ID: 1181643899

View in Genome Browser
Species Human (GRCh38)
Location 22:24220014-24220036
Sequence CGTACACACAGGCCCCCTCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 1, 2: 0, 3: 6, 4: 84}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181643896_1181643899 -6 Left 1181643896 22:24219997-24220019 CCTCAGGTCCGAGACGGCGTACA 0: 1
1: 0
2: 0
3: 2
4: 14
Right 1181643899 22:24220014-24220036 CGTACACACAGGCCCCCTCCTGG 0: 1
1: 1
2: 0
3: 6
4: 84
1181643889_1181643899 14 Left 1181643889 22:24219977-24219999 CCTGCGGCCTCCCCACTCTTCCT 0: 1
1: 0
2: 1
3: 59
4: 656
Right 1181643899 22:24220014-24220036 CGTACACACAGGCCCCCTCCTGG 0: 1
1: 1
2: 0
3: 6
4: 84
1181643891_1181643899 7 Left 1181643891 22:24219984-24220006 CCTCCCCACTCTTCCTCAGGTCC 0: 1
1: 0
2: 0
3: 49
4: 481
Right 1181643899 22:24220014-24220036 CGTACACACAGGCCCCCTCCTGG 0: 1
1: 1
2: 0
3: 6
4: 84
1181643894_1181643899 2 Left 1181643894 22:24219989-24220011 CCACTCTTCCTCAGGTCCGAGAC 0: 1
1: 0
2: 1
3: 10
4: 110
Right 1181643899 22:24220014-24220036 CGTACACACAGGCCCCCTCCTGG 0: 1
1: 1
2: 0
3: 6
4: 84
1181643892_1181643899 4 Left 1181643892 22:24219987-24220009 CCCCACTCTTCCTCAGGTCCGAG 0: 1
1: 0
2: 0
3: 15
4: 138
Right 1181643899 22:24220014-24220036 CGTACACACAGGCCCCCTCCTGG 0: 1
1: 1
2: 0
3: 6
4: 84
1181643893_1181643899 3 Left 1181643893 22:24219988-24220010 CCCACTCTTCCTCAGGTCCGAGA 0: 1
1: 0
2: 0
3: 7
4: 117
Right 1181643899 22:24220014-24220036 CGTACACACAGGCCCCCTCCTGG 0: 1
1: 1
2: 0
3: 6
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181643899 Original CRISPR CGTACACACAGGCCCCCTCC TGG Exonic
902685988 1:18078006-18078028 CAGACTCACAGGCCCACTCCAGG + Intergenic
906375483 1:45293330-45293352 CAAACACACAGGCTCCCTCCTGG - Intronic
1063002765 10:1940138-1940160 CGTCCACTCAGACCCCCTCCAGG + Intergenic
1070282885 10:75062647-75062669 GGTGCACACAGGCCGCCTTCAGG - Intergenic
1070812420 10:79305210-79305232 CTTGCACACAGGACACCTCCAGG - Exonic
1075069448 10:119311021-119311043 GGTACACACAGCCCCTCCCCTGG - Intronic
1076188497 10:128466907-128466929 CTTCCAGAGAGGCCCCCTCCAGG + Intergenic
1077026384 11:441807-441829 CACACACACAGGCGCCTTCCAGG + Intronic
1079127015 11:17724353-17724375 ATTACACACAGACCCCCTCTAGG - Intergenic
1083271948 11:61577146-61577168 CATGGAGACAGGCCCCCTCCAGG - Intronic
1089188343 11:116636358-116636380 AGGACACACAGGCCCGGTCCTGG - Intergenic
1092226686 12:6752736-6752758 CTTACACTCAGGCCTCCCCCAGG + Intronic
1095048984 12:37540880-37540902 CTCAGGCACAGGCCCCCTCCTGG + Intergenic
1096111544 12:49031879-49031901 ACCACAGACAGGCCCCCTCCAGG - Exonic
1106136929 13:26980373-26980395 AGTCCACACAGGCCACCTCTGGG + Intergenic
1115931643 14:38503446-38503468 CATACACACAGGGCCCTTCTAGG + Intergenic
1122216861 14:100210417-100210439 CATTCACACAGGCCCCTTCATGG - Intergenic
1122985987 14:105211816-105211838 CCTACATACAGGCTCCCTGCAGG + Intronic
1124340964 15:28888930-28888952 CGGGCACACAGGCTGCCTCCTGG - Intronic
1130553079 15:84904361-84904383 GATACACACAGGCCTTCTCCAGG - Intronic
1132093209 15:98962222-98962244 CTAAAACACAGGCGCCCTCCTGG + Exonic
1132207635 15:99997510-99997532 GGTACACGCAGGTCACCTCCCGG + Exonic
1132693516 16:1192178-1192200 GGGGCACCCAGGCCCCCTCCTGG + Intronic
1133983753 16:10652548-10652570 CACACACACACACCCCCTCCAGG + Intronic
1136716938 16:32288897-32288919 CCTGCACACAGGGCTCCTCCTGG + Intergenic
1136835313 16:33495142-33495164 CCTGCACACAGGGCTCCTCCTGG + Intergenic
1136936097 16:34465903-34465925 CCTACACAGTTGCCCCCTCCTGG - Intergenic
1136963724 16:34882667-34882689 CCTACACAGTTGCCCCCTCCTGG + Intergenic
1137486509 16:48895761-48895783 ACTACTCACAGGCCCCCTGCAGG + Intergenic
1141277572 16:82602407-82602429 AGTACGCACAGGCCCCCCTCTGG - Intergenic
1142302653 16:89267584-89267606 CCCACACACAGCCCCTCTCCTGG + Intergenic
1203009490 16_KI270728v1_random:228890-228912 CCTGCACACAGGGCTCCTCCTGG - Intergenic
1203145486 16_KI270728v1_random:1795463-1795485 CCTGCACACAGGGCTCCTCCTGG + Intergenic
1142978168 17:3657290-3657312 CCTGCACGCGGGCCCCCTCCTGG - Intronic
1146650795 17:34605065-34605087 CGAAATCACAGGCCCCATCCAGG - Intronic
1148348737 17:46923122-46923144 CGTCCTCACAGCCCCCCTTCCGG - Exonic
1152925539 17:83085948-83085970 CGTACCCACAAGACCCCTCTGGG - Intronic
1154067180 18:11118287-11118309 TGTACCCCCAGGGCCCCTCCAGG - Intronic
1154295345 18:13142285-13142307 CTGACACACAGGCTGCCTCCAGG + Intergenic
1157497816 18:48169037-48169059 GGTACACACAGACCCCCTTGGGG - Intronic
1159461143 18:68723717-68723739 GGTACATACAGCCCCACTCCTGG + Intronic
1160346622 18:78137580-78137602 CATCCACACAGGCCCCGTCCAGG - Intergenic
1160591240 18:79945738-79945760 CCCCCACACCGGCCCCCTCCAGG + Intronic
1161085862 19:2334595-2334617 CGTACTCACAGGCCACCTGCAGG - Exonic
1162312423 19:9914808-9914830 CCTGCACTCACGCCCCCTCCTGG + Intronic
1162893913 19:13753234-13753256 CTAATACACAGGCTCCCTCCAGG - Intronic
1165601932 19:37061016-37061038 CTCACGCACAGGCCCCCTCCTGG + Intronic
1166432896 19:42741678-42741700 CTCACACACAGGCACCATCCGGG - Intronic
933893067 2:86788997-86789019 CGGCCACAGCGGCCCCCTCCCGG + Intronic
935893732 2:107710463-107710485 CACACACACAGCCCCCCTGCAGG + Intergenic
945291686 2:208133608-208133630 CATTCACACATCCCCCCTCCCGG - Intergenic
1171543525 20:25984382-25984404 CTCAGGCACAGGCCCCCTCCTGG + Intergenic
1173066408 20:39717216-39717238 GGTACACCCAGGCCCACCCCTGG - Intergenic
1174560059 20:51424757-51424779 CGTACACACAGGTCCCCCATGGG - Intronic
1175272310 20:57743012-57743034 GACAGACACAGGCCCCCTCCTGG - Intergenic
1175693371 20:61082664-61082686 CAAACACACAGCCCCCATCCTGG + Intergenic
1175940891 20:62537054-62537076 CCTCCACACAGGCCTCCTCCTGG - Intergenic
1176122183 20:63458870-63458892 GACCCACACAGGCCCCCTCCCGG - Intronic
1176307398 21:5131043-5131065 CGTTCACACGGCCCCGCTCCTGG + Exonic
1179849662 21:44130987-44131009 CGTTCACACGGCCCCGCTCCTGG - Exonic
1181643899 22:24220014-24220036 CGTACACACAGGCCCCCTCCTGG + Exonic
1181673145 22:24435292-24435314 CCTGCAGACAGGGCCCCTCCTGG - Intronic
1183240392 22:36653485-36653507 GGCACACACAGGCCCCAGCCCGG - Intronic
1185066968 22:48637206-48637228 CTTACACACAGGCACGCACCAGG - Intronic
952237263 3:31492887-31492909 GGCACACACAGGCCCTCTTCAGG - Intergenic
960726680 3:120677396-120677418 CTTATAAACAGCCCCCCTCCAGG + Intronic
961674824 3:128558320-128558342 GGTTCCCACCGGCCCCCTCCTGG + Intergenic
965513953 3:169600595-169600617 GGTAGACTCAGGCCCACTCCAGG + Intronic
967890106 3:194358957-194358979 CCTGCGCCCAGGCCCCCTCCGGG - Exonic
984774296 4:183467267-183467289 CCTCCACACAGACTCCCTCCTGG + Intergenic
985571127 5:645889-645911 CGTCCACACAGGCCGCCGACGGG - Intronic
988195248 5:27996889-27996911 CTTGTACCCAGGCCCCCTCCAGG - Intergenic
1002528347 5:179828009-179828031 CGAAGCCACAGGGCCCCTCCTGG + Intronic
1002614059 5:180439435-180439457 TGTACACACAGACCCCGTCTGGG + Intergenic
1006804141 6:36777504-36777526 CGTCCACACAGGCCCCCTCCAGG - Intronic
1007653013 6:43434743-43434765 GGTATACACAGGCCGCATCCAGG - Exonic
1019308611 7:348021-348043 AGAACACAGAGGCCCCCACCGGG + Intergenic
1020082682 7:5295339-5295361 CGGACACACAAGCCACCCCCTGG + Intronic
1025294899 7:57769461-57769483 CTCAGGCACAGGCCCCCTCCTGG + Intergenic
1027270324 7:76515277-76515299 TGCACCCACAGGCCCCCTCAGGG + Exonic
1032461460 7:132114514-132114536 AGGACACACTGGACCCCTCCTGG + Intergenic
1034133086 7:148739028-148739050 CTTTCACACAGGCGCCCTTCAGG + Intronic
1034267515 7:149788415-149788437 CCTCCACACAGGCCACCACCTGG - Intergenic
1035274116 7:157737276-157737298 CGTCCACACAGGCCCCAGTCTGG - Intronic
1035362679 7:158323737-158323759 CACAAACACAGGCCTCCTCCAGG + Intronic
1036084775 8:5601382-5601404 TGCACACACAGGACTCCTCCGGG - Intergenic
1040276317 8:46015878-46015900 GGAAGACCCAGGCCCCCTCCTGG + Intergenic
1048872837 8:138813083-138813105 GTTTCACACAGGCCCCGTCCTGG + Intronic
1049225812 8:141449988-141450010 CATCCACACCAGCCCCCTCCTGG + Intergenic
1049428840 8:142549929-142549951 CGGCCACCCAGGCCCACTCCTGG + Intergenic
1062457631 9:136646939-136646961 CCTAGCCACAGGCTCCCTCCCGG + Intergenic
1198493455 X:137166784-137166806 CGTACTCACATGCCCCCTAGTGG - Intergenic