ID: 1181645719

View in Genome Browser
Species Human (GRCh38)
Location 22:24231046-24231068
Sequence TGTCAGGGGCGTGCACCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 124}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181645719_1181645735 25 Left 1181645719 22:24231046-24231068 CCCCCAGGTGCACGCCCCTGACA 0: 1
1: 0
2: 1
3: 12
4: 124
Right 1181645735 22:24231094-24231116 CCTGCTTCTGTGTCTGGGACTGG 0: 1
1: 0
2: 5
3: 40
4: 368
1181645719_1181645731 20 Left 1181645719 22:24231046-24231068 CCCCCAGGTGCACGCCCCTGACA 0: 1
1: 0
2: 1
3: 12
4: 124
Right 1181645731 22:24231089-24231111 GCCCACCTGCTTCTGTGTCTGGG No data
1181645719_1181645730 19 Left 1181645719 22:24231046-24231068 CCCCCAGGTGCACGCCCCTGACA 0: 1
1: 0
2: 1
3: 12
4: 124
Right 1181645730 22:24231088-24231110 AGCCCACCTGCTTCTGTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181645719 Original CRISPR TGTCAGGGGCGTGCACCTGG GGG (reversed) Intronic
902572535 1:17356031-17356053 TCACAGGGGCCTGCACCTGCTGG - Exonic
904684457 1:32250421-32250443 AGTCTGTGGCCTGCACCTGGGGG + Intergenic
913054862 1:115148552-115148574 TGTCAGCAGTGTGCCCCTGGTGG - Intergenic
918110349 1:181450232-181450254 TGTTGGGGGAGGGCACCTGGTGG - Intronic
918390400 1:184053653-184053675 TTTCAGGGGCCTACACCTGCAGG - Intronic
918789874 1:188812828-188812850 TGTCAGGGGAGGGCAGCTGGGGG + Intergenic
920048908 1:203151540-203151562 AATCAGGGGTGTGCTCCTGGTGG + Intronic
921584191 1:216928605-216928627 GGTCAGTGGCATGCAGCTGGAGG - Intronic
924799373 1:247316443-247316465 TGTCATGGGAGTGGAACTGGTGG + Intronic
1066974771 10:42357508-42357530 TGGCAGGGGAGGGCACCTGAGGG - Intergenic
1067080821 10:43211355-43211377 GGTCAGGGGTGTGACCCTGGAGG - Intronic
1067430265 10:46238078-46238100 TGCCAGTGGTCTGCACCTGGTGG - Intergenic
1067852309 10:49761851-49761873 GGTCAGCGCTGTGCACCTGGCGG - Intronic
1069340004 10:67398704-67398726 TGTCATGGGAGGGTACCTGGTGG + Intronic
1069439870 10:68418574-68418596 GGTGAGGGGCGGGAACCTGGTGG - Intronic
1069871333 10:71534995-71535017 TGTCAGGAGAGGGCCCCTGGGGG + Intronic
1070266487 10:74908082-74908104 TATCATGGGAGTGGACCTGGTGG + Intronic
1071243344 10:83735481-83735503 CGTCAGGGGGGTGATCCTGGTGG - Intergenic
1071412351 10:85409305-85409327 TGTCAGAGGGGTGGAGCTGGGGG - Intergenic
1073293832 10:102426365-102426387 TGTGAGGTGCGTGGAACTGGTGG - Intronic
1074756273 10:116626799-116626821 TCTCTGGGGTGTGCACCTGGGGG + Intronic
1076017505 10:127039968-127039990 GGGCAGGGGCGAGCACCTGAAGG - Intronic
1078428279 11:11268688-11268710 TGTCTGGTTCGAGCACCTGGTGG + Intergenic
1081715843 11:45249744-45249766 TGTCAGGGGTGGGGGCCTGGGGG + Intronic
1083889880 11:65590427-65590449 TGTCAGGGTAGGGCAGCTGGGGG - Intronic
1085278871 11:75317323-75317345 TGGGAGGGGAGAGCACCTGGAGG - Intronic
1091463266 12:662095-662117 GGTCAGGGGAGGGCTCCTGGGGG + Intronic
1091663356 12:2400753-2400775 TGTCAGGGCCGTGCACTCAGTGG - Intronic
1094821633 12:34230795-34230817 TCTCAGGGTCGTGCACATGCAGG + Intergenic
1096647678 12:53047433-53047455 TGCCAGGGGCGGGCGCCAGGGGG + Intronic
1097257845 12:57694242-57694264 TGTCGGGAGCCTGAACCTGGAGG + Exonic
1103857284 12:123981405-123981427 TGTCATGGGAGGGGACCTGGGGG + Intronic
1104746877 12:131216157-131216179 TGTCTGGGGAGAGCAGCTGGGGG - Intergenic
1104785740 12:131447026-131447048 TGTCTGGGGAGAGCAGCTGGGGG + Intergenic
1104958659 12:132477864-132477886 TGCCTGGGCCGTGCACCTCGGGG + Intergenic
1105484465 13:20813191-20813213 TGCCAGGGGCGGGGACCTGGTGG - Intronic
1106051210 13:26191489-26191511 TGTCAAGGGAGGGGACCTGGTGG + Intronic
1108473628 13:50791325-50791347 TGTCAGGGGCATGAAGCGGGTGG - Intronic
1112415507 13:99200733-99200755 AGTCAGGGGCGTGCGCCCGCTGG - Intergenic
1118162101 14:63301006-63301028 TGTCAGGGGCGTGGATAAGGAGG + Intergenic
1118495089 14:66300453-66300475 TGTCAGGGGTGGGGGCCTGGGGG + Intergenic
1118615128 14:67569810-67569832 TGTCACTGGCCTGCTCCTGGAGG + Intronic
1122142981 14:99673694-99673716 ACTGAGGGGGGTGCACCTGGAGG + Intronic
1122789294 14:104177564-104177586 TGACAGCGGCGTGAACGTGGGGG + Exonic
1128937330 15:71757961-71757983 TGTCAGCAGCCTGCCCCTGGAGG + Exonic
1129692227 15:77720351-77720373 GGGCAGGTGCGTGGACCTGGCGG - Intronic
1131825765 15:96321853-96321875 TGTCAGGGGCGGCCGCCGGGTGG - Intergenic
1133226491 16:4343246-4343268 TGTGATGGGCGTGCAGGTGGTGG - Exonic
1134667440 16:16028961-16028983 TGTCAGGGTCCTCCCCCTGGAGG + Intronic
1139316614 16:66076593-66076615 TGTCAGGGGGAGGCACCTGGTGG - Intergenic
1141961403 16:87411747-87411769 TGTAAGGGGCGTGCACGACGGGG + Exonic
1142175507 16:88643309-88643331 TTGCAGGTGGGTGCACCTGGCGG + Exonic
1144787559 17:17840372-17840394 TGCCCGGGACGCGCACCTGGCGG - Intergenic
1145244295 17:21258174-21258196 GGGCAGGGGCGTGCTCCTGGAGG + Intergenic
1146888117 17:36485952-36485974 TCTCAGGGGCGTGCAGGTGCAGG + Intergenic
1146907307 17:36626046-36626068 TGTCAGGTGCGTCCACCAGAGGG + Intergenic
1147374224 17:40014638-40014660 TGTCAGGGTCGTGCACGAGGAGG + Intergenic
1151885984 17:76923666-76923688 TGTGAGGTGTGTACACCTGGGGG - Intronic
1152610792 17:81314186-81314208 TGTCAGGGGCATGCAAAGGGTGG - Intronic
1152638595 17:81440230-81440252 TGTCAGGGGCGGGCAGGTGGCGG + Intronic
1152781871 17:82230351-82230373 AGTCTGGGGTGGGCACCTGGAGG + Intronic
1154195434 18:12262812-12262834 TGTCAGGGGCCTGAAAATGGAGG - Exonic
1161153741 19:2721876-2721898 GGTCAATGGGGTGCACCTGGAGG + Intronic
1162930987 19:13957546-13957568 TGTCAGATGCGTGCACATGTGGG + Intronic
1163594553 19:18213475-18213497 TGTCTGTGGCCAGCACCTGGGGG + Exonic
1163681258 19:18683886-18683908 TGTCCGGCGCGTGCACGGGGCGG + Intronic
1165454995 19:35905343-35905365 TGTCTGAGGCCTGCCCCTGGGGG - Intronic
1166404686 19:42511514-42511536 TGCCAGGGGAGGGCACGTGGTGG + Intronic
1166420983 19:42635578-42635600 TGAGAGGAGCCTGCACCTGGTGG - Intronic
1167509756 19:49889804-49889826 TGTCAGATGCGTGCCCCTCGGGG + Exonic
925180505 2:1814191-1814213 TGCCAGGGGCGTTCACCTAGCGG - Intronic
926005634 2:9371626-9371648 TGTCAGGGACGTGTAACTGGGGG + Intronic
929866477 2:45721431-45721453 TGTCAGGGGAGTGCAGAAGGTGG + Intronic
937154654 2:119710498-119710520 TGTCTGGGGTGGGCTCCTGGGGG - Intergenic
938675741 2:133632126-133632148 TGTCAGGAGTGTTCACCAGGGGG + Intergenic
943451237 2:188044803-188044825 TGTCAAGGGCGGGGACCAGGTGG - Intergenic
944317109 2:198295161-198295183 TGTCAGCGGAGTGAATCTGGGGG + Intronic
945977356 2:216281379-216281401 TGTCTGGGGCATGAACCAGGAGG + Intronic
1171436684 20:25130195-25130217 TCTGAGGGGCGTCCACCTGAGGG - Intergenic
1172448259 20:35004197-35004219 TGTGAGGGACGTGGACATGGGGG + Intronic
1174365426 20:50053537-50053559 TGTAAGGGGGGTGCTCCTTGAGG + Intergenic
1175305678 20:57974047-57974069 TGGCAGGAGCCAGCACCTGGTGG - Intergenic
1176025987 20:62985899-62985921 TGACAGGTGCTTGGACCTGGGGG + Intergenic
1179787876 21:43740119-43740141 CATCTGGGGGGTGCACCTGGGGG - Intronic
1180110562 21:45646573-45646595 TGTCATGGGAGTGGAGCTGGTGG - Intronic
1180722479 22:17919805-17919827 TGTCAGGAGCCAGGACCTGGAGG + Intronic
1181645719 22:24231046-24231068 TGTCAGGGGCGTGCACCTGGGGG - Intronic
1181682097 22:24502458-24502480 TGCCAGGGGCTTGGACCAGGTGG - Intronic
1183719541 22:39554445-39554467 TGTCAGGGGGGTGCATTAGGGGG + Intergenic
1184462616 22:44647886-44647908 GGGCAGGGGCTGGCACCTGGTGG - Intergenic
1185049042 22:48544141-48544163 TGTCTGGGGTGTGCACCCTGGGG + Intronic
949206777 3:1449505-1449527 TGTCAGGAGCCTGCACGTGTTGG + Intergenic
950106310 3:10391315-10391337 TGTGAGGGCCTTGCCCCTGGAGG - Intronic
950435905 3:12979972-12979994 TGCCAGGGGCATGCAGCTGGAGG + Intronic
950829609 3:15860196-15860218 TGGAAGGGGTGGGCACCTGGGGG + Intergenic
952225486 3:31371379-31371401 TGTCATGGGAGTGGAACTGGTGG - Intergenic
954580591 3:51700908-51700930 TGTCAGTGGCATGCACCTGGTGG - Intronic
954693678 3:52409585-52409607 TGTCAAGGGGGTGCAAGTGGAGG - Exonic
955224490 3:57049820-57049842 AGTCAGGGGGCTGCACCTAGTGG - Intronic
961045143 3:123703038-123703060 TGGCAGGCACCTGCACCTGGAGG + Intronic
961223670 3:125219802-125219824 TGTCATGGGCTGGGACCTGGTGG + Intergenic
964386865 3:156156678-156156700 TTTCAGGGGAGTGGATCTGGAGG + Intronic
968445127 4:648584-648606 TGGCAGGGGCCTCCAGCTGGAGG - Intronic
969704698 4:8785377-8785399 GGTAGGGGGCGTCCACCTGGAGG + Intergenic
971493081 4:27235006-27235028 TGTCATGGGAGTGGAACTGGTGG + Intergenic
974110132 4:57515467-57515489 TGTCATGGGCATGCACATGATGG - Intergenic
976751934 4:88457592-88457614 TGTGAGGGGCGGGCAGCCGGGGG + Intronic
976777077 4:88718695-88718717 TGTCAGGGACGTGATGCTGGGGG + Intergenic
977002489 4:91521030-91521052 TGTCAGGGGCGGGGGTCTGGGGG - Intronic
985741413 5:1619415-1619437 TTTGAGGGCCGTGCATCTGGAGG - Intergenic
985877713 5:2613033-2613055 TGTCAGGGTCGTGGACCCCGAGG + Intergenic
985909881 5:2870826-2870848 GGGCAGTGGCGTGCACATGGTGG + Intergenic
987083421 5:14446596-14446618 TGTGGGGTGCATGCACCTGGGGG + Intronic
992102701 5:73422539-73422561 TGTCAGTGCAGTGCAGCTGGTGG + Intergenic
997422867 5:133782939-133782961 TGTCAGGGACTTGCAGGTGGCGG + Intergenic
997918113 5:137949645-137949667 TGTCATGTGCCTGTACCTGGTGG + Intronic
999241943 5:150132957-150132979 CGTCAGGGGCGGGGCCCTGGGGG + Intronic
1001133208 5:169081144-169081166 TGTAAGTGGCAGGCACCTGGTGG - Intronic
1002043843 5:176531414-176531436 TGCCTGGGGCTTGCAGCTGGTGG + Intronic
1006388939 6:33747437-33747459 TGTCAGGGGATTACAGCTGGGGG + Intergenic
1013328283 6:109070228-109070250 TCTCAGAGGGGTGCAGCTGGAGG - Intronic
1014898379 6:126931909-126931931 TGCCAGAGGGGAGCACCTGGAGG + Intergenic
1018638411 6:165885008-165885030 CGGCAGGGGCGTGCACATGAAGG - Intronic
1019056358 6:169226182-169226204 GGTCAGGGTTGTGCACCAGGGGG + Exonic
1021286248 7:18784532-18784554 TGTCTGGGGCAAGCACCTGGTGG - Intronic
1023665446 7:42518242-42518264 TGTCAGTGGCTCTCACCTGGGGG - Intergenic
1024604315 7:51012023-51012045 TTTCAGGGGTGTGCTCCTGGGGG - Intergenic
1029226561 7:99033188-99033210 GGTCAGGGCCCTGCTCCTGGGGG - Intronic
1034121194 7:148629318-148629340 ACTCAGGGCCGTGCACCTGTGGG - Intergenic
1042886390 8:73556796-73556818 TGTCTGGGGAGTGGAGCTGGTGG + Intronic
1048594856 8:135855645-135855667 TGTCAGGGGAGGGCAGCTCGGGG - Intergenic
1049316751 8:141973321-141973343 GGTCAGGGGGCTGCATCTGGCGG + Intergenic
1049442874 8:142617225-142617247 TGTCAGGGACGGGCACGGGGTGG - Intergenic
1053511835 9:38694104-38694126 TGTGAAGGGCGTCCACATGGGGG + Intergenic
1061051082 9:128195737-128195759 TGTCAGGGGCTTGCACTATGAGG - Intronic
1062690678 9:137840707-137840729 TGTCAGCGGTGTGAACCTGTGGG + Intronic
1192236695 X:69300663-69300685 TGTCAGGGTCCTGGTCCTGGTGG - Intergenic
1196243747 X:113373784-113373806 TGTCAGGGGTGGGGGCCTGGGGG + Intergenic