAGCAGAGCCTGGGGAAGG + Intronic
1113891831 13:113740012-113740034 ACCGAGAGAGAGCCCAGGGAGGG - Intergenic
1114649761 14:24277057-24277079 ATGGAGAGTGAGGATGGAGAAGG + Intergenic
1114730841 14:24990961-24990983 AAGGAGAGAGAGCATGAGAAAGG + Intronic
1115478150 14:33835934-33835956 ATGGAGAGAGATCCTGTGATAGG - Intergenic
1116654387 14:47632785-47632807 AAGGAGAGAGAGGTTGGGGAAGG - Intronic
1116868363 14:50049508-50049530 AGGAAGAGGGAGGCTGGGGAAGG - Intergenic
1117567600 14:57011102-57011124 TTGGAGAAAGAGCCTGGGTTAGG + Intergenic
1118184568 14:63525028-63525050 GTGCAGAGAGAGCCAGGGGTGGG - Intronic
1118611907 14:67547873-67547895 AGGGAGAGAGAGCCGGATGAAGG + Intronic
1118752058 14:68814715-68814737 ATAAACAGAGAGCCTAGGGAGGG + Intergenic
1118892411 14:69921282-69921304 AGAGACAGAGTGCCTGGGGAGGG + Intronic
1118974549 14:70665442-70665464 ATGGAGAGAGAGGGAGGAGAGGG + Intronic
1119414632 14:74461342-74461364 ATGGAGGGAGATGTTGGGGAAGG - Intergenic
1119726111 14:76922701-76922723 AAGGAGAGCGAGCTGGGGGAAGG - Intergenic
1119808566 14:77498516-77498538 ATGGAGAGAGGGGCCGGGGCCGG - Intronic
1120188446 14:81418246-81418268 AAAGAGAGAGAGCCTGTGCATGG + Intronic
1120193934 14:81463191-81463213 AGGGAGAGGGAGACGGGGGAGGG + Intergenic
1120193942 14:81463210-81463232 AGGGAGAGGGAGACGGGGGAGGG + Intergenic
1120193950 14:81463229-81463251 AGGGAGAGGGAGACGGGGGAGGG + Intergenic
1120193958 14:81463248-81463270 AGGGAGAGGGAGACGGGGGAGGG + Intergenic
1120193966 14:81463267-81463289 AGGGAGAGGGAGACGGGGGAGGG + Intergenic
1120645139 14:87065021-87065043 CAGGAGAGAGAGCCAGAGGAGGG + Intergenic
1120648653 14:87103517-87103539 AGCGAGAGAGAGCGAGGGGAAGG - Intergenic
1120841883 14:89093020-89093042 AGGTAGAGAGATCCTGAGGAGGG + Intergenic
1120931988 14:89858150-89858172 ATGGCAAGAGAGCCAGGAGAGGG - Intronic
1121468171 14:94129294-94129316 AGAGAGAGAGTGCCAGGGGAAGG + Intronic
1121660302 14:95630308-95630330 GTGGAGTGAGAGCGTGGGCATGG + Intergenic
1121670616 14:95708182-95708204 ATGTAGAGGGAGGCTGGGCACGG + Intergenic
1122014984 14:98787665-98787687 ATGGAGAGTGGGGCTGGGCATGG - Intergenic
1122019830 14:98828455-98828477 AGGTAGAGAGAGCAAGGGGATGG + Intergenic
1122124407 14:99571265-99571287 TTGGCGAGATGGCCTGGGGAGGG - Intronic
1122338958 14:101013075-101013097 AGGAAGAGAGAGGCTGGGCACGG - Intergenic
1122509771 14:102257019-102257041 GTGGTGTGGGAGCCTGGGGAAGG - Intronic
1122781125 14:104143989-104144011 TTGGGGAGGGAGCCTGGGGAAGG + Intronic
1123863567 15:24493807-24493829 ATGAAGAGTGAGGCTGGGCATGG + Intergenic
1124103170 15:26713953-26713975 ATGGCAAGTGTGCCTGGGGAAGG - Intronic
1124167145 15:27338348-27338370 ATGGAAAGAATGCCTGGGGTGGG - Intronic
1124816636 15:33000532-33000554 TTGGAGAGAGAGGCTGAGGTGGG + Intronic
1125197713 15:37067422-37067444 AGGGTGGGAGAGCCTGGGCAAGG - Intronic
1125450959 15:39806784-39806806 ATTGAGAGAAGACCTGGGGATGG - Intronic
1125726049 15:41868616-41868638 ACGGAGGGAGAGCCGGGTGAGGG + Intronic
1125770210 15:42160154-42160176 TGGGAGAGAAAGCCTGGGTAGGG + Exonic
1126325851 15:47476577-47476599 AAGGAGATAGAGCATGAGGAAGG - Intronic
1126373809 15:47974717-47974739 ATGGAGGGAGAGCATGGAGGAGG - Intergenic
1126802999 15:52317755-52317777 AAGGAGAGAGAGGCAAGGGAGGG + Intronic
1127029383 15:54845129-54845151 TTGGAGGGTGAGCCTGGGGTGGG - Intergenic
1127573318 15:60265343-60265365 ATGGGAAGAGAGCCCTGGGAGGG - Intergenic
1128223233 15:65983074-65983096 AGGGAGATGGAGCCAGGGGAGGG - Intronic
1128496378 15:68200825-68200847 ATGAAGCGAGGGCCTGGGGGTGG - Intronic
1128514469 15:68333804-68333826 GTGGGGACAGAGGCTGGGGAGGG - Intronic
1128514834 15:68335671-68335693 ATGGAGGGGGAGCCTGGGGCCGG - Intronic
1128591129 15:68898427-68898449 ATGGAGAGAGAGAAGGGGCAAGG - Intronic
1128874125 15:71188281-71188303 AAGGGGAGAGAGGCTGGCGAAGG + Intronic
1129122520 15:73409525-73409547 ATGCAGACAGCTCCTGGGGAAGG - Intergenic
1129249639 15:74301862-74301884 GTGGAGAGAGAGAGGGGGGAGGG - Intronic
1129862346 15:78872681-78872703 ATGGAGAGAGAAGCGGGGGTGGG + Intronic
1129943954 15:79523297-79523319 ATGCAGAGAAAACTTGGGGAAGG - Intergenic
1129973460 15:79801106-79801128 AGAGAGAGAGAGGATGGGGAGGG - Intergenic
1131080563 15:89531136-89531158 AGGGAGCCAAAGCCTGGGGACGG - Intergenic
1131161298 15:90106659-90106681 ATTGGGATAGAGCCTGGGGAAGG + Intergenic
1131472534 15:92709398-92709420 GAGGAGAGAGAGCCTGGGGCAGG - Intronic
1131646234 15:94348359-94348381 AGGGAGAGAGAGAAGGGGGATGG - Intronic
1131679377 15:94705626-94705648 AGGGAGAGAGAGAAGGGGGAGGG - Intergenic
1132382597 15:101376948-101376970 CTGGAGGGAGAGGCTGGGTAAGG + Intronic
1132644332 16:991835-991857 GTGGAGGGAGAGGCTGGTGAAGG + Intergenic
1132645976 16:999476-999498 ACGGAGGAACAGCCTGGGGATGG - Intergenic
1132676275 16:1122577-1122599 ATGGAGGGAGAGCGTGTGGGGGG + Intergenic
1133100410 16:3475938-3475960 ATGGGGAGAGAGGCTGGCCAGGG + Intronic
1133771138 16:8867809-8867831 AGGCAGAGAGAGGCTGGAGAAGG + Intronic
1134239925 16:12498052-12498074 AGGGAAAGAGAGACTGGGGAAGG + Intronic
1134316831 16:13126646-13126668 GTGGAGAGAGAGACTGAGGAAGG + Intronic
1134316867 16:13126933-13126955 AGGGAGAGAGAGCTGAGGGAAGG + Intronic
1134344206 16:13374307-13374329 ATGGATGGAGGGCCAGGGGAGGG - Intergenic
1134355052 16:13474579-13474601 ATGGAGTTACAGCCTGGTGAGGG + Intergenic
1134834930 16:17353324-17353346 ATTGACAGAGAGCCTGTTGAGGG + Intronic
1134856043 16:17520118-17520140 ATGGAGAAGGAGGCAGGGGAAGG + Intergenic
1135117877 16:19738993-19739015 CTGCAGAGGGAGCATGGGGAGGG - Intronic
1135412507 16:22245738-22245760 AGGCAGAGAGAGCTTGGAGAGGG - Intronic
1135711995 16:24725536-24725558 ATGGAGAGAGGAGCTGGGGAGGG - Intergenic
1135978116 16:27124552-27124574 CTGGAGAGGAAGCCTGGGAAGGG - Intergenic
1136247927 16:28985825-28985847 AAGGAGACACAGCTTGGGGATGG - Intronic
1136428690 16:30185028-30185050 AGGGAAGGAGAGGCTGGGGAAGG + Intronic
1137020490 16:35420965-35420987 AGAAAGAGAGGGCCTGGGGAAGG + Intergenic
1137255162 16:46769058-46769080 TTGGACTGAGGGCCTGGGGATGG - Intronic
1138110084 16:54316777-54316799 ATGGAGAGAGGTGCTGGGGATGG - Intergenic
1138279791 16:55764050-55764072 ATGCAGAGCCTGCCTGGGGAAGG - Intergenic
1138288709 16:55829598-55829620 ATGCAGAGCCTGCCTGGGGAAGG + Intronic
1138812320 16:60165634-60165656 AAGGCCTGAGAGCCTGGGGATGG + Intergenic
1139065107 16:63303039-63303061 GTGTAGACAGAGCCTGAGGAAGG + Intergenic
1139495489 16:67314145-67314167 AGGGAGAGAGGGGCTGGGCACGG - Intronic
1139660668 16:68418768-68418790 AAGGAGACAGAGCCAGGGGCAGG - Intronic
1139985315 16:70894029-70894051 GTGGAGGGAGAGACTGGAGATGG - Intronic
1140137623 16:72221603-72221625 CTGGAGGGAGAGTATGGGGAAGG + Intergenic
1140223968 16:73064277-73064299 CTGGAGTGAGAGTCAGGGGAGGG - Intergenic
1140278601 16:73533411-73533433 ATGGAGAGAGAGCCTTCTGTTGG - Intergenic
1140350881 16:74261031-74261053 ATGGAGAGAGAGGCTGGGTCAGG - Intergenic
1140475611 16:75238071-75238093 ATGGTAAGAGCACCTGGGGAGGG - Intronic
1140693431 16:77507534-77507556 GTGGAGGGAGAGCAGGGGGAGGG + Intergenic
1141252193 16:82368903-82368925 ATGGGGAGAGAGAGTGGGGAGGG + Intergenic
1141616316 16:85211671-85211693 GTGGAGTGAGATCCTGGGGATGG + Intergenic
1141789063 16:86220875-86220897 AAGGAGAGAGAGCATGAAGAAGG - Intergenic
1141859528 16:86706930-86706952 ATGGAGAGACAGTCTGGGCCTGG + Intergenic
1141943124 16:87291573-87291595 ATGGAGGTAGACCATGGGGAGGG - Intronic
1141982766 16:87560554-87560576 AGGGAGAAAGAGCCTGGGGGCGG + Intergenic
1142011638 16:87718362-87718384 AGGGAGAGGGAGACTGTGGAGGG - Intronic
1142466597 17:140676-140698 ATGGTGAGGGGGCCTGGTGAGGG + Intergenic
1142631946 17:1230829-1230851 CTGGAGAGGGGGCCTGGAGACGG + Intergenic
1143248450 17:5504738-5504760 ATGGTGAGCAAGCCTGGGGTGGG - Intronic
1143289789 17:5820123-5820145 GGGGAGAGCGAGCCGGGGGAAGG - Intronic
1143367435 17:6417323-6417345 ATGGAGAAAGAGGCTGAGCAAGG + Intronic
1143520970 17:7444200-7444222 AGGGAGACAGAGTCTGGAGAAGG + Exonic
1144169567 17:12646852-12646874 ATGGATAGAGAGTCTGGGGTCGG + Intergenic
1144588483 17:16503584-16503606 CAGGAGAGAGAGCCAGTGGAGGG + Intergenic
1145247571 17:21279746-21279768 ATGGTGAGAGGGGCTGGGGCAGG + Intergenic
1145890994 17:28415583-28415605 AGGGACAGAGAGCCTAGGCAGGG + Intergenic
1146886896 17:36476951-36476973 ATGGTGACAGAGGCTGGGGTGGG - Intergenic
1146909373 17:36638694-36638716 ATGGAGAGGGAGCTGGGGGGAGG - Intergenic
1147498138 17:40937138-40937160 AGGGTGAGCGAGCCTGGAGAAGG + Intronic
1147632618 17:41941828-41941850 GTGGAGAGGGAGCCTAGGGGAGG - Intronic
1147727802 17:42577564-42577586 ACGGAGAGAAAGGCAGGGGAGGG + Intronic
1147743654 17:42682546-42682568 CAGGAGACAGAGGCTGGGGAAGG + Intronic
1147817563 17:43221125-43221147 ACTGAGATATAGCCTGGGGAAGG - Intergenic
1147875951 17:43620714-43620736 AGGGTTAGAGAGGCTGGGGATGG - Intergenic
1147909538 17:43847265-43847287 ATGGGGAGAGGGTCTCGGGAGGG + Intronic
1147951125 17:44108619-44108641 ATGGGGAGAGGGGGTGGGGAGGG + Intronic
1147955390 17:44130923-44130945 ATGTAGAGTGAGCCTGCAGATGG + Intergenic
1148228067 17:45913243-45913265 AGGGAGAGAGAGCTTGTGCAGGG + Intronic
1148490955 17:48023833-48023855 ATGCAGAGGGGCCCTGGGGATGG + Intergenic
1148676548 17:49448860-49448882 ATGCAGAGAGAGGCTAGGGAAGG + Intronic
1148836376 17:50467931-50467953 AGGGACAGGGAACCTGGGGACGG + Intronic
1148880801 17:50725046-50725068 ATGAAGAGAAAGGCTGGGCATGG - Intronic
1149793243 17:59497429-59497451 AAAGAGAGAGAGACTGGGCATGG - Intergenic
1150224208 17:63514150-63514172 GTGGAGAGGGAGCCTGGAGCAGG - Intronic
1150480308 17:65503993-65504015 ATGCAGGGAAAGCCTGGGGATGG + Intergenic
1150649392 17:67000107-67000129 TTGCAGAGAGAGCCTGGGGAAGG - Intronic
1150738684 17:67762031-67762053 ATGGAGTGAGACTCTGGGGGCGG - Intergenic
1151326703 17:73384061-73384083 ATGATGAGAGAGCGTGGGGAGGG - Intronic
1151377683 17:73702326-73702348 AGAGAGAGAGAGACAGGGGAAGG + Intergenic
1151429822 17:74054961-74054983 AAGGAGAGAGAGAAAGGGGAGGG - Intergenic
1151598985 17:75094808-75094830 ATGGTGACAGAGCCAGGAGAAGG - Intronic
1151663812 17:75534157-75534179 CTGGAGAGAGAGTCTGGTGTTGG + Intronic
1151763529 17:76121010-76121032 CTGTAGTGAGTGCCTGGGGAGGG - Intronic
1152323467 17:79622356-79622378 AGGCAGGGAGAGCCCGGGGAGGG - Intergenic
1152372853 17:79901293-79901315 AGGGAGGCAGTGCCTGGGGAGGG + Intergenic
1153543777 18:6185431-6185453 GAGGAGAGGGAGGCTGGGGAAGG + Intronic
1153591051 18:6674519-6674541 TTGGTGAGAGCCCCTGGGGATGG + Intergenic
1154092806 18:11380886-11380908 ATGTGGGGAGAGCCTGAGGAAGG + Intergenic
1154356599 18:13626495-13626517 ATGGAGGGAGAGGCAGGAGAGGG + Intronic
1154946483 18:21166682-21166704 AGAGAGAGAGAGTTTGGGGAAGG - Intergenic
1155195671 18:23471779-23471801 ACGAGGTGAGAGCCTGGGGAAGG + Intronic
1155306127 18:24480380-24480402 AAGGAGAGAGAGCTTGTGCAGGG + Intergenic
1155833955 18:30554420-30554442 AGAGAGAGAGAGGCAGGGGAGGG - Intergenic
1156110033 18:33714745-33714767 ATGGAGAGAAAGACCGGGGGAGG - Intronic
1156503233 18:37572946-37572968 AGGGAGGGAGAGGCTGAGGATGG + Intergenic
1156597486 18:38564198-38564220 AGAGAGAGAGAGCGGGGGGAAGG - Intergenic
1156777006 18:40803276-40803298 TTGGAGATAGAGCGTGGTGATGG + Intergenic
1156890659 18:42186406-42186428 ATGGTGAGAGAGGCTGTGTAGGG + Intergenic
1156901782 18:42308823-42308845 AAAGAGAGAGAGCCTGTGCAGGG + Intergenic
1157287299 18:46385709-46385731 TTGGAGCAAGAGGCTGGGGAGGG - Intronic
1157675479 18:49565492-49565514 ATGGACGGTGAGCCCGGGGAGGG + Exonic
1157688546 18:49662416-49662438 AAGGTGAGAGAGGCTGGGGAGGG + Intergenic
1157750121 18:50170995-50171017 AAGGAGAGAGAGCCTCAGGGAGG - Intronic
1158429246 18:57369386-57369408 ATCTAGAGAGAGCCTGGGATGGG - Intronic
1158555646 18:58472555-58472577 AAGGATAAAGAGCCTGGGGAGGG + Intergenic
1159025685 18:63180531-63180553 ATGGAGATTAAGCCTGGGGTGGG - Intronic
1159026547 18:63187673-63187695 ATGGAGACAGAGGCTTGGAATGG + Intronic
1160707698 19:537100-537122 GTGGAAAGAGAGCAAGGGGAAGG + Exonic
1160828367 19:1091151-1091173 ATGAGCAGAGAGGCTGGGGAGGG - Intronic
1160871129 19:1278520-1278542 ATGGAGTCAGAGCATGCGGAGGG - Intronic
1161074791 19:2280362-2280384 AAAGAGAGAGAGGCTGGGCACGG - Intronic
1161121736 19:2530820-2530842 ATCGAAAGAGAGCCTGGGTTTGG + Intronic
1161405688 19:4090084-4090106 AAGGAGAGTGAGGCTGGGGGCGG - Intergenic
1161504965 19:4639152-4639174 ACAGACAGAGAACCTGGGGAGGG - Intergenic
1161693361 19:5750822-5750844 AGGGAGAGAGGGCTGGGGGAGGG - Intronic
1161985392 19:7650631-7650653 CTGGAGTGGGTGCCTGGGGAGGG + Intergenic
1162003857 19:7764989-7765011 GGGGAGGGAGAGGCTGGGGATGG + Intronic
1162456798 19:10789990-10790012 ATGGTGAGAGTGCCTGGGCAGGG - Intronic
1162612681 19:11768191-11768213 GAGGAGAGAAAGCCTGAGGAAGG - Intronic
1162769891 19:12943046-12943068 ATGGAGAGACAGCCAGGGACGGG - Intronic
1162957198 19:14105983-14106005 CTGGAGAGGGAGCTTTGGGAAGG + Intronic
1162957812 19:14109056-14109078 ATGGGGAGAGAGGCTGGGTGAGG + Intronic
1163093340 19:15036451-15036473 GTGGAGAAAGGGCCTGGGGCAGG + Intergenic
1163267781 19:16232014-16232036 ATGCAGAGAGAGCCAGGAGAAGG - Intronic
1163274726 19:16276357-16276379 AGAGAGAGAGAGACTGGGCATGG - Intergenic
1163717020 19:18878710-18878732 GGGGAGGGAGAGGCTGGGGAGGG - Exonic
1164389342 19:27804914-27804936 ATGGTGGGAGAACCTGGGGGTGG + Intergenic
1164435841 19:28228594-28228616 CTGGAGGGAGAGGCTGTGGATGG - Intergenic
1164556730 19:29258764-29258786 ATGAAGAGAGAGCCTGGGGATGG - Intergenic
1164839607 19:31382546-31382568 TTGGAGAGAGGGACAGGGGATGG + Intergenic
1164867155 19:31614121-31614143 CTGGAGAGAGTGTCAGGGGATGG - Intergenic
1164918829 19:32073270-32073292 ATGGAGAGTAGTCCTGGGGATGG - Intergenic
1164984675 19:32639615-32639637 CTGCAGAGAGATCCAGGGGATGG - Intronic
1165070300 19:33251584-33251606 CTGGACGAAGAGCCTGGGGAAGG - Intergenic
1165866953 19:38945358-38945380 GTGGAGCCAGAGCCTGGGGGAGG + Intronic
1165866969 19:38945399-38945421 GTGGAGCCAGAGCCTGGGGGAGG + Intronic
1165866993 19:38945463-38945485 GTGGAGCCAGAGCCTGGGGGAGG + Intronic
1165867111 19:38945758-38945780 GTGGAGCCAGAGCCTGGGGGAGG + Intronic
1165958111 19:39514831-39514853 CTGGACAGGGAGCCTGGTGAGGG + Intergenic
1166135677 19:40775742-40775764 ATGGAGATAGGGTCTAGGGAAGG - Exonic
1166851745 19:45764646-45764668 ATGCACAGAGTGGCTGGGGAGGG - Intergenic
1167276977 19:48544898-48544920 AAGGTGACAGAGACTGGGGAGGG - Intergenic
1167405166 19:49301923-49301945 CTGGAGTTAGAACCTGGGGATGG - Intronic
1167433047 19:49464222-49464244 GTGGAGCGAGAGGCTGGGGCAGG + Exonic
1167591526 19:50406884-50406906 AGGGTGAGGTAGCCTGGGGAGGG - Intronic
1167644090 19:50696374-50696396 ATGGGGAGAGAGGGTGGGGCTGG - Intronic
1167667595 19:50831768-50831790 ATGGAGAGAGATCCAGGGGCTGG - Intronic
1167734664 19:51286288-51286310 AGGGAGAGAGAGTCGGGGGGCGG - Intergenic
1168125116 19:54278676-54278698 ACAGAGAGAGAGACAGGGGATGG - Intronic
1168290102 19:55353399-55353421 ATGGAGAGGGAGAAGGGGGACGG + Intronic
1168307415 19:55442974-55442996 GTGGGCAGAGAGGCTGGGGAGGG + Intergenic
1168308903 19:55451220-55451242 ATGGAGAGAGAGGCCAGGGCTGG + Intergenic
925408524 2:3625318-3625340 ATGGAGGGTGAGCCTGAGGCAGG + Intronic
925416504 2:3673470-3673492 CTGGAGTCAGAGCCTGGGGCAGG + Intronic
925588579 2:5487574-5487596 CTGGAGGGAGAGACTTGGGACGG + Intergenic
925642349 2:5998271-5998293 ATGAAGAGAAAGACTGGAGAGGG + Intergenic
926052668 2:9754714-9754736 CTGGAGAGAGAGGGTGGGCAGGG + Intergenic
926146555 2:10400051-10400073 TTGGATAGAGTGCTTGGGGAAGG + Intronic
926199611 2:10784947-10784969 GTTGAGAGAGAGCCTTGGGACGG - Exonic
926305942 2:11637299-11637321 ATGGAGCAAGAGCCTGTGGCTGG + Intronic
926714111 2:15910407-15910429 ATTGACAGAAAGCCTGGGAATGG + Intergenic
926722074 2:15968366-15968388 AGGAACAGAGTGCCTGGGGAGGG + Intergenic
927093178 2:19727944-19727966 GTGGAGGGAGCCCCTGGGGAAGG - Intergenic
927503170 2:23595792-23595814 GTGGAGAGACAGCATGGGAAGGG - Intronic
927860288 2:26556465-26556487 ATGGGCAGAGCTCCTGGGGAAGG - Intronic
928028816 2:27761626-27761648 AGGGAGGGAGAGCCTGTGGAGGG - Intergenic
929016645 2:37504002-37504024 ATGGAGAGAGAGGGGAGGGAAGG - Intergenic
929035520 2:37687986-37688008 ATGGAGTAAGACACTGGGGATGG - Intronic
929175906 2:38975980-38976002 AGCAAGAGTGAGCCTGGGGAAGG - Intergenic
929881506 2:45840943-45840965 CTGGGGACAGAGCCTTGGGAGGG + Intronic
930075977 2:47405950-47405972 AAAGAGAGAGAGCCTGTGCAGGG - Intronic
930237338 2:48900626-48900648 AAGGAGGGAGAGGCTGGGGCAGG + Intergenic
930927630 2:56838530-56838552 AGAGAGAGAGAGCATGGGGAGGG + Intergenic
931169836 2:59790980-59791002 AAGGCGAGGGAGGCTGGGGAGGG + Intergenic
931228570 2:60354720-60354742 TTGGAGAGCAATCCTGGGGAAGG - Intergenic
932460755 2:71880435-71880457 ATGTAGAGGGAGCATGAGGAAGG - Intergenic
933784456 2:85827773-85827795 CTGGAGAGAGATCCTGGGACAGG - Intergenic
933815042 2:86059903-86059925 ATGGAGAGTGGGGTTGGGGAGGG + Intronic
934521530 2:95023075-95023097 TTGCAGAGCCAGCCTGGGGAAGG - Intergenic
934813596 2:97305307-97305329 AAGGACAGCGAGGCTGGGGAAGG - Intergenic
934824099 2:97403173-97403195 AAGGACAGCGAGGCTGGGGAAGG + Intergenic
935532164 2:104247684-104247706 AGGGAAAGAGGGGCTGGGGAAGG + Intergenic
935665542 2:105508973-105508995 GTGGAGTGTGACCCTGGGGAGGG + Intergenic
935815064 2:106839638-106839660 ATGGAGGGAGAGACTGGGGGTGG - Intronic
935982397 2:108640241-108640263 AAGGACATGGAGCCTGGGGAAGG - Intronic
936060070 2:109289156-109289178 AGAGAGAGAGAGACAGGGGATGG - Intronic
936558108 2:113513489-113513511 ATGGACAGAGAGACAGGAGATGG + Intergenic
936618383 2:114071349-114071371 ATGGAGAGAGAGCCTCAGTGTGG - Intergenic
937155158 2:119713904-119713926 ATGGAGATGGAGCCTGGTGGTGG - Intergenic
937877624 2:126837303-126837325 AAGGGGACAGAGCCTGGGGCTGG + Intergenic
939387414 2:141518656-141518678 AGGGAGAGAGAGGCCGGGCATGG + Intronic
940004992 2:149002040-149002062 ATGGAGGAGGAGCCTGTGGAGGG + Intronic
940092065 2:149931763-149931785 AGGGAGAAATAGCCTGGGGGAGG - Intergenic
940199270 2:151132142-151132164 AGAGAGAGAGAGGCTGGGCATGG + Intergenic
941158891 2:162012814-162012836 GTGGAGAGATGGGCTGGGGAGGG - Intronic
941390081 2:164901373-164901395 ATGGAAAGATATCCTGTGGATGG - Intronic
941542732 2:166806693-166806715 ATGGAGAGAGAGACTCTGGCAGG + Intergenic
941753990 2:169164892-169164914 ATGGAAAGAGATTTTGGGGAAGG + Intronic
941872010 2:170395768-170395790 AAGGAAAGAGAGACTGGGAACGG + Intronic
941900485 2:170673270-170673292 ATGGAGAGAGAACCTGCCCAAGG - Intergenic
942044182 2:172089913-172089935 AAGGAGAGAATGCCTGGCGAGGG + Intergenic
942157111 2:173141614-173141636 AAGGAGAGAGAGAGAGGGGATGG + Intronic
942657183 2:178226141-178226163 ATGCAGTGACAGCCTGGGTAGGG + Intronic
942664923 2:178307316-178307338 AGGGAGAGAGAGTGTTGGGAGGG - Intronic
943784232 2:191859467-191859489 AGGGAGAGAAAGACTGAGGATGG - Intergenic
944822451 2:203444141-203444163 AGAGAGAGAGAGGCTGGGCACGG + Exonic
944975135 2:205041479-205041501 ATGGAGAGAGAACCTGGAGGAGG - Intronic
945114084 2:206393825-206393847 AGGGAGAGAGAGCTTGTGCAGGG - Intergenic
945401639 2:209389439-209389461 ATGAAGAGAAAGCTTCGGGATGG - Intergenic
945538584 2:211053405-211053427 ATGGAGAGTGGACTTGGGGACGG - Intergenic
945643403 2:212460078-212460100 AAGGAGAGAGAGCTTGTGCAGGG - Intronic
946227273 2:218270605-218270627 AAGGAGAGGGACCCCGGGGAGGG + Intronic
946712232 2:222517876-222517898 ATGGCCAGAGAACCTGGGGCTGG - Intronic
947435245 2:230067788-230067810 ATGGGGTGAGAGACCGGGGACGG - Intronic
947536749 2:230944414-230944436 AAGGGGAGAAAGCCTGTGGAGGG + Intronic
947546590 2:231014903-231014925 AGGCAGAGAGAGCCTTGAGAAGG - Intronic
947665464 2:231902758-231902780 ATGGATACAGACCCTGGGGTGGG - Intergenic
947690508 2:232131852-232131874 ATGAATGGAAAGCCTGGGGATGG + Intronic
948048210 2:234959379-234959401 AGAGAGAGAGAGCCTGGACAAGG + Intronic
948310876 2:236985689-236985711 GTGGAGAGCTAGGCTGGGGAAGG - Intergenic
948553656 2:238792701-238792723 ATGGAGAGGGATCCTGGTGATGG - Intergenic
1168786234 20:543029-543051 ATGGAGAGAAAGCTTGGCTAAGG - Intronic
1169390446 20:5186326-5186348 CTGGAGAGAGGCCATGGGGAAGG - Intronic
1169866003 20:10200680-10200702 ATGGAGAGAGAGACTGGTTCTGG + Intergenic
1170385855 20:15815993-15816015 ACGGAGAGATGGACTGGGGAAGG - Intronic
1170639472 20:18138568-18138590 ATGGAGAGTGAGTACGGGGAAGG - Intronic
1171311719 20:24150245-24150267 ATGGAGAGAGACGCTGCTGAGGG + Intergenic
1171365290 20:24618353-24618375 GAGGGGGGAGAGCCTGGGGAAGG + Intronic
1171401444 20:24875180-24875202 AGGGAGGGAGAGCCAGGTGAGGG - Intergenic
1172442653 20:34977053-34977075 AGGGAGAGAGAGAGGGGGGAGGG - Intronic
1172719513 20:36988862-36988884 AGGAAGAGAGAGCAGGGGGAGGG - Intergenic
1172799437 20:37565680-37565702 GTGGAGAGTGGGCCTGGGCAGGG + Intergenic
1172842179 20:37908520-37908542 ATGGAGAGATTGGCTGGGCACGG + Intronic
1173067814 20:39729756-39729778 AGAGAGAGAGAGACAGGGGAGGG - Intergenic
1173291340 20:41717679-41717701 CTGGACAGAGAACGTGGGGAAGG - Intergenic
1173344526 20:42186557-42186579 GAGATGAGAGAGCCTGGGGAAGG + Intronic
1173762483 20:45575812-45575834 ATGGAAACAGGGCCTGGGGCTGG - Intronic
1173803824 20:45911451-45911473 ATGGCGAGCGGGCCTGGGGGTGG + Exonic
1173806431 20:45928581-45928603 AGAGAGAGAGAGACTGGGCATGG + Intergenic
1174018422 20:47508504-47508526 AAGAAGAGAAAGCATGGGGAGGG + Intronic
1174149583 20:48476660-48476682 ATGGAGCTAGAGACTGGGGGAGG - Intergenic
1174253387 20:49236031-49236053 ATGGGGATAGAGGCTGGGCACGG - Intronic
1174532064 20:51222044-51222066 AGAGAGAGAGAGCCAGGGGGAGG + Intergenic
1174701388 20:52612622-52612644 AAAGAGAGAGAGCTTGGGCAGGG - Intergenic
1175663375 20:60836818-60836840 AGGCAGAGAGAGGCTGGGAATGG - Intergenic
1175760059 20:61556348-61556370 ATGGAGAGAGAGGCTCCGGGGGG + Intronic
1175891313 20:62317280-62317302 ATGCAGACAGGGCCTTGGGAGGG - Intronic
1175936093 20:62514778-62514800 ATGGAGAGAGAGCAGGGCCAGGG - Intergenic
1176034591 20:63030005-63030027 GTGGAGGCAGAGCCTGGGGCTGG + Intergenic
1176040475 20:63062892-63062914 ATGGGGACAGAGCCTGGGTTTGG - Intergenic
1176058821 20:63163056-63163078 GAGGAGAGAGAGCCTTGAGATGG + Intergenic
1176383515 21:6125739-6125761 ATGGTGGGAGAGGCCGGGGAGGG + Intergenic
1177061311 21:16377478-16377500 ATGGTGAGAGAGGCTGCAGAGGG - Intergenic
1177893555 21:26835171-26835193 AAAGAGAGAGAGCCTGTGCAGGG - Intergenic
1178390986 21:32198209-32198231 AAGGAAAGAGGGCCTGGGAAGGG + Intergenic
1178673553 21:34612909-34612931 AGGGATAGAGAGCAAGGGGAGGG - Intronic
1178736552 21:35157659-35157681 AAAGAGAGAGAGCCTGTGCAGGG - Intronic
1178917265 21:36713055-36713077 TTGGGGAGAGAGAATGGGGAGGG + Intronic
1178998935 21:37436156-37436178 ATGGATTGAGAGTCTGGGAAAGG + Intronic
1179503514 21:41824607-41824629 GTGGACAGAAAGACTGGGGACGG + Intronic
1179538473 21:42067987-42068009 AGGGAGAGAGAGATGGGGGAGGG + Intronic
1179739955 21:43412499-43412521 ATGGTGGGAGAGGCCGGGGAGGG - Intergenic
1180082601 21:45493623-45493645 CTGTGGAGACAGCCTGGGGAGGG + Intronic
1181393494 22:22600961-22600983 AGGGAGAGAGACGCTGGGGGTGG - Intergenic
1181414183 22:22747482-22747504 GTGGGGACTGAGCCTGGGGAAGG - Intronic
1181534079 22:23532881-23532903 GGGCAGAGACAGCCTGGGGAAGG + Intergenic
1181639497 22:24189244-24189266 ATGGAGAGAGAGCCTGGGGAGGG - Intergenic
1181666920 22:24404844-24404866 AAGGGCAGAGGGCCTGGGGATGG - Intronic
1181972336 22:26700525-26700547 ATGGACAGTGAGGGTGGGGATGG - Intergenic
1182042528 22:27249476-27249498 ATAGAGAGAGAGCCTGGGTTGGG + Intergenic
1182171127 22:28230632-28230654 ATACAGAGAGAGACTGGGGGAGG + Intronic
1182185597 22:28398344-28398366 ATGGAGAGGGAGCCAGAAGAGGG + Intronic
1182421807 22:30252134-30252156 ATTCAGGGAGAGCCTGGGGGAGG - Intergenic
1182686515 22:32124322-32124344 ATGGAGGCATAGCCAGGGGAAGG + Intergenic
1182866189 22:33606584-33606606 GTGGAGAGAGAGCACGGGGTAGG - Intronic
1184092356 22:42299337-42299359 ATGGAGAGAGTGCCAGAGCAGGG - Intronic
1184274814 22:43404256-43404278 AGGGACAGAGAAGCTGGGGAGGG - Intergenic
1184321142 22:43742946-43742968 CTGGAGAGCAAGGCTGGGGAAGG + Intronic
1184637821 22:45849200-45849222 ATGGAGAGAGAGACTTGAGTTGG + Intergenic
1185014847 22:48336798-48336820 ATGCGGAGAGGCCCTGGGGATGG - Intergenic
1185075181 22:48679082-48679104 ATGGACAGGGAGCCGGGAGAGGG - Intronic
1185075189 22:48679105-48679127 ATGGACAGGGAGCCGGGAGAGGG - Intronic
1185075197 22:48679128-48679150 ATGGACAGGGAGCCGGGAGAGGG - Intronic
1185075212 22:48679174-48679196 ATGGACAGGGAGCCGGGAGAGGG - Intronic
1185075437 22:48679765-48679787 ATGGACAGGGAGCCGGGAGAGGG - Intronic
949111711 3:269426-269448 ATGGAGAGAGATGGTAGGGAGGG + Intronic
949453361 3:4211962-4211984 AGGGACAGAGCACCTGGGGAAGG + Intronic
949583408 3:5413052-5413074 TTGGACAGAGCACCTGGGGAAGG + Intergenic
949735423 3:7166498-7166520 GTGGAGACAGTGGCTGGGGAAGG - Intronic
949740637 3:7229694-7229716 ATGGAGAGCGGGGTTGGGGAAGG - Intronic
950284494 3:11733970-11733992 ATGGAGAAAGAGCATGGAGAAGG + Intergenic
950866074 3:16190305-16190327 CTGGAGGGGGAGCCTGAGGATGG - Intronic
951125118 3:18975539-18975561 ATAGAAAGAGAGACTGGGGTAGG - Intergenic
951265597 3:20562144-20562166 AGGGAGAGAAAGGGTGGGGAGGG + Intergenic
951465398 3:22995849-22995871 TTGGACAGAGACCCTGGAGAAGG + Intergenic
951698681 3:25472296-25472318 ATGAAAAGAGAGCGTGGGGGAGG + Intronic
951910281 3:27743172-27743194 AAGGATAGAGATACTGGGGAAGG + Intergenic
951950496 3:28195238-28195260 TTGGAGAGAGGGCTAGGGGATGG - Intergenic
952000565 3:28781115-28781137 ATGGAGAGAGGGCAAGAGGAAGG + Intergenic
952695799 3:36264194-36264216 AAGGACAGAGTGCCTGGGGGAGG - Intergenic
952900443 3:38108694-38108716 ATGGTCAGAGAGCCTGGAGTAGG + Intronic
952995873 3:38881779-38881801 ATGCAGAGGGTGCCAGGGGAAGG - Intronic
953367096 3:42354216-42354238 ATGGAGCCAGAGAGTGGGGATGG - Intergenic
953928227 3:46993094-46993116 ATGAAGACAGAGCCAGGGTAGGG - Intronic
954287758 3:49630852-49630874 ATGGAAAGAGAGCCAGAGGCAGG + Intronic
954288801 3:49638144-49638166 ATGGAGAGCCAGCTTGGAGAGGG + Intronic
954474024 3:50726339-50726361 AGGAAGGGAGAGACTGGGGAAGG + Intronic
955019541 3:55105979-55106001 ATGGAGAGTCAGCCTGGGGAGGG + Intergenic
955170401 3:56558148-56558170 AGGGAGAGAGAGGCTGGGAAAGG - Intronic
955756822 3:62233352-62233374 CTGGGGAGAGAGCATGGGGAAGG - Intronic
956078368 3:65530867-65530889 ATGGAGAGAGAGAAAGAGGAGGG + Intronic
956301853 3:67781189-67781211 AGGGACAGAGCACCTGGGGAAGG - Intergenic
956426922 3:69145329-69145351 CTGCAAAGGGAGCCTGGGGAGGG + Intergenic
959002257 3:100977897-100977919 ATGCAGAGAGGGCCTCGAGATGG - Intronic
959571113 3:107885150-107885172 ATGGAGACAGCCCCAGGGGAAGG + Intergenic
959620178 3:108391471-108391493 TTGGAGTGAGAGCCTGGAGCTGG + Intronic
959645437 3:108694533-108694555 AAGGAGAGAGAGCTTGTGCAGGG + Exonic
960275819 3:115728105-115728127 ATGGAGAGACAGCATGAGGGAGG + Intergenic
960883946 3:122375320-122375342 ATGGTGGGGGAGACTGGGGAAGG + Intronic
961513579 3:127419426-127419448 ATCTAGAGAGAGCCTTGGGGTGG - Intergenic
961531771 3:127544452-127544474 CTGGAGAGACAGCCCTGGGAGGG + Intergenic
961597246 3:128028217-128028239 ATTGAGAGAGAGACTCTGGAGGG + Intergenic
961601037 3:128062262-128062284 CTAGAGGGAGAGCCTAGGGAGGG + Intronic
961809773 3:129515066-129515088 ATGGAGACAGAGCTAGGAGAGGG - Intronic
962177762 3:133172909-133172931 AAAGAGAGAGAGCTTGTGGAGGG - Intronic
962285724 3:134084358-134084380 AGGGAGAGGCAGCCTGGGAAGGG + Intronic
963003890 3:140707966-140707988 AGTGAGAGAGAGCATGGGGTAGG - Intergenic
963049263 3:141127714-141127736 ATGGAGACACAGGCTGGAGAAGG + Intronic
963237728 3:142972197-142972219 ATGGAGGGAGAGCCCAGCGAAGG + Intronic
964071256 3:152635900-152635922 ATGAAGAAAGACCCTGGTGAGGG - Intergenic
964570192 3:158102623-158102645 GAGCAGAGAGAGCCTGGGGTTGG - Intronic
964847075 3:161055766-161055788 AGAGAGAGAGAGATTGGGGAGGG - Intronic
964936759 3:162098617-162098639 ATGGAGACCGAGTCTGAGGAGGG + Intergenic
966464299 3:180212814-180212836 CTGGAGACACAGCCTGGGGATGG - Intergenic
966929059 3:184664022-184664044 ATGCAGAGAGAGCCCATGGAGGG - Intronic
967496829 3:190150983-190151005 GTGGTGATAGAGCCTGGAGAAGG - Intergenic
967721459 3:192820642-192820664 TTGCAGAGAGAGCCCGGGGCGGG - Intronic
967849129 3:194069408-194069430 ATGGAGGGCGTGCCTGGTGAAGG - Intergenic
968978660 4:3835053-3835075 ATGGAGAGAGAGAAGAGGGAAGG + Intergenic
969317390 4:6390449-6390471 CTGGGAAGGGAGCCTGGGGATGG - Intronic
969486443 4:7474935-7474957 ATGGAGACAGTGACTGGGGGAGG - Intronic
969493189 4:7511561-7511583 AGAGAGAGTGAGCCTGGGGTGGG + Intronic
970100753 4:12518838-12518860 ATGGAGAGAGAGCCTAGAATTGG - Intergenic
970491433 4:16579004-16579026 CTGGAGATAGAGAGTGGGGATGG + Intronic
970697586 4:18696336-18696358 ATGGAGAGAGAGGCACTGGAAGG - Intergenic
971753452 4:30679265-30679287 AAAGAGAGAGAGCTTGTGGAGGG - Intergenic
972408675 4:38769966-38769988 ATGGAGACAAAGCATGGGGAAGG - Intergenic
972421696 4:38893673-38893695 ATGGACAGAAAACCTTGGGAGGG - Intronic
972591112 4:40488029-40488051 AGAGAGAGAGAGGCTGGGCACGG + Intronic
972731489 4:41799342-41799364 AGGGAGAGAAACCCTGGGGCTGG - Intergenic
973960589 4:56105978-56106000 ACGGAGACAGAGCTTGGGGATGG - Intergenic
974230032 4:59100059-59100081 AAGGAGAGAGAGCTTGTGCAGGG + Intergenic
975173428 4:71259490-71259512 GGGGAGAGAGAAGCTGGGGAAGG + Intronic
975276315 4:72505821-72505843 ATGCAGAGAGATCCTGGTGCAGG - Intronic
975276541 4:72507801-72507823 ATAGACAGATAGCCTGTGGAGGG - Intronic
975902635 4:79170725-79170747 AAGGAGAGAAAGCCTGAGGCTGG - Intergenic
976184606 4:82431049-82431071 AAGGAGAGAAAGCCTGCGGTGGG + Intronic
976266884 4:83193352-83193374 ATGGAGAGATAGGCAGGGCAAGG - Intergenic
976282836 4:83342126-83342148 AGGAAGAGAGAGACTGGTGAAGG + Intergenic
976569781 4:86594618-86594640 CTGTAGAAGGAGCCTGGGGAGGG - Exonic
978621786 4:110640106-110640128 CTGGACTGGGAGCCTGGGGAAGG + Intronic
981830095 4:148989499-148989521 CTGGAAATAGAGCCTGGGGAAGG + Intergenic
982060750 4:151601964-151601986 ATAGAGAGAGAGCTTGTGCAGGG + Intronic
982266560 4:153543518-153543540 AGGCAGTGAGAGCCTGGGGAAGG + Intronic
982901958 4:161017190-161017212 ACAGAGAGAGAGCCTGTGCAGGG - Intergenic
984632565 4:182076181-182076203 AAGGAGAAAGAGGCTGGGCATGG - Intergenic
984846199 4:184110055-184110077 ATGGAAGCAGAGCCAGGGGAAGG + Intronic
985089480 4:186348680-186348702 AAGGAGACAGAAGCTGGGGAGGG - Intergenic
985651562 5:1110029-1110051 ATGGGCACGGAGCCTGGGGAAGG - Intronic
985712504 5:1437470-1437492 AGGGAAAGAGAGCGAGGGGAAGG + Intronic
985738544 5:1600434-1600456 ACGGAGAGAGAGACGGGGAAAGG - Intergenic
985860775 5:2469032-2469054 AAGGAAGGAGAGCCTGGAGATGG + Intergenic
986822832 5:11486575-11486597 TTGGAGGGAGAGACAGGGGAAGG + Intronic
986980410 5:13441624-13441646 ATGGGGAGTGAACCTGAGGAGGG - Intergenic
987042078 5:14072388-14072410 ATGGAGATAGAAGATGGGGAAGG - Intergenic
987190965 5:15478007-15478029 AGGGAGAGAGAGCTTGTGCAGGG - Intergenic
987207147 5:15639451-15639473 AAAGAGAGAGAGCCTGTGCAGGG - Intronic
987743372 5:21938176-21938198 CTGGAGAGAGAGCCAGGTGTTGG - Intronic
988649298 5:33130839-33130861 AAGAAGAGAGAGCTTGTGGAGGG - Intergenic
989173209 5:38494120-38494142 TGGGAGAGGGAGACTGGGGAGGG + Intronic
989285954 5:39700105-39700127 AGAGAGAGAGAGGCTGGGCACGG + Intergenic
990507059 5:56455503-56455525 ATGGACAGGAAGCCTGGAGATGG - Intergenic
990536966 5:56732666-56732688 AGGAAGAGGGAGGCTGGGGAAGG + Intergenic
991017322 5:61945967-61945989 AGGAAGAGAGGGGCTGGGGAGGG + Intergenic
991604975 5:68392182-68392204 ATGAAGAGAGAGAAAGGGGAGGG + Intergenic
991749540 5:69786323-69786345 CTGGAGAGAGAGCCAGGTGTTGG + Intergenic
991763569 5:69948317-69948339 CTGGAGAGAGAGCCAGGTGTTGG - Intergenic
991783756 5:70169812-70169834 CTGGAGAGAGAGCCAGGTGTTGG + Intergenic
991801120 5:70366141-70366163 CTGGAGAGAGAGCCAGGTGTTGG + Intergenic
991827480 5:70643905-70643927 CTGGAGAGAGAGCCAGGTGTTGG - Intergenic
991842799 5:70823377-70823399 CTGGAGAGAGAGCCAGGTGTTGG - Intergenic
991876202 5:71170187-71170209 CTGGAGAGAGAGCCAGGTGTTGG + Intergenic
992361604 5:76044056-76044078 TTGGAGGGAGAGCAGGGGGAGGG - Intergenic
992381856 5:76245322-76245344 ATGGAGAAACAGGCTGTGGAAGG + Intronic
993204557 5:84863213-84863235 ATGGAGAGAGAGGGAGGGAAGGG - Intergenic
993330584 5:86595074-86595096 ATGGAAAGAGAGGCTAGGCATGG + Intergenic
993596914 5:89868897-89868919 AAGGAGAGAGATTATGGGGAGGG + Intergenic
993724115 5:91348871-91348893 GTGGAGAGAGAGCTTGTGCAGGG + Intergenic
994624299 5:102198645-102198667 ATGGATTGAGAGCATGAGGAAGG + Intergenic
994816818 5:104595846-104595868 CTGGAGTGAGTGCCTGGTGAGGG - Intergenic
995038513 5:107562337-107562359 ATGGAGAGAGAGACAGACGATGG - Intronic
995550893 5:113280246-113280268 ATGGAAAGGGAACCTGGGGGTGG + Intronic
997057184 5:130458871-130458893 AAAGAGAGAGAGCCTGTGCAGGG - Intergenic
997815480 5:137013068-137013090 ACAGAGAGAGAGACAGGGGAAGG + Intronic
998405117 5:141869849-141869871 AGGGAGAGAGAGCCAGTGGAAGG + Intronic
998770708 5:145541680-145541702 TGGGGGAGAGAACCTGGGGATGG + Intronic
998813811 5:145992641-145992663 AGGGAGAGAGAGCTTGTGCAGGG + Intronic
999286046 5:150394992-150395014 ATGGAGAGGGAAGCTGGGGAGGG - Intronic
999908384 5:156168913-156168935 ATGCAGAGAGTGCCTGGGAAGGG - Intronic
999969373 5:156843917-156843939 ATTGAGAGTGAGGATGGGGAAGG + Intergenic
1000391283 5:160726018-160726040 ATGGAATGAGAGTCTGGGGAAGG + Intronic
1001266847 5:170279961-170279983 AGGGAGAGAGAGAGGGGGGAAGG + Intronic
1001268894 5:170296062-170296084 ATGAAGAGAAAGACTTGGGACGG - Intronic
1001547990 5:172582379-172582401 TGGGAGAGGGAGCCTGGGGAAGG + Intergenic
1001548648 5:172586573-172586595 AGGAAGAGCGAGGCTGGGGAAGG + Intergenic
1001651339 5:173318289-173318311 AGAGAGAGAGAGGCTGGGAATGG + Intronic
1002057502 5:176606977-176606999 AGGGACAGAGAGCCTGGTCAGGG + Intronic
1002526085 5:179816888-179816910 AGGGAGGGAGAGGCTGGCGAGGG + Intronic
1002565946 5:180113082-180113104 ATGGACAGAGGGACTGGGGATGG + Intronic
1002565985 5:180113196-180113218 ATGGACAGAGGGACCGGGGATGG + Intronic
1002568683 5:180128216-180128238 AGGGAGAGGGAGGCTGGGGCGGG - Intronic
1002790624 6:435179-435201 AGGGAGAGAGAGCCAGGTAAGGG - Intergenic
1002874486 6:1199537-1199559 GTGGAGAGAGACCCAGGGAAGGG + Intergenic
1003051700 6:2786454-2786476 ATGAAGGGAGATTCTGGGGATGG - Intronic
1003482387 6:6545917-6545939 CTGGAGAAGGAGCTTGGGGATGG - Intergenic
1003673383 6:8180565-8180587 CTGGAGAGAGAACTTGGGGGTGG + Intergenic
1005585530 6:27273014-27273036 GTAGAGAGAGAGCTTGGGGGAGG - Intergenic
1006276933 6:33012021-33012043 TAGGAGAGAGAACCTGGGAAAGG + Intergenic
1006316125 6:33292996-33293018 TTGGTGAGGGAGCCTTGGGATGG - Exonic
1006677390 6:35774209-35774231 CTGGAGAGGAGGCCTGGGGATGG - Intergenic
1007015507 6:38462758-38462780 ATGGAGAGAGAGATTGTGTATGG - Intronic
1007122317 6:39393214-39393236 AGGGAGAGAGGGCCTGCGGGTGG - Intronic
1007241013 6:40425220-40425242 AAGGAGAGAGACCCTGAAGATGG - Intronic
1007272908 6:40651771-40651793 CTGGAGGAAGAACCTGGGGAGGG - Intergenic
1007325006 6:41053133-41053155 AGAGGGAGAGAGCCTGGGGGAGG + Intronic
1007372671 6:41436872-41436894 ATGGAGTGGGTGCTTGGGGAGGG - Intergenic
1007607986 6:43130106-43130128 ATGGAGAAACGGCCTGAGGAAGG - Intronic
1007696646 6:43737916-43737938 AGAGAGAGAGAGCCTGCTGAGGG + Intergenic
1007715747 6:43855093-43855115 ATGAAGAGATGCCCTGGGGAGGG - Intergenic
1007720835 6:43884654-43884676 ATGGAGAGCCAGCCTCGGGGTGG + Intergenic
1008377773 6:50810756-50810778 GTGGAGAGAGAGGCAGGGGCAGG + Intergenic
1008392937 6:50973813-50973835 CTGAAGAGAGAGACTGGGAAAGG - Intergenic
1008475200 6:51928779-51928801 ATGCAGAGACAGCCAGGGTAAGG + Intronic
1008475544 6:51931955-51931977 ATGGAGAGAGAGGAGGGAGAAGG + Intronic
1008858559 6:56121193-56121215 ATGGTTACAGAGGCTGGGGAGGG + Intronic
1010052359 6:71521909-71521931 AAGGAGATAGAGATTGGGGATGG - Intergenic
1010450264 6:75994594-75994616 ATAGAGAGAGAGCTTGGGCAGGG + Intronic
1011172620 6:84522724-84522746 AGGGAGAAAGAGCCTGAGAATGG - Intergenic
1011458150 6:87574571-87574593 AGGGAGAGAGAGAATAGGGAGGG + Intronic
1011698340 6:89933096-89933118 ATGAAGAGATGTCCTGGGGAAGG - Intronic
1011838085 6:91458607-91458629 ATGAACCGAGAGGCTGGGGAAGG - Intergenic
1011908302 6:92402165-92402187 ATGGGGTGGGAGGCTGGGGAAGG - Intergenic
1012413246 6:98984211-98984233 TTGGAGATAGGGCCTGTGGAAGG + Intergenic
1013185871 6:107757429-107757451 ATGGAGAGTGTGGCTGGGGAAGG + Intronic
1013584753 6:111568559-111568581 AGGGAGAGTGTCCCTGGGGAGGG + Intronic
1014495690 6:122119160-122119182 AGGAAGAGAGAGCAAGGGGAAGG + Intergenic
1014980649 6:127942682-127942704 AAAGAGAGAGAGCTTGTGGAGGG + Intergenic
1015209587 6:130682190-130682212 ATGAAGAAAGGGCCAGGGGAGGG - Intergenic
1015751229 6:136561278-136561300 AGGGCGAGAGAGGTTGGGGAAGG - Intronic
1016041211 6:139433650-139433672 ATGGAGAGGGAGCCTGGCCTGGG - Intergenic
1016476639 6:144434418-144434440 AAGGAGAGAGAAGCTGGGGCTGG + Intronic
1016861383 6:148721958-148721980 AGGGAGAGAGAGCAGAGGGAGGG - Intergenic
1017125990 6:151065316-151065338 AGTGAGAGGGAGCCTGGGGCAGG - Intronic
1017454946 6:154593261-154593283 CTGGGGAGAGAGCTGGGGGAGGG - Intergenic
1018007294 6:159634262-159634284 ATGGAGAAACACCCTGGGGCAGG + Intergenic
1018219073 6:161560644-161560666 AGGATGACAGAGCCTGGGGATGG - Intronic
1018236868 6:161735101-161735123 TTGTAGAGAGAGGCTGAGGAGGG + Intronic
1018441303 6:163815962-163815984 CAGCACAGAGAGCCTGGGGAAGG - Intergenic
1018748388 6:166780358-166780380 ATGGGGAGAGAGATGGGGGAAGG + Intronic
1018783821 6:167092745-167092767 ATGGGAAGCGAGGCTGGGGACGG + Intergenic
1018847320 6:167564703-167564725 ATGCACAGAAACCCTGGGGAGGG + Intergenic
1018930807 6:168239287-168239309 AAGGAGAGAGGGGCTGGGCAGGG + Intergenic
1018953750 6:168394592-168394614 ATGGAGAGAGAGATGGGGGAAGG + Intergenic
1018986382 6:168640346-168640368 ATGGAGAGGAAGCATGGGGCAGG + Intronic
1019140311 6:169938461-169938483 GGGGAGGGAGAGCCTGGGGAGGG + Intergenic
1019153801 6:170025753-170025775 ATGGGGAGGGAGCATGTGGACGG + Intergenic
1019408755 7:897647-897669 ATGGAGGGGGCACCTGGGGAAGG + Intergenic
1019416957 7:932256-932278 CTGGAGAGGAAGGCTGGGGAGGG - Intronic
1019435429 7:1020041-1020063 GTGGGAAGAGAGGCTGGGGACGG - Intronic
1019484861 7:1284835-1284857 ATGGGGGCAGAGCCTAGGGATGG + Intergenic
1019563966 7:1670651-1670673 AGGGAGAGAGGCGCTGGGGAAGG - Intergenic
1020095985 7:5369606-5369628 AGAGAGAGAGAGACTAGGGAAGG + Intronic
1020410400 7:7885880-7885902 AAAGAGAGATAGCCTGGGCATGG - Intronic
1020439863 7:8205988-8206010 AGGGGGAGAGAGGCTGTGGAGGG - Intronic
1020552311 7:9621811-9621833 GTGGAGAGAGAGCCGCGGGCGGG - Intergenic
1021465053 7:20933075-20933097 AGGCAGAGACAGCCTGGAGATGG - Intergenic
1021527072 7:21600000-21600022 CTAGACAGAGAGGCTGGGGATGG + Exonic
1021782695 7:24121236-24121258 ATAAAAAGAGAGCCTCGGGAAGG - Intergenic
1021828140 7:24574034-24574056 ATGGAGAGCCGGCCTGGGGGCGG + Intronic
1021873423 7:25026339-25026361 ATGGAGAGAGCGCTAGGAGATGG - Intergenic
1022297988 7:29074715-29074737 AGAGAGAGAGAGCATGGGCAGGG - Intronic
1022502486 7:30891525-30891547 ATGGGGACAGAGGGTGGGGAGGG - Intronic
1022819034 7:33940447-33940469 CTGGAGGGAGACCCTTGGGAGGG + Intronic
1023879181 7:44308867-44308889 ATGGACAGAGGCCCCGGGGAGGG - Intronic
1023909417 7:44542651-44542673 ATGGGGAATGAGCCAGGGGATGG + Intergenic
1024231771 7:47368568-47368590 AGGGTGGGCGAGCCTGGGGAGGG + Exonic
1024263174 7:47587048-47587070 CAGGAGAGGGAGCCTGGGGAGGG + Intergenic
1024284297 7:47744101-47744123 ATGCAGAGAGAGCCCTAGGAAGG - Intronic
1024554956 7:50595518-50595540 GAGGAGAAAAAGCCTGGGGAAGG + Exonic
1024610495 7:51059990-51060012 ATGAAGGGAGGGCCTGTGGAGGG - Intronic
1024699982 7:51896356-51896378 ATGGAGCGAGGGTTTGGGGAAGG + Intergenic
1025607100 7:63047348-63047370 ATGGTGAGGGAGGTTGGGGAAGG - Intergenic
1026168016 7:67928337-67928359 AGGAAGAGAGAGCCAGGGGAAGG - Intergenic
1026609065 7:71841228-71841250 CCGGAGTGAGAGTCTGGGGAGGG - Intronic
1028101290 7:86823966-86823988 GGGGAGAGAGAGCCTGGAGCAGG + Intronic
1028281122 7:88929220-88929242 ACGGGGAGAGAGACTGGGGATGG + Intronic
1028810036 7:95075538-95075560 ATGGAGAGGTAGGCTGGGCATGG + Intronic
1028944647 7:96563313-96563335 ATTGAGAGTGAGGATGGGGAGGG + Intronic
1029115003 7:98232223-98232245 ATGGGGAGACAGGCTCGGGAGGG + Intronic
1029405669 7:100373005-100373027 ACCGAGAGAGGGCCTGGGGCAGG + Intronic
1029419714 7:100466377-100466399 ATTGAGACAGAGGCTGGAGAAGG - Intronic
1029479081 7:100802203-100802225 CTGGAGAGGGAGGCTGGGGCAGG - Intergenic
1029481665 7:100817176-100817198 CTGGATGGTGAGCCTGGGGAAGG - Exonic
1029556467 7:101273274-101273296 TTGGAGAGAATCCCTGGGGATGG + Intergenic
1029604257 7:101589159-101589181 CTGGAGAGAGAGCATGGGCTGGG + Intergenic
1029707306 7:102282729-102282751 ATGGAGCGAGAGCATGGAGAGGG + Intronic
1030868893 7:114732382-114732404 AAGGAGAGAGAGCTTGTGCAGGG - Intergenic
1030956601 7:115860633-115860655 ATGGTGATAGAGGGTGGGGAAGG - Intergenic
1031339596 7:120582597-120582619 ATGGAGAAAGAGGCAGAGGAGGG - Intronic
1031557150 7:123191493-123191515 ATGGAGAAAGAGCTTGGGAAGGG + Intronic
1031865971 7:127039546-127039568 ATGAGGAGGGAGCCTGTGGAGGG + Intronic
1031897238 7:127364645-127364667 AGGGAGACAGAAGCTGGGGAGGG + Intronic
1031910961 7:127516264-127516286 ATGAAGAAACAGCCTGAGGAAGG - Intergenic
1032012563 7:128356556-128356578 CAGGAGAGAGATCCTGGGAAGGG - Intronic
1032478727 7:132229732-132229754 ATGGGGAGGGAGCCTTGGGGAGG + Intronic
1032692564 7:134303675-134303697 ATGTATAGAGAGCTTGGGGCTGG + Intronic
1032767519 7:135012341-135012363 AGGGAGGGAGAGGCTGGTGATGG + Intronic
1032841782 7:135719925-135719947 AGGGGGAGAGAGACAGGGGAGGG + Intronic
1033461453 7:141550893-141550915 CAGGGGAGAGAGCCTGGAGAGGG - Intergenic
1033600927 7:142888005-142888027 CTGGGGAGAGAGGCTGGGGGAGG + Intergenic
1034125154 7:148664680-148664702 ATGGAATGTGAGCCTGGGCAGGG - Intergenic
1034339958 7:150346539-150346561 AGGGAGAGAGAGACTCAGGAGGG + Intergenic
1034369839 7:150585253-150585275 ATGGAATGAGAGACTGGAGAAGG + Intergenic
1034390973 7:150787497-150787519 AAGGAGGGAGAGCCTGGCCAGGG - Intergenic
1034904081 7:154928780-154928802 GTGATGGGAGAGCCTGGGGAGGG + Intronic
1035174016 7:157037712-157037734 AAGGGGAGGGAGCCTGGGGAGGG + Intergenic
1035630637 8:1104366-1104388 ATGTAAAGAGAGCCTGGGAGAGG + Intergenic
1035718241 8:1770331-1770353 ATGGAGTGAGATGCAGGGGATGG + Intronic
1036101859 8:5795690-5795712 ATGGGGAGAGAGAAGGGGGATGG - Intergenic
1036191855 8:6678183-6678205 ATGGGGAGAGAGGTGGGGGAAGG - Intergenic
1036414629 8:8535578-8535600 ATGGAAAAAGAGACTGGGGTGGG + Intergenic
1036652434 8:10653980-10654002 CTGGGGAGGGAGCCTGGGGCAGG + Intronic
1036777833 8:11625677-11625699 ACGGTGAGGGAGGCTGGGGAAGG + Intergenic
1037888582 8:22608695-22608717 AGGGAGAGTGAGACTGAGGAAGG - Intronic
1037923091 8:22821683-22821705 AGGGAGAAAGAGGCTGAGGAGGG + Intronic
1038096097 8:24312027-24312049 GTGGGGAGAGAGTCTGGGGGTGG - Intronic
1038729759 8:30116368-30116390 ATGGACAGGGAGGCGGGGGATGG + Intronic
1038833587 8:31092746-31092768 ATGGAAGGACAGACTGGGGAGGG - Intronic
1038916581 8:32031201-32031223 ATGGAGACAGAGCCTGGTGATGG - Intronic
1039064781 8:33598904-33598926 ATGGGGACAGAGCATGGGCAGGG - Intronic
1039109623 8:34027641-34027663 ATGGAGAGACAGACTGGTGAGGG - Intergenic
1039503826 8:38037095-38037117 ATGGAGAGAGACCCCAGGCATGG - Intronic
1039599613 8:38824081-38824103 ATGGAGAGATGGCTGGGGGAGGG - Intronic
1039950187 8:42164935-42164957 AGGGAGAGAGAGGAAGGGGAGGG + Intronic
1041935835 8:63331014-63331036 ATTGAGAGGGAGCCTGGGTTCGG + Intergenic
1042167547 8:65960186-65960208 ATGCAGAGAGGCCCTGGGGGAGG + Intergenic
1042719544 8:71812534-71812556 ATGGAGAGGGAGCCTGCAGCAGG - Intergenic
1042840479 8:73118466-73118488 GTGCTGAGAGAGCATGGGGAAGG - Intronic
1043300581 8:78726060-78726082 ATGGAGAAAAAGCATGGGGGTGG + Intronic
1043997979 8:86842918-86842940 TTGGAGCTAGAGCCTGGGAAGGG - Intergenic
1044163663 8:88952873-88952895 AAAGAGAGAGAGCCTGTGCATGG - Intergenic
1044598503 8:93981064-93981086 ATGGAGACAAGACCTGGGGAGGG + Intergenic
1045270311 8:100655726-100655748 GTGGACAGTGAGGCTGGGGAGGG + Intronic
1045508014 8:102792293-102792315 AGAGAGAGAGAGGCTGGGCACGG - Intergenic
1046564199 8:115877896-115877918 ATGGAGAGAGAGTGGGGGAAAGG + Intergenic
1046602815 8:116337461-116337483 ATGGATAGGGAGCTTTGGGAAGG + Intergenic
1046761207 8:118022836-118022858 ATGGAGGTAATGCCTGGGGAAGG + Intronic
1046997552 8:120541291-120541313 GTGGAGAGAGGGCCAGAGGAGGG - Intronic
1047370154 8:124249494-124249516 AAGGAGACCGTGCCTGGGGATGG + Intergenic
1048078386 8:131098083-131098105 AGGGAGAGAGGGCCTGGAGGAGG + Intergenic
1048211741 8:132459794-132459816 AAGGAGAGGGAGCCTAGTGAGGG - Intronic
1048295855 8:133212854-133212876 CTGGAGAGAGGGCCTGCGGGGGG - Exonic
1048577730 8:135706230-135706252 ATGGAGGGAGAGTGTGGGGGAGG + Intergenic
1048981478 8:139705156-139705178 AAGGAGATAAAGCCTGGAGAGGG - Intergenic
1049120774 8:140735217-140735239 CGGGAGAGAGGGCCTGGGGGTGG - Intronic
1049221013 8:141428946-141428968 GTGGGGAGAGAACCCGGGGAAGG - Intronic
1050244570 9:3674743-3674765 ATGGAGGGAGAGGCAGGAGAGGG + Intergenic
1050606378 9:7305656-7305678 GTGGAGAGAGGGCCTGTGAATGG - Intergenic
1051703353 9:19849093-19849115 GTGGGCAGAGACCCTGGGGAAGG + Intergenic
1053202072 9:36159534-36159556 ATGGACACATAGCCTGGTGAAGG + Intronic
1053305610 9:36982451-36982473 AAGGAGAGAAGGCCTGGAGATGG + Intronic
1053423658 9:37997200-37997222 ATGGAGATACAGCCTGTGGCCGG - Intronic
1053735958 9:41102768-41102790 ATGGACAGAGAGACAGGAGATGG - Intergenic
1054692415 9:68328631-68328653 ATGGACAGAGAGACAGGAGATGG + Intronic
1054961583 9:70975992-70976014 ATGGAGATAGGGGCTGGGGGAGG - Intronic
1055266038 9:74497314-74497336 ATGGAGAGAGAGCGCTGAGAGGG - Intergenic
1055300047 9:74873275-74873297 AGGCTGAGAGAGCATGGGGAAGG - Intronic
1055485789 9:76755361-76755383 ATGGAGAGAGAGAATGAGGGAGG + Intronic
1055681348 9:78718819-78718841 ATGGTGAGAGAGTTTGGTGAAGG + Intergenic
1056266485 9:84901760-84901782 ATGGAGAAGAAGCCAGGGGAGGG - Intronic
1056319797 9:85425267-85425289 AGGGAGAGAGAGCACCGGGAAGG - Intergenic
1056526356 9:87446461-87446483 GTGAAGAGAGAGACTTGGGAAGG - Intergenic
1056691310 9:88810921-88810943 AAGGAGAGAAAGCCTGAGGGTGG - Intergenic
1056872068 9:90291016-90291038 ATGCATAGATAGCCTGGGTATGG + Intergenic
1057253674 9:93525419-93525441 AGGGACAGATACCCTGGGGATGG + Intronic
1057494481 9:95550093-95550115 ATAGAGAGATTGTCTGGGGATGG + Intergenic
1057745653 9:97748827-97748849 CTGGAGAGATGGCCTTGGGAAGG - Intergenic
1057851544 9:98570545-98570567 ATGGAGACAGAGCATGGGAAAGG - Intronic
1057868655 9:98701490-98701512 AGGGAGGAAGACCCTGGGGAAGG + Intronic
1058027565 9:100158916-100158938 AGGGAGAGAGAGAACGGGGAAGG - Intronic
1058379811 9:104364961-104364983 AGAGAGAGAGAGCCTGACGAGGG - Intergenic
1058903357 9:109460716-109460738 AGGGAGAGAGTGCCAGGGCAAGG - Intronic
1059223083 9:112644266-112644288 GTGCAGACAGATCCTGGGGACGG + Intronic
1059321230 9:113471648-113471670 ACGGAGAGAGAGAGCGGGGAGGG - Intronic
1059375669 9:113879149-113879171 AAGGAGAGATGGGCTGGGGAGGG + Intronic
1059419800 9:114183769-114183791 CTGGAGACAGAGCCAGGGGGAGG + Intronic
1059424403 9:114211609-114211631 ATGGAGAAAGAGCCAAGGCACGG + Intronic
1059930476 9:119255429-119255451 ATGATGACAGGGCCTGGGGATGG + Intronic
1060041266 9:120303749-120303771 ATGGAGAGAAAGCCAGTGGAAGG + Intergenic
1060277296 9:122191858-122191880 ATGGAGGGGGAGCCTGCGGGAGG - Intronic
1060310522 9:122456171-122456193 AGGGAGGAAGAGTCTGGGGATGG + Intergenic
1060354716 9:122894587-122894609 ATGAAGAGAGAGGCTGGGCACGG + Intronic
1060996160 9:127875818-127875840 AGACGGAGAGAGCCTGGGGAGGG - Intronic
1061026827 9:128055296-128055318 AGGGAGAGAGAGGAAGGGGAGGG + Intergenic
1061315134 9:129790707-129790729 ATGGAAAGAAGGCCTGGGAAAGG - Intergenic
1061389913 9:130311745-130311767 AGGCAGAGAGAGGGTGGGGAGGG + Intronic
1061587524 9:131578528-131578550 AGGGAGGGAAAGCCAGGGGATGG + Exonic
1061614922 9:131773324-131773346 AGGCAGAGGGAGCCAGGGGAAGG - Intergenic
1062262340 9:135669174-135669196 AGAGAGAGAGAGCCTGTGCAGGG - Intergenic
1062351640 9:136142535-136142557 GTGGAGAGGGAGCCCTGGGAGGG - Intergenic
1062467100 9:136686327-136686349 ATGTAGCAACAGCCTGGGGACGG + Intronic
1185604667 X:1361176-1361198 ATGGAGAGAGAGAGAGGGGAAGG - Intronic
1185874592 X:3692098-3692120 AGGGAGAGCGAGAGTGGGGAGGG + Intronic
1186554957 X:10548220-10548242 ATGGAGAGGGAGCTTTGAGAGGG - Intronic
1187667246 X:21627635-21627657 AAAGAGAGAGAGCTTGTGGAGGG + Intronic
1188029209 X:25245716-25245738 ATGAAGAGAGAGGCTGGGCATGG - Intergenic
1189066245 X:37812362-37812384 AAGGAGAAAGAGCTGGGGGAAGG + Exonic
1189211223 X:39285477-39285499 TGGGAGAGGGAGCCTGAGGAAGG - Intergenic
1189277443 X:39797292-39797314 AGGGAGGGAGAGGCTGGGCAGGG - Intergenic
1189885463 X:45540022-45540044 AAGGAGAGAGAGCCAGTGGCTGG - Intergenic
1190066669 X:47246083-47246105 ATGGAGAGGGATGGTGGGGAAGG - Intronic
1190726776 X:53195056-53195078 ATGGGCAGAGAACCTGGGGCAGG + Exonic
1190914779 X:54803234-54803256 ACGGAGTGAGACCCTGGGGGAGG + Intergenic
1190930972 X:54949567-54949589 ATGGAGAGATAGACTGTGCATGG - Intronic
1191696728 X:63997553-63997575 AAAGAGAGAGAGCCTGTGCAGGG - Intergenic
1191771785 X:64768119-64768141 ATGGAGAGAGAGTGGAGGGAAGG - Intergenic
1192135806 X:68599245-68599267 AGGGAGAGAGAACATGGTGAGGG - Intergenic
1193384455 X:80854285-80854307 ATGAAGAAAGAGGCTGGGCATGG - Intergenic
1194984778 X:100478530-100478552 AAGGATAAAGAGGCTGGGGAGGG - Intergenic
1195068752 X:101260184-101260206 ATGGAGAAAGGGGCTGGGAAAGG - Intronic
1195086063 X:101415787-101415809 AAGGAGAGAGAACCTGGAGAAGG + Intergenic
1195089097 X:101441456-101441478 AAGAGGAGAGAGCCTGGAGAAGG + Intronic
1195694747 X:107658708-107658730 ACGGAGTGAGACCCTGAGGAAGG + Intergenic
1196193014 X:112813737-112813759 ATGAAGAGAGAGTTTGGAGAGGG + Intronic
1196769797 X:119282101-119282123 ATGGAGAGGGAGGCCGGGCACGG - Intergenic
1197048494 X:122029365-122029387 ATGGAGAGAGAGCAACAGGAAGG + Intergenic
1197982954 X:132237611-132237633 ATCTAGAAAGAGCCTTGGGAGGG - Intergenic
1201282586 Y:12354175-12354197 TTGGGGTGAGGGCCTGGGGAGGG + Intergenic
1201862616 Y:18615880-18615902 AAGGAGCGAGAGGCTGGAGATGG - Intergenic
1201870707 Y:18704500-18704522 AAGGAGCGAGAGGCTGGAGATGG + Intergenic