ID: 1181647518

View in Genome Browser
Species Human (GRCh38)
Location 22:24241459-24241481
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 536
Summary {0: 8, 1: 3, 2: 16, 3: 66, 4: 443}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181647518_1181647522 10 Left 1181647518 22:24241459-24241481 CCTGCTTCTCTGGGAAACCTCAG 0: 8
1: 3
2: 16
3: 66
4: 443
Right 1181647522 22:24241492-24241514 TACGGCCTTCAACTGATTGGAGG 0: 2
1: 12
2: 20
3: 23
4: 64
1181647518_1181647523 13 Left 1181647518 22:24241459-24241481 CCTGCTTCTCTGGGAAACCTCAG 0: 8
1: 3
2: 16
3: 66
4: 443
Right 1181647523 22:24241495-24241517 GGCCTTCAACTGATTGGAGGTGG 0: 13
1: 172
2: 500
3: 826
4: 980
1181647518_1181647521 7 Left 1181647518 22:24241459-24241481 CCTGCTTCTCTGGGAAACCTCAG 0: 8
1: 3
2: 16
3: 66
4: 443
Right 1181647521 22:24241489-24241511 TCTTACGGCCTTCAACTGATTGG 0: 2
1: 65
2: 224
3: 484
4: 746
1181647518_1181647525 29 Left 1181647518 22:24241459-24241481 CCTGCTTCTCTGGGAAACCTCAG 0: 8
1: 3
2: 16
3: 66
4: 443
Right 1181647525 22:24241511-24241533 GAGGTGGCCCACCCATATTATGG 0: 10
1: 0
2: 25
3: 214
4: 880
1181647518_1181647519 -8 Left 1181647518 22:24241459-24241481 CCTGCTTCTCTGGGAAACCTCAG 0: 8
1: 3
2: 16
3: 66
4: 443
Right 1181647519 22:24241474-24241496 AACCTCAGTTTTTGTTCTTACGG 0: 10
1: 25
2: 78
3: 134
4: 457

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181647518 Original CRISPR CTGAGGTTTCCCAGAGAAGC AGG (reversed) Intronic
901146052 1:7065302-7065324 ATGAGGTTTCCCAGAGGGCCTGG + Intronic
902282975 1:15387951-15387973 CTGAGGTTTCTAGGAGACGCTGG - Intronic
904900914 1:33856366-33856388 CTGGGGTTCCCCAGAGAAAGAGG - Intronic
906549728 1:46654208-46654230 CTGAGCCTTCCCAGAGAGTCAGG + Intronic
906937277 1:50225482-50225504 CTGAGGCTGCACAGAGCAGCAGG - Intergenic
906990370 1:50731028-50731050 CTGGGCTTTCCCAGAGATACTGG + Intronic
907526218 1:55055710-55055732 CTGAGGCCTCCCAGGGAAGAAGG - Intronic
907862959 1:58371699-58371721 CTGAGGCTTCACAGAGCAGGGGG - Intronic
909075659 1:71047784-71047806 CAGAGGTTTCCCAGAGAGGAAGG - Exonic
909257956 1:73448357-73448379 CTGAGGCTGCACAGAGGAGCAGG + Intergenic
910103080 1:83599207-83599229 CTGAGGCTACACAGAGCAGCAGG + Intergenic
910460635 1:87444774-87444796 CTGAGGCTGCACAGAGTAGCAGG + Intergenic
912247288 1:107973004-107973026 CTGTCCTTTCCCAGAAAAGCTGG - Intergenic
913402195 1:118448752-118448774 CTGAGGCTGCACAGAGCAGCAGG - Intergenic
914234617 1:145797290-145797312 ATGAGTTTTGCCAGAGAAGGAGG - Intronic
914317872 1:146531042-146531064 CTGAGGCTGCGCAGAGTAGCAGG + Intergenic
914496484 1:148202316-148202338 CTGAGGCTGCGCAGAGTAGCAGG - Intergenic
914881010 1:151547218-151547240 CTGGGCTTTGCCAGAGAAGGAGG + Intronic
916512490 1:165484702-165484724 CTCAGGTTTCACAGACAATCAGG - Intergenic
916829218 1:168474270-168474292 CTGAGGCTGCACAGAGCAGCCGG - Intergenic
918364602 1:183794261-183794283 ATGATGTTTACCAGAGAGGCTGG + Intronic
918564690 1:185914934-185914956 CTGAGGATATCCAGGGAAGCAGG + Intronic
919368903 1:196700899-196700921 GTGAGTTTTCTCAGAGCAGCTGG + Intronic
919381531 1:196867252-196867274 GTGAGTTTTCTCAGAGCAGCTGG + Intronic
919532829 1:198746214-198746236 CTGACACTTCCCAGTGAAGCCGG + Intronic
920091473 1:203455999-203456021 TTGGGTTTTTCCAGAGAAGCTGG + Intergenic
920398880 1:205664838-205664860 CTGAGGTGCCCCACAGCAGCAGG - Exonic
920672002 1:208010841-208010863 CTGAGGTTGCCCAGCAAAGAAGG - Intergenic
921220483 1:212970186-212970208 CTGACCTTTTCCAGGGAAGCGGG - Intronic
921220741 1:212972039-212972061 CTGAGCTTTTCCAGGGAAGGGGG - Intronic
923139860 1:231151937-231151959 CTCAGGCTTCTTAGAGAAGCAGG + Intergenic
923172678 1:231431339-231431361 CCGAGGCTGCACAGAGAAGCAGG + Intergenic
923504065 1:234590585-234590607 CTGAGGTTTCCTGAAGAAGAAGG + Intergenic
924258593 1:242207020-242207042 GTGGGGTTTCCCAAAGAAGAAGG - Intronic
924720506 1:246618609-246618631 CTAAGGATTCCAAGAGCAGCAGG - Intronic
924812525 1:247415957-247415979 CTGAGGCACCCCACAGAAGCAGG - Intergenic
924932020 1:248740325-248740347 CTGAGTTTTCCCTGAGAAGAAGG + Intronic
1063185094 10:3643485-3643507 CTGAGGTTTCCCCCCAAAGCAGG + Intergenic
1063584083 10:7335122-7335144 CGGTGGTTGCCCAGAGAAGGGGG + Intronic
1064255858 10:13742298-13742320 CTGGGGAATCCCAGGGAAGCAGG + Intronic
1064543126 10:16425244-16425266 CTGAAGTCTCAGAGAGAAGCAGG - Intergenic
1065300666 10:24318391-24318413 CTGAGGTTTCCTTGAGGAGGAGG + Intronic
1066083463 10:31955032-31955054 CTGAGACTGCACAGAGAAGCAGG - Intergenic
1068870459 10:61937956-61937978 CTGTGGATTCACAGAGAAACTGG - Intronic
1069231141 10:66009814-66009836 CTCGGTTTTCCCAGAGAATCTGG + Intronic
1070274513 10:74992772-74992794 CTGACAAATCCCAGAGAAGCTGG - Intronic
1071049061 10:81423625-81423647 GTGAGGTATCCCAGAGAATGAGG + Intergenic
1071701820 10:87946836-87946858 CTCAGGGTTCCCAGTAAAGCAGG + Intronic
1072257154 10:93631215-93631237 ATGATGTTTCCCAGAGAACTGGG - Intronic
1072924534 10:99604981-99605003 CTGAGGTTTCCCAGAGAAGAAGG + Intergenic
1073445043 10:103575495-103575517 CAGAGGCTTCCCAGGGTAGCTGG + Intronic
1075215278 10:120527354-120527376 TTGAGGTTTCCCAGATAAGAAGG - Intronic
1075940823 10:126388805-126388827 CCGAGGGTTCCCAGAGAGCCGGG - Intergenic
1076060764 10:127412455-127412477 CGGAGGTTTCCCAGGCAAGACGG - Intronic
1076551756 10:131283269-131283291 CTTAGGTCTCCCTGAGAACCAGG + Intronic
1076845832 10:133069168-133069190 CTGAGGCCTCCCACAGCAGCTGG - Intergenic
1077218976 11:1407040-1407062 CTAGGGTTTCCCAGGGAAGGGGG + Intronic
1077279119 11:1734039-1734061 CTGCGGTTTCCCAGACCAGCTGG + Exonic
1077608348 11:3627329-3627351 CTGAGGATTCCCAGGGAGGCAGG - Intergenic
1077770093 11:5207927-5207949 CTGACGTTTACCACAGAACCTGG - Intergenic
1078151845 11:8766263-8766285 CTCAGGCTTCCCAGAGTGGCTGG + Intronic
1078467589 11:11561708-11561730 GTGTGGTTTCCCAGGGAAACAGG + Intronic
1078564932 11:12406256-12406278 CTGAGATTTCTCAGAGAAAATGG - Intronic
1078834866 11:15017553-15017575 CTGAGGTTTCACACAGCAGGGGG - Intronic
1079401441 11:20109636-20109658 CTTGGGTTTCCCAGAGGTGCTGG - Intronic
1079465301 11:20724033-20724055 CTGAGGCTGCACCGAGAAGCTGG + Intronic
1079465307 11:20724074-20724096 CTGAGGCTGCACAGAGCAGCTGG + Intronic
1080108621 11:28540398-28540420 CTGAGGCTTACAAGAGCAGCAGG + Intergenic
1080168069 11:29264286-29264308 CTGAGTTTTCCAAGAGAACTAGG + Intergenic
1080707654 11:34713182-34713204 CTGAGGTTGCACAGAGCAGCAGG - Intergenic
1080997225 11:37618934-37618956 CTGAGGCTGCACAGAGCAGCAGG - Intergenic
1082270657 11:50166532-50166554 TTGAGGTTGCACAGAGCAGCAGG - Intergenic
1083292658 11:61698577-61698599 GTGAGCTTCCCCAGGGAAGCAGG - Intronic
1084564485 11:69921394-69921416 CTGGGGTGACCCAGAGAGGCTGG + Intergenic
1085981411 11:81730809-81730831 CTGAGGCTGCACAGAGAAGCAGG - Intergenic
1086906478 11:92423797-92423819 CTGAGGTTTCCCAAAGAAGAAGG - Intronic
1087708377 11:101521227-101521249 CTGAGGTTGCACAAGGAAGCTGG - Intronic
1088358828 11:108970252-108970274 GTGTGGTTTCCCAGGAAAGCTGG - Intergenic
1088808466 11:113372851-113372873 CTCAGGCTTCCCTGAGATGCTGG - Intronic
1089282617 11:117384991-117385013 GTGAGGATTTCCAGAGAAGAGGG + Intronic
1089679465 11:120111236-120111258 CTGAGGGTCCCCAGAGGAACAGG - Intergenic
1089698852 11:120232170-120232192 GTGAGGTTGCCCAGGGAACCAGG - Intergenic
1090035584 11:123246842-123246864 CTGAGGCCTCCCTGAGCAGCTGG + Intergenic
1090188178 11:124751730-124751752 CTGAGGTTTCCGGGAGGGGCCGG + Intronic
1090948582 11:131452722-131452744 CTCAGGAATCTCAGAGAAGCTGG - Intronic
1091262554 11:134245831-134245853 CTCATGTTCCCCAGAGAGGCTGG - Exonic
1091645623 12:2270322-2270344 CTGACATTTCACAGAGAAGGAGG - Intronic
1091995916 12:4993993-4994015 CTGGGGTCCCCTAGAGAAGCTGG - Intergenic
1093351034 12:18103401-18103423 CTGAGGCTGCACAGAGCAGCTGG + Intronic
1095226749 12:39686503-39686525 CTGAGGCTGCACAGAGCAGCAGG + Intronic
1095395424 12:41757123-41757145 CTGAGGCTTCACAGAGCAGCAGG + Intergenic
1095631012 12:44377413-44377435 CTGAGCTTTGCCACAGAAGTAGG - Intronic
1095756720 12:45776121-45776143 CTGAGGTTCCCCAGACCAGCCGG + Intronic
1096137804 12:49217126-49217148 CTTAGGTCTTCCAGATAAGCTGG + Intronic
1096184266 12:49568004-49568026 CTGAGGGTTCTCAGAGGAGTTGG - Intronic
1096630417 12:52922985-52923007 CTGAGCTTCCCCAGATCAGCGGG - Intronic
1096910569 12:54979813-54979835 CTCTGTTTTCCCAGGGAAGCAGG + Intronic
1097009873 12:55945300-55945322 CTGAGATTACCCAGAGAAAGAGG + Intronic
1097401669 12:59134979-59135001 CTGAGGTTGCACAGAACAGCGGG + Intergenic
1097571290 12:61335319-61335341 TTGAGGTTGCACAGAGCAGCGGG + Intergenic
1099708628 12:86190888-86190910 CCGAGGTTTTCCAGAGAAGAAGG + Intronic
1100095059 12:91023892-91023914 CCGAGGTTTGGCAGAGAAGAAGG - Intergenic
1100677524 12:96884256-96884278 CTGAGATTGCCCAGGGAAGAGGG - Intergenic
1101516413 12:105439579-105439601 CTGAGGCTGCACAGAGCAGCAGG + Intergenic
1102870561 12:116410821-116410843 CTGAATTTCCCCAGAGAAGCTGG + Intergenic
1103145933 12:118596012-118596034 CTGAGGCTTCCCTGAGCAGGAGG + Intergenic
1104675355 12:130708841-130708863 CTGTGAGATCCCAGAGAAGCTGG - Intronic
1104997084 12:132664804-132664826 CTGGGCTTTCTCTGAGAAGCTGG - Intronic
1105208794 13:18245545-18245567 AACAGGTTTCCCAGAGAAGCAGG - Intergenic
1105427897 13:20311399-20311421 CAGAGTTTTCCCAAAGATGCAGG - Intergenic
1105835678 13:24209244-24209266 CTGAGGTTTAATAGAGAAACGGG - Intronic
1106033844 13:26026331-26026353 CTGAGGCATCACAGAGAACCTGG - Intergenic
1107330677 13:39296423-39296445 CAGAGGTTACACAGAGCAGCAGG - Intergenic
1107714429 13:43185695-43185717 CTGAGAATAACCAGAGAAGCAGG - Intergenic
1107820872 13:44284608-44284630 CTGAAGTTGCTAAGAGAAGCAGG - Intergenic
1108256199 13:48613346-48613368 CTGAGGTTAGCCATAGAAACTGG - Intergenic
1108688174 13:52838888-52838910 CTGAGGCTTCACAGAGGGGCAGG + Intergenic
1109311575 13:60700598-60700620 CTGAGGTTTTCCAAAGAAGAAGG - Intergenic
1109342201 13:61076165-61076187 CTGAGGTTGCACAGGGTAGCAGG - Intergenic
1110533403 13:76623128-76623150 CTGGGGTTTCCCCTGGAAGCAGG - Intergenic
1111318595 13:86593979-86594001 TTGAGGTTTCCCAGAGAAGGGGG + Intergenic
1111693736 13:91596764-91596786 ATGAGGTTTCCCAGTGTTGCTGG + Intronic
1112389440 13:98969682-98969704 CAAGGGTTTCCCAAAGAAGCTGG + Intronic
1112512213 13:100020052-100020074 CTGAGGCTGCACAGAGCAGCAGG - Intergenic
1112951912 13:105008684-105008706 CAGAGGCTTCACAGAGAAGGAGG - Intergenic
1113111057 13:106824070-106824092 CTGACCTCTCACAGAGAAGCTGG - Intergenic
1113630718 13:111881813-111881835 CCGAGGCTTCCCAGAGAAGGAGG + Intergenic
1117765958 14:59083152-59083174 CTGAGAATTCCCAGAGCATCTGG - Intergenic
1117767897 14:59101883-59101905 CTGACCTGTCTCAGAGAAGCAGG - Intergenic
1118016795 14:61668928-61668950 CAGAGTCTTCCCAGAGAAGGTGG + Intergenic
1118731090 14:68667320-68667342 CTGAGGTTTCCTGAAGAAGAAGG - Intronic
1118903332 14:70004481-70004503 CTGAGGTTTCCCCAAAAAGAAGG + Intronic
1119414077 14:74457773-74457795 CTGCTGTTTCCCACAGAGGCAGG + Intergenic
1119473836 14:74915723-74915745 CTGATTTTTTCAAGAGAAGCAGG + Intronic
1119651449 14:76386939-76386961 CTGATGTTTCCCTGACAAACGGG + Intronic
1120661626 14:87257666-87257688 CTGAGGCTACACAGAGCAGCAGG - Intergenic
1121348134 14:93151382-93151404 TTGCAGTTTCCCAGAGAATCAGG + Intergenic
1121471140 14:94155421-94155443 CTGAGGCTGCACAGAGAAGCGGG - Intronic
1122159773 14:99774494-99774516 CTGAGGAGTCCCAGAGGAGGAGG - Intronic
1122318092 14:100837400-100837422 GTTAGACTTCCCAGAGAAGCTGG + Intergenic
1122320332 14:100851599-100851621 CTCAGGTTTCCCTGGGCAGCAGG + Intergenic
1122630520 14:103105623-103105645 GGGAGGCTTCCCAGAGAAGGAGG - Intronic
1123992415 15:25693617-25693639 CTCAGGTTTCCCTGAGGAGCTGG - Intronic
1124444944 15:29722304-29722326 CTGAGGCTGCACAGAGCAGCAGG - Intronic
1124687673 15:31796397-31796419 CTGAGCTTCCCCAAAGAAGAAGG - Intronic
1125171315 15:36769423-36769445 CTGAGGTTTCCCAGAAAAGAAGG - Intronic
1125763886 15:42119989-42120011 CTGAGGTTTCTCAGAAAAGGAGG + Intergenic
1126556235 15:49990720-49990742 CTATGATTTTCCAGAGAAGCTGG + Intronic
1127301148 15:57655103-57655125 CTGAGCTATCACAGAGAAGGGGG + Intronic
1127844446 15:62857054-62857076 CTCAGGTATCCAAGAGCAGCTGG - Intergenic
1128670498 15:69571230-69571252 TTGAGGTTTCCTAAAGAAGATGG + Intergenic
1128704815 15:69831275-69831297 CTGAGGCTTTCCAGAAATGCTGG - Intergenic
1129715352 15:77845277-77845299 CTGAGGTTGCGCAGGGCAGCAGG - Intergenic
1129786144 15:78311384-78311406 GTGAGGTTTCCAAAAGAACCTGG + Intergenic
1130072686 15:80661781-80661803 CAGAGGCTTCACAGAGAAGGAGG - Intergenic
1131334492 15:91534899-91534921 CTGCGGTTTCTTAGAGAATCAGG - Intergenic
1134277028 16:12785819-12785841 CAGAGGGTTTCCAGAAAAGCTGG - Intronic
1135287896 16:21209891-21209913 CAGAGGCTTCCCAGAGATGCTGG + Intronic
1136279669 16:29200926-29200948 CTGCAGTTTTCCAGAGAAGAGGG - Intergenic
1136359568 16:29769939-29769961 CTGAGGTTTCCCAACCAAGGTGG + Intergenic
1137358695 16:47792253-47792275 CTGAGGCTTCACAGAGCAGCAGG + Intergenic
1140644085 16:77010945-77010967 CTGAGGTTTCCTGAAGAAGAAGG + Intergenic
1141712757 16:85709617-85709639 CAGAGGTATCACAGAGAGGCAGG + Intronic
1141849487 16:86635517-86635539 CAGAGTTTCCCCAGAGAAGACGG + Intergenic
1142084059 16:88167023-88167045 CTGCAGTTTTCCAGAGAAGAGGG - Intergenic
1143641330 17:8199785-8199807 CTGCTGTTTCTCAGAGAAGAGGG + Intergenic
1143679402 17:8465151-8465173 CTGAGGTTTCTAGGAGAAGCAGG + Intronic
1144833234 17:18143381-18143403 CTGAGGTTGGCCAGAGAAAAGGG - Intronic
1146632298 17:34479576-34479598 CTGAAGTTGCCCAGAGTAGCTGG + Intergenic
1149403627 17:56324624-56324646 CTAAGGTGTGCAAGAGAAGCCGG + Intronic
1151398793 17:73842414-73842436 CTGAGGTATTCAAGAGAGGCTGG + Intergenic
1151458491 17:74240814-74240836 ATGTGTTTTCCCAGAGGAGCTGG - Intronic
1151495348 17:74455018-74455040 CTGAGGTTCCCAAGAGAAGCTGG + Intergenic
1152089004 17:78236768-78236790 CAGAGGCCTCCCAGAGAAACAGG - Intronic
1152230558 17:79112223-79112245 CTGAGACTTCCCACAGAAGGCGG - Intronic
1152417872 17:80174766-80174788 CTGAGGACTCCCAGGGAAGCTGG + Intronic
1152899189 17:82930210-82930232 CTCACGTTTCCCACTGAAGCGGG - Intronic
1153103279 18:1498511-1498533 CTGAGGTTCCCCAAAGAAAAAGG - Intergenic
1153487497 18:5614690-5614712 CTCTGGTTTCTCAGTGAAGCTGG - Intronic
1155495550 18:26438494-26438516 CTGAGATTTCCCGGAGAAAGTGG + Intergenic
1155932441 18:31721658-31721680 CGAAGGTTTCCCAGAGTAGAAGG + Intergenic
1156191621 18:34727158-34727180 CTGAGGCTTCACAGGGCAGCAGG + Intronic
1156683353 18:39617195-39617217 CCAAGGTTTCACAGAGAAGCAGG + Intergenic
1156995861 18:43465927-43465949 CTGAGGTTGCTCAGTGCAGCAGG + Intergenic
1158581678 18:58689705-58689727 GAGACATTTCCCAGAGAAGCTGG + Intronic
1159196424 18:65122282-65122304 CTGAGGCTGCGCAGAGAAGCAGG - Intergenic
1159803078 18:72924153-72924175 CTGAGGCTGCACAGAGCAGCAGG + Intergenic
1160115576 18:76075944-76075966 CTGTGGATTCCCAGAGACGCTGG - Intergenic
1160126071 18:76173250-76173272 CTGCGGTCACCCAGAGAAGCTGG - Intergenic
1160379257 18:78439072-78439094 GAGAGGTTGCCCAGAGAAGCTGG + Intergenic
1160658878 19:289115-289137 CTGAGGGTGGCCAGGGAAGCAGG + Intronic
1161081932 19:2315586-2315608 CTGTTGTTTTCCAGAGAAGGGGG + Intronic
1161861478 19:6801544-6801566 CCGAGGGTTCCCAGAGAGGGCGG - Intronic
1162315521 19:9936225-9936247 CGGAGGGTTCCCGGAGAAACGGG - Intronic
1162525108 19:11202295-11202317 TTGGGGTTTCCCAGAGAAAGAGG + Intronic
1162541098 19:11296468-11296490 CTGTGGTTCCCTGGAGAAGCAGG + Intronic
1162760202 19:12884513-12884535 ATGAGGCTTCCCAGAGACCCTGG - Exonic
1163497867 19:17657084-17657106 CTGTGGCTTCCAAGGGAAGCAGG - Intronic
1164726618 19:30469693-30469715 CTGAGCGTCCCCAGAGGAGCAGG - Intronic
1165272793 19:34724892-34724914 CTGGGGTTTTTCAGAGAAGGGGG - Intergenic
1165444163 19:35847893-35847915 CTGAGGTTTGGCAGGGAATCAGG - Intronic
1165838327 19:38772566-38772588 CTGAGGGTTCCCTGAGCATCAGG - Intronic
1165841232 19:38790131-38790153 CTGAGGGTTCCCTGAGCATCAGG + Intronic
1168404232 19:56102671-56102693 CTGAGCTTTCCCTGAAAAGTCGG + Intronic
926099611 2:10105912-10105934 CTGAGGTTGCGCAGGGCAGCAGG + Intergenic
926202789 2:10813350-10813372 CTGGGGTTCTCCAGAGAAGGAGG - Intronic
926343363 2:11923184-11923206 CTGAGGTTTCCCAAAGAAGATGG - Intergenic
926438726 2:12864148-12864170 CTGAGTATTGCCAGAGAAGAAGG - Intergenic
926916085 2:17893510-17893532 ATGAGGGTGCCCAGAGATGCAGG - Intronic
927384001 2:22511876-22511898 CAGAGGTCTCCCAGAAGAGCAGG - Intergenic
927674057 2:25091526-25091548 CTGAGCCTTCCCAGAGAAACTGG + Intronic
928286257 2:29992493-29992515 CTGAGTTTTGCCAGGTAAGCAGG - Intergenic
928307696 2:30184140-30184162 CTGAGGTTTCCAGAAGAAGAAGG - Intergenic
928342229 2:30454565-30454587 CTCAAGCTTCCCAGAGTAGCTGG + Intronic
928490005 2:31772859-31772881 CTGAAGTTTCCTAAAGAAGAAGG - Intergenic
929042220 2:37756176-37756198 TGGAGGTTTCCCTGAGAAGAAGG + Intergenic
929071912 2:38039473-38039495 TTGTATTTTCCCAGAGAAGCGGG - Intronic
929612796 2:43284325-43284347 CTGAGGCTGCACAGAGCAGCTGG - Intronic
929901077 2:46004428-46004450 ATGAGAGTTCCCAGAGCAGCAGG - Intronic
930961501 2:57267278-57267300 CTGAGGCTGCACAGAGCAGCTGG + Intergenic
932154733 2:69405570-69405592 CTGAGAACTCCCAGAAAAGCTGG - Intronic
932590399 2:73062811-73062833 AGGAGGTGTCCCAGAGGAGCTGG + Intronic
932842897 2:75100120-75100142 CTGAGTTTTTTCAGAGAGGCAGG + Intronic
934985224 2:98880531-98880553 CTCAGGATGCCCAGAGAAGGGGG - Intronic
935368726 2:102322221-102322243 CTGAGGTTTCCCAAAGAAGAAGG - Intronic
935668901 2:105538633-105538655 CAGAGGTTTCCCAGAGAAGAGGG + Intergenic
936447288 2:112606284-112606306 ATGAGGTGGCTCAGAGAAGCAGG - Intergenic
936850829 2:116895787-116895809 CTGAGGCTGCACAGAGCAGCAGG + Intergenic
937354554 2:121190015-121190037 CTCAGGTGTCCCAGAGACACAGG + Intergenic
938141360 2:128797326-128797348 CTGAGGTTTCCCGAAGAAGAAGG - Intergenic
939092837 2:137799300-137799322 CTGAGGCTACACAGAGCAGCAGG - Intergenic
939156481 2:138530890-138530912 GTAAGGTTTCCCTGAGAAACGGG - Intronic
939835535 2:147125417-147125439 CTGAGGCTACACAGAGCAGCAGG - Intergenic
940009397 2:149038579-149038601 CTGCGGTTTCCCAGCGGAGCCGG + Exonic
940103450 2:150069879-150069901 CTGAGGTTCCCCAGTGAAAATGG - Intergenic
940403102 2:153268908-153268930 CTGAGGCTGCACAGAGCAGCAGG + Intergenic
943493454 2:188585675-188585697 CTGAGGTTGCACAGAGCAGCAGG + Intronic
943665253 2:190602362-190602384 CTGATATTTCCCAAAGAAGAAGG - Intergenic
944371221 2:198985708-198985730 CTGAGGCTGCAGAGAGAAGCTGG + Intergenic
945292012 2:208135941-208135963 GTGAGGTTTCCCTCAGAGGCTGG + Intergenic
946502188 2:220261380-220261402 CTGAATTTTTTCAGAGAAGCTGG + Intergenic
946583546 2:221158123-221158145 AAGAGTGTTCCCAGAGAAGCTGG - Intergenic
946741368 2:222805607-222805629 CTGATGCTTCCGAGAGAACCAGG + Intergenic
947011544 2:225571622-225571644 CTGAGGTTTCACAGAGCAGGGGG + Intronic
947809181 2:232989719-232989741 CTGTGGTTTCCCAAAGAATTAGG + Intronic
1168889780 20:1287501-1287523 CTGAGGTTACCCAGAAAGTCAGG - Intronic
1169280147 20:4260262-4260284 CTGAGATTTTCCAGAGAGGAAGG - Intergenic
1169302287 20:4454333-4454355 CTGAGGTTTCCCTGAGAAAAAGG - Intergenic
1169683733 20:8246969-8246991 CTGTGGTTTTCCACAGCAGCAGG + Intronic
1169774531 20:9238098-9238120 CTGGAGTTTTCCAGAGCAGCTGG + Intronic
1170496868 20:16933592-16933614 CTGCTGTTTCCCAGAGATTCTGG - Intergenic
1170936499 20:20814506-20814528 CTGAGAAGTCCCACAGAAGCTGG - Intergenic
1171288190 20:23960779-23960801 CTGAGTATTGCCAGAGAAGAAGG + Intergenic
1171289962 20:23977259-23977281 CTGAGGTTTCCAAGAGAAGCAGG - Intergenic
1172196775 20:33097315-33097337 ATGGGGTCTCCCAGAGATGCTGG - Intronic
1172391263 20:34567009-34567031 CTGCAGATTCCTAGAGAAGCAGG + Intronic
1172655009 20:36531545-36531567 CAGCAGCTTCCCAGAGAAGCTGG + Intergenic
1172789491 20:37493043-37493065 TTGAGGTATCCCAGAGCAGAAGG + Intronic
1173123864 20:40318759-40318781 GTGAGTGTTCCCAGAGAACCAGG - Intergenic
1173306826 20:41858482-41858504 CTGGGGTGTCCCAGGGAAGCAGG + Intergenic
1173575938 20:44113046-44113068 CTGAGGCCTCCCAGGGAAGCTGG - Exonic
1174082676 20:47982254-47982276 CTGAGGCATCCCAAAGAAGAAGG - Intergenic
1174531450 20:51217769-51217791 CTGAGGCTACCCACAGTAGCAGG + Intergenic
1175485875 20:59345817-59345839 CTGAGGTTTCCTAAATAAGAAGG - Intergenic
1177510802 21:22084952-22084974 AACAGGTTTTCCAGAGAAGCTGG - Intergenic
1177602652 21:23335977-23335999 CTGAGGATGCACAGAGCAGCAGG - Intergenic
1177748059 21:25245337-25245359 GAGAGGTCTCCCTGAGAAGCTGG - Intergenic
1178473055 21:32911872-32911894 CTGAGGTTTCCCAGGGAAGAAGG - Intergenic
1178682436 21:34684231-34684253 CTGAAGTTCTCCAGAAAAGCAGG - Intronic
1178927177 21:36785781-36785803 CTTAGGTTTCCCCAAGAAGCAGG + Intronic
1179553368 21:42157267-42157289 CCCAGTCTTCCCAGAGAAGCGGG + Intergenic
1179924867 21:44528866-44528888 CTGAGGACTCTCAGAGGAGCAGG - Intronic
1180048251 21:45319615-45319637 CTGGGGTTTCCCAGGGCTGCGGG - Intergenic
1180767466 22:18353774-18353796 CTGAGGTTTCCCAGAGAAGCAGG + Intergenic
1180778840 22:18508608-18508630 CTGAGGTTTCCCAGAGAAGCAGG - Intergenic
1180811562 22:18765929-18765951 CTGAGGTTTCCCAGAGAAGCAGG - Intergenic
1181128752 22:20717231-20717253 CTGAGCTTTTCAAGAGAAGATGG - Intronic
1181197715 22:21200177-21200199 CTGAGGTTTCCCAGAGAAGCAGG - Intergenic
1181395860 22:22621109-22621131 CTGAGGTTTCCCAGAGAAGCAGG + Intergenic
1181647518 22:24241459-24241481 CTGAGGTTTCCCAGAGAAGCAGG - Intronic
1181703986 22:24636724-24636746 CTGAGGTTTCCCAGAGAAGCAGG + Intergenic
1182175153 22:28278172-28278194 CAGTAGTTTCCCAGAGAAACAGG - Intronic
1183002808 22:34875761-34875783 TTGATATTTCCCTGAGAAGCAGG - Intergenic
1185331288 22:50253117-50253139 CTGAGGTTTCTGAGAGCACCGGG + Exonic
1203229088 22_KI270731v1_random:94658-94680 CTGAGGTTTCCCAGAGAAGCAGG + Intergenic
1203294419 22_KI270736v1_random:27672-27694 TGGAGGTTTCCCTGAGAAGAAGG + Intergenic
949452146 3:4197549-4197571 CTGTTCTTTTCCAGAGAAGCAGG - Intronic
949692802 3:6660448-6660470 CTGAGATGTCCTAGAGAAGAAGG + Intergenic
949925878 3:9041248-9041270 CTAAGTTTACCCAGGGAAGCTGG + Intronic
950327204 3:12121953-12121975 CTGAGGTTTTGCAGAGAAGAAGG - Intronic
950640471 3:14345211-14345233 CTGAGGGTTCACACAGAAGTAGG + Intergenic
952559364 3:34572680-34572702 GGGAGGTTTCCCAAAGAAGGTGG - Intergenic
952947636 3:38490064-38490086 CTGAGCTTCCTCAGAAAAGCAGG - Exonic
953359165 3:42280013-42280035 CTGAGGCTGCACAGAGCAGCAGG - Intergenic
953915952 3:46921395-46921417 CTGAGGATCCCCAGAGGACCAGG + Intergenic
954705939 3:52480529-52480551 CTGCGGTCTCCTAGAGGAGCTGG - Intronic
954748339 3:52799626-52799648 CTGAGGCTTGCCACAGAAGCGGG - Intronic
955644101 3:61118306-61118328 CTGAAGATTCCCAGAGTAGTTGG + Intronic
956911360 3:73821428-73821450 CTGAGGCTGCACAGAGCAGCAGG - Intergenic
957283623 3:78186553-78186575 CTGAAGTTTTGCAGAGAGGCAGG + Intergenic
957444062 3:80292020-80292042 CTGAGGCTGCACAGAGCAGCTGG + Intergenic
957760408 3:84548469-84548491 CTTTGGATTCCCAGAGCAGCTGG - Intergenic
957783487 3:84849462-84849484 CTGGGGCTGCACAGAGAAGCAGG + Intergenic
957956549 3:87195893-87195915 CTGAGGCTGCACAGAGCAGCAGG - Intergenic
958158935 3:89791149-89791171 CTTAGCTTTCCCCGAGTAGCTGG - Intergenic
962058469 3:131899949-131899971 TTGAGCTTGCCCAGAGAAGTGGG - Intronic
962463219 3:135633763-135633785 CTGAGTTTTCCCAAAGATGAAGG + Intergenic
962654392 3:137528303-137528325 CTGAGGTCCCCCAAAGAAGAAGG + Intergenic
964541879 3:157788408-157788430 CAGAGGCTTTCCAGAGAAGATGG - Intergenic
964896226 3:161599595-161599617 CTGAGGAGTCCCAGGGATGCAGG - Intergenic
964934051 3:162059770-162059792 CTGAGGGTGCACAGAGAATCTGG + Intergenic
965376782 3:167934609-167934631 CTGAGGTTTCTCAGAGAGGAAGG - Intergenic
965883182 3:173411792-173411814 CAGATGTAACCCAGAGAAGCAGG - Intronic
966946256 3:184779111-184779133 CTGGGGTTCCCCGCAGAAGCGGG + Intergenic
967512438 3:190327224-190327246 CGGAGGTTTCCCAGAAGAGCAGG - Intronic
968672162 4:1857441-1857463 CTGAGGTGCCGCGGAGAAGCAGG - Intergenic
968695878 4:2026240-2026262 CTGAGGTTGCACAGAGCAGTGGG + Intronic
969371263 4:6732975-6732997 CCGAGGCTTCCCTGAGAAGGAGG - Intergenic
969572138 4:8015374-8015396 CTGAGGCTCCCCAGGGGAGCCGG - Intronic
969712932 4:8854482-8854504 CTGAGGTTCCCCCAAGCAGCAGG + Intronic
971277940 4:25215684-25215706 CTGAGGCTGCACAGAGCAGCAGG + Intronic
971431896 4:26577060-26577082 CTGAGGTTTTCTAGAGAAGAAGG + Intronic
971944912 4:33261873-33261895 CTCTGGCTTCTCAGAGAAGCAGG - Intergenic
972012822 4:34205927-34205949 CTGAGGCTTCACAGAGCAGGGGG - Intergenic
972156772 4:36172819-36172841 CTGGTGTTTCCCAGGAAAGCTGG - Intronic
973344212 4:49036875-49036897 AGGAGGCTTCCCAGAGGAGCTGG - Intronic
974924243 4:68277826-68277848 CTGAGGCTGCACAGAGCAGCAGG - Intergenic
974973309 4:68858515-68858537 CTGAGGCCTCACAGAGCAGCTGG - Intergenic
976965693 4:91037407-91037429 CTGAGATTTCTTAGAGAAGGAGG - Intronic
977415958 4:96733338-96733360 CCGAGGCTTCACAGAGCAGCAGG - Intergenic
977989266 4:103421084-103421106 CTGAGGCTTCACAGAGTAACGGG + Intergenic
978279774 4:106996743-106996765 CAGACGTTTTTCAGAGAAGCAGG - Intronic
978492480 4:109323534-109323556 CTGAGGCTGCACAGAGCAGCAGG + Intergenic
978831275 4:113088206-113088228 CTGGGGTTTTACAGAGGAGCAGG + Intronic
979060919 4:116059380-116059402 CTGAGGCTGCACAGAGCAGCAGG + Intergenic
980407067 4:132366792-132366814 CTTAGGTTGCACAGAGAAACCGG + Intergenic
980597671 4:134975960-134975982 ATGAGGTTTCACAGAGGAGGGGG - Intergenic
980766260 4:137309641-137309663 CTGAGGTTTCCCAGAGAACACGG + Intergenic
981260040 4:142708477-142708499 CTGAGGTTGCACAGGGCAGCAGG - Intronic
981356901 4:143799352-143799374 CTGAGGCTGCACAGAGCAGCAGG + Intergenic
981368432 4:143929949-143929971 CTGAGGCTGCACAGAGCAGCAGG + Intergenic
981378229 4:144040234-144040256 CTGAGGCTGCACAGAGCAGCAGG + Intergenic
981569273 4:146134399-146134421 CTGAGGCATCACAGACAAGCAGG + Intergenic
981870177 4:149476336-149476358 CTTAAGTTTCCCAGAGTGGCAGG + Intergenic
982284146 4:153716792-153716814 CTGAGGCTTCCTAGAGAAAAAGG - Intronic
983336168 4:166396051-166396073 TTGAGGTTTACCAGACAACCTGG + Intergenic
984057044 4:174942598-174942620 CTGAGGCTTCACAGAGCAGTTGG + Intronic
985615921 5:922060-922082 CTGGGGTCTCCCTGAGATGCTGG - Intergenic
985866520 5:2518543-2518565 CTGAGGTGGCCCCGAGAAGAAGG + Intergenic
985888437 5:2697928-2697950 TTGTGCTTTCCCAGAGGAGCTGG + Intergenic
986099700 5:4595933-4595955 CTGAGGTTGCACAGAGCAGCAGG - Intergenic
986131016 5:4930220-4930242 CTGAGGTCTCCCAAAGAAGAAGG - Intergenic
986362057 5:6988320-6988342 CTGAGGTTTCTTGGAGAAGAAGG + Intergenic
986582307 5:9278649-9278671 CTGAGGCTGCACAGAGCAGCAGG - Intronic
986894336 5:12347375-12347397 CTGAGGCTGCACAGAGAAGCAGG - Intergenic
986901739 5:12443267-12443289 CTAAGATTTCCCAAAGAAGAAGG - Intergenic
987188577 5:15450507-15450529 CTGAGGATACCCATAGAAGATGG + Intergenic
987274183 5:16344615-16344637 TTGAGGTTTCTCAGAGGAGGTGG - Intergenic
987697844 5:21355176-21355198 CCGAGGCTGCCCAGAGCAGCAGG + Intergenic
987744060 5:21947845-21947867 CTGAGGTTGCCCAGAGCAACGGG - Intronic
988363527 5:30266483-30266505 CTGAGGTTCCCCAGGGAAAAAGG - Intergenic
988628319 5:32900943-32900965 ATGAGGTTGCACAGAGCAGCTGG + Intergenic
990213746 5:53508259-53508281 CTGAGGCTGCACAGAGCAGCTGG + Intergenic
990391872 5:55331473-55331495 CTGAGGTTTTCCACTGTAGCTGG + Intronic
990662330 5:58029954-58029976 TTGAGGTTTCCTGGAGAAGAGGG + Intergenic
991122514 5:63032528-63032550 CTGAGGCTGCACAGAGCAGCTGG - Intergenic
991742601 5:69697211-69697233 CCGAGGCTGCCCAGAGCAGCAGG - Intergenic
991755093 5:69857993-69858015 CCGAGGCTGCCCAGAGCAGCAGG + Intergenic
991764264 5:69957982-69958004 CTGAGGTTGCCCAGAGTAACGGG - Intergenic
991783063 5:70160165-70160187 CTGAGGTTGCCCAGAGCAACGGG + Intergenic
991794174 5:70276949-70276971 CCGAGGCTGCCCAGAGCAGCAGG - Intergenic
991821991 5:70572524-70572546 CCGAGGCTGCCCAGAGCAGCAGG - Intergenic
991834420 5:70733141-70733163 CCGAGGCTGCCCAGAGCAGCAGG + Intergenic
991843496 5:70833054-70833076 CTGAGGTTGCCCAGAGTAACGGG - Intergenic
991875505 5:71160492-71160514 CTGAGGTTGCCCAGAGCAACGGG + Intergenic
991886552 5:71276491-71276513 CCGAGGCTGCCCAGAGCAGCAGG - Intergenic
992623535 5:78616593-78616615 CTGATGTGTCCCAGAGGAGAAGG + Intronic
992743079 5:79793476-79793498 CTGTGGTTTCCCAGTAATGCTGG - Exonic
992937049 5:81718605-81718627 CAGAGCTTTCCCAGTGAAGCTGG - Intronic
993673400 5:90789102-90789124 CTGAGGTTTCCTGGAGAAAAAGG - Intronic
993690684 5:90996271-90996293 CTGAGGTTGCACAGAGCAGTGGG - Intronic
994019263 5:95004545-95004567 CTGAGGTGGCACAGAGAAGCAGG - Intronic
994112511 5:96022829-96022851 CAGAGGTTTCCTGGAGAAGAAGG - Intergenic
994592337 5:101789053-101789075 CTGAGGCTGCACAGAGCAGCGGG - Intergenic
995114967 5:108469297-108469319 CTAAGGTTTCCCAAAAAAGAAGG - Intergenic
995132726 5:108647523-108647545 CTGAGGCTGCTCAGGGAAGCAGG - Intergenic
995390948 5:111639862-111639884 CTGAGGCTGCACAGAGAAGGGGG - Intergenic
995477556 5:112563391-112563413 CTGAGGTTGGGCAGAGCAGCAGG - Intergenic
996046779 5:118882775-118882797 CTGAGGCTGCACAGAGCAGCAGG + Intronic
996480936 5:123974066-123974088 CTGAGGCTGCACAGAGGAGCAGG + Intergenic
996487467 5:124053733-124053755 CTGAGGCTTCCCAGAGAAAAAGG + Intergenic
996499725 5:124203520-124203542 TTGAGGTTGCACAGAGCAGCAGG - Intergenic
997159585 5:131594126-131594148 CTGAGGCTACACAGAGTAGCAGG - Intronic
998533958 5:142911711-142911733 ATGAGGTGTCCCAGAGAAATGGG - Intronic
998554057 5:143105980-143106002 CTGACTTTTCGCAGAGTAGCAGG + Intronic
998761625 5:145438712-145438734 ATGAGGTTTCCGAGAGCAGGTGG - Intergenic
999426572 5:151492604-151492626 CTCAAGTTTTCGAGAGAAGCAGG - Intergenic
999482052 5:151957715-151957737 CTGAGGTTTCAGAGAGGTGCTGG + Intergenic
999532330 5:152477597-152477619 CTGAGGTTTCCTGGAGAAGAAGG + Intergenic
1000103092 5:158035494-158035516 CTGAGGCTGCACAGAGCAGCAGG - Intergenic
1000813124 5:165887380-165887402 CTAGGGTTTCCCAGAGAAGGAGG + Intergenic
1002057413 5:176606481-176606503 TTTAGTTTTCCAAGAGAAGCTGG - Intronic
1002932300 6:1643086-1643108 CTGAGTCTCCCCAGAGAAACTGG + Intronic
1003062460 6:2874445-2874467 CTGGGGTTTGCCAGAGACCCTGG - Intergenic
1003495754 6:6661831-6661853 ATGAGGGTTGCCAGAGAACCAGG + Intergenic
1003923751 6:10857486-10857508 CTGAGGTTCCTCAGAGAAGAAGG + Intronic
1003923959 6:10859537-10859559 CTGAGGTTTCCCAGAGAAGGAGG + Intronic
1004344209 6:14833254-14833276 ATGAGGTTTCCCAGAGAAGAAGG - Intergenic
1004613722 6:17269833-17269855 CTGAGATTTCCCAGAAAAGAAGG + Intergenic
1005092036 6:22067370-22067392 TGGAGTTTTCCCAGAGAGGCTGG + Intergenic
1005553007 6:26943228-26943250 CCGAGGCTGCCCAGAGCAGCAGG - Intergenic
1006437457 6:34033366-34033388 ATGAGGTATCCCAGAGCTGCAGG + Intronic
1007593795 6:43039158-43039180 CTGAGGCTTGCCATAGAGGCAGG - Intronic
1007696078 6:43735030-43735052 GTCAGGATTCCCAGTGAAGCAGG + Intergenic
1008367749 6:50702562-50702584 CTGTGTTTTCCCAGAGAACATGG - Intergenic
1009377961 6:62994669-62994691 CTGAGGCTGCACAGAGCAGCTGG + Intergenic
1009844271 6:69116126-69116148 CTGAGGTTTCCTGGTGAAGAAGG - Intronic
1010247203 6:73672684-73672706 CTGAGCTTTCCCAGAATAGTTGG + Intergenic
1010344962 6:74800475-74800497 CTGAGGCTGCACAGAGCAGCTGG - Intergenic
1010473813 6:76262447-76262469 CTGAGGTTGCACACAGCAGCAGG - Intergenic
1012416140 6:99016171-99016193 CTGTGGACTCCCAGAGAAGTGGG + Intergenic
1014374804 6:120659394-120659416 CTGAGGCTGCACAGAGCAGCTGG + Intergenic
1015841106 6:137478310-137478332 CTGACGGTTCCTAGAGAAGAAGG - Intergenic
1016003342 6:139065176-139065198 ATGAGGTTTCCCAGAGAAGAAGG - Intergenic
1016291687 6:142534730-142534752 CAGAGGTTGCACAGAGCAGCAGG - Intergenic
1017221938 6:151975599-151975621 CTGAGGTTTCCCCAAGAGGACGG - Intronic
1018775633 6:167012766-167012788 GTGAGTTTTTCCAGAGAAGGGGG + Intronic
1018869554 6:167770565-167770587 CTGAGGCTCCCCAGAGGCGCAGG - Intergenic
1019050321 6:169177736-169177758 GTGAGCTTTCTCAGAGACGCTGG + Intergenic
1019565087 7:1675112-1675134 ATGTGGCTTCCCAGACAAGCTGG - Intergenic
1019825822 7:3283409-3283431 GTGAGGTCTCCTAGAGAAGGGGG - Intergenic
1019925865 7:4191480-4191502 TGGAGGGATCCCAGAGAAGCTGG - Intronic
1020153095 7:5698719-5698741 GTCTGTTTTCCCAGAGAAGCTGG + Intronic
1020198197 7:6058870-6058892 CTGAGGTTTGCCTGAGGACCTGG - Intronic
1021096300 7:16539661-16539683 CTGAGGCTGCACAGAGCAGCGGG - Intronic
1021565624 7:22013950-22013972 CTGATGATTCCCTGACAAGCTGG + Intergenic
1021629583 7:22631313-22631335 CTGAAGTTTCCCAGAGAAGAAGG - Intronic
1022261607 7:28710935-28710957 ATGTGGTTGCCCAGAGAAGGTGG + Intronic
1022840524 7:34159694-34159716 CTGACCTTTCCCAAAGAAGAGGG - Intergenic
1022958581 7:35403586-35403608 ATGAGGTTACACAGAGAAGTTGG + Intergenic
1023598097 7:41853682-41853704 CTCAGGTGTCCCAGGGAAGCAGG - Intergenic
1024692116 7:51814358-51814380 CTGAGGTTTGGGAGAGAGGCTGG + Intergenic
1024845431 7:53636537-53636559 CTGAGGCTGCACAGAGTAGCAGG - Intergenic
1025748697 7:64271573-64271595 CTGAGGCTTCACAGAGCAGTGGG - Intergenic
1027358276 7:77381623-77381645 CTGAGGGAACCCAGGGAAGCAGG - Intronic
1028859342 7:95630761-95630783 CAGTGGTTTCTCAGAGATGCAGG + Intergenic
1029064638 7:97837281-97837303 AGGAGGCTTCCCAGAGAAACCGG + Intergenic
1029604560 7:101590776-101590798 CTGAGGTCTTCCAAAGAGGCTGG + Intergenic
1029667610 7:102005966-102005988 ATGAGGTTGGCCAGAGAAACTGG + Intronic
1030469001 7:109939328-109939350 CTGAGGCTACACAGAGCAGCAGG + Intergenic
1031182545 7:118435901-118435923 GTGAGGGTTCCCAGGGAAGAGGG - Intergenic
1031258760 7:119489493-119489515 CTGAGGCTGCACAGAGAAGTGGG + Intergenic
1032434866 7:131891993-131892015 AACAAGTTTCCCAGAGAAGCTGG + Intergenic
1032472361 7:132187721-132187743 CAGTGGTCTCCCAGAGAACCAGG + Intronic
1033347936 7:140540050-140540072 GGGAGGTTTCCCAGAGTAGGGGG - Intronic
1035327919 7:158076736-158076758 ATGAGGCTCCACAGAGAAGCTGG - Intronic
1035331228 7:158098579-158098601 CTCTGGTTTCACAGAGCAGCTGG - Intronic
1035862248 8:3041968-3041990 CTGATGTTTCCCAGAGATGAAGG - Intronic
1040295617 8:46147588-46147610 CTGGGGTTTTCCAGACAATCCGG + Intergenic
1040945933 8:52883928-52883950 CTGAGGCTGCACAGAGCAGCAGG + Intergenic
1040984677 8:53280740-53280762 CTGAGGTTGGCCAGGCAAGCCGG + Intergenic
1041632107 8:60099790-60099812 CTGAGGCTGCAAAGAGAAGCAGG + Intergenic
1042412151 8:68477915-68477937 CTGAGGCTGCACAGAGCAGCAGG + Intronic
1042660376 8:71148505-71148527 CTCAGGTTTCCCAGAGAAGAAGG + Intergenic
1043003670 8:74791425-74791447 CTGAGGTTCCCCAAAGATGAAGG - Intronic
1043132921 8:76484029-76484051 CTGGGGTCTGCCAGAGAAGACGG - Intergenic
1044288695 8:90441515-90441537 AAGAGTTTTACCAGAGAAGCAGG - Intergenic
1044295101 8:90518610-90518632 CTGAGGCTGCACAGAGCAGCAGG - Intergenic
1044326884 8:90868974-90868996 CTGAGGCTGCACAGAGCAGCAGG - Intronic
1044594296 8:93943032-93943054 CTGATGTTTCACTGGGAAGCAGG - Intergenic
1044639368 8:94362344-94362366 CTGAGGTTTCCAAAAGAAGAAGG + Intergenic
1045438946 8:102191017-102191039 CTGAGGCTGCACAGAGCAGCAGG + Intergenic
1045513942 8:102840319-102840341 AAGAGGTTTCCCAGTGAAGATGG - Intronic
1045561790 8:103271286-103271308 CTGAGGTTGCACAGGGCAGCAGG - Intergenic
1046416826 8:113927096-113927118 TTGGGGTTTCACAGAGATGCCGG - Intergenic
1047557897 8:125952323-125952345 CTGAGGATTGCCAGGGAAACAGG + Intergenic
1047598375 8:126401666-126401688 CTAAGATTTCCCAAAGAAGACGG - Intergenic
1048069770 8:131009267-131009289 CTGAGGCTGCACAGAGCAGCAGG - Intronic
1048137382 8:131759590-131759612 CTGAGGCTGCACAGAGCAGCAGG - Intergenic
1048526224 8:135205568-135205590 CTGAGGCTGCACAGAGAAGCTGG - Intergenic
1048583988 8:135755785-135755807 CTCAGGTTACCCAGAGAAGCAGG - Intergenic
1048950417 8:139492094-139492116 GTGATTTTTCCCAGAGAAGGAGG + Intergenic
1049322923 8:142006634-142006656 CTGCGGCTTCTCAGAGAAGAAGG + Intergenic
1049340531 8:142109920-142109942 CTGTGGTTTCCCTGGGAAACCGG + Intergenic
1050431220 9:5563835-5563857 CTGAGGTTTCCCAGAAAAGATGG - Intronic
1050525668 9:6544229-6544251 ATGAGGTTTCCCCGAGAATGAGG + Intronic
1050643369 9:7692981-7693003 CTGAGGCTGCACAGAGCAGCAGG - Intergenic
1050674557 9:8037061-8037083 CTGAGGCTGCACAGAGGAGCAGG + Intergenic
1050976860 9:11949783-11949805 CTGAGGCTGCACAGAGCAGCAGG + Intergenic
1051360129 9:16274877-16274899 CTGAGGTCACCCAGAGCATCGGG - Intronic
1051580642 9:18670081-18670103 CTGAGGTTGTCTAGAGAAGATGG + Intronic
1053264279 9:36699140-36699162 CTGAGGCTGCACAGAGCAGCGGG + Intergenic
1054868341 9:70025727-70025749 CCGAGGTTGCACAGAGCAGCAGG + Intergenic
1055885925 9:81063219-81063241 CTGAGGTTGCACAGAGCAGCAGG - Intergenic
1056942267 9:90965673-90965695 CTGAGGTTTCCCAAAGGAGAAGG - Intergenic
1057248693 9:93481652-93481674 CTGGGGTGTCCCAGACAAGGAGG - Intronic
1057528719 9:95825321-95825343 CTGTGCTTCCCCAGGGAAGCAGG - Intergenic
1058055999 9:100449468-100449490 CTGAGGTTTCACAGAGCAAGCGG + Intronic
1059540989 9:115130127-115130149 CTGTGGCTGGCCAGAGAAGCTGG - Intergenic
1060237436 9:121875281-121875303 CTGAGGTGTCCCAGAGGTGGTGG - Intronic
1060396311 9:123319247-123319269 ATTAGGTTTCCCAGAGCAGCAGG + Intergenic
1060426481 9:123510882-123510904 CAGAGGTATGCAAGAGAAGCTGG + Intronic
1060447166 9:123700586-123700608 CTGAGGTTTTCCAGAGAAGAAGG - Intronic
1060603464 9:124893897-124893919 CTGAGGACTCCCAGAAAAACTGG - Intronic
1061978817 9:134088027-134088049 CTGAGCTTCCACAGAGTAGCTGG + Intergenic
1062099023 9:134718437-134718459 CTGTGGCTGCCCAAAGAAGCAGG - Intronic
1186362163 X:8853505-8853527 CTGAGGTCTCCCAAAGAAAAAGG - Intergenic
1186414313 X:9370187-9370209 CTAAGGCTTCCCAGACCAGCTGG - Intergenic
1186806041 X:13140797-13140819 CTGGGATTTCACAGAGAAGGTGG - Intergenic
1186914687 X:14206864-14206886 CTGGGGCTTGCCAGAGAAGTGGG - Intergenic
1187634378 X:21210995-21211017 CTGAGGTTGCACAGAACAGCTGG - Intergenic
1188925968 X:36044126-36044148 CTGAAGCTTCACAGAGCAGCAGG + Intronic
1189011329 X:37048578-37048600 CTGAGGCTGCACAGAGAAGCAGG - Intergenic
1189553121 X:42113738-42113760 CTGAGGTTGCACAGAGCATCAGG + Intergenic
1189586048 X:42463149-42463171 CTGGGGTTTCCCACTGAGGCTGG + Intergenic
1189869645 X:45368900-45368922 CTGAGGCTGCACAGAGTAGCTGG - Intergenic
1190477280 X:50840554-50840576 CCAAAGTTTCCCAGAGAAGGTGG - Intergenic
1190691832 X:52918987-52919009 CTGAGGTCTCCCAAAACAGCAGG + Intergenic
1190694151 X:52936805-52936827 CTGAGGTCTCCCAAAACAGCAGG - Intronic
1191606246 X:63065923-63065945 CTGAGGTTGACCTGAGATGCCGG + Intergenic
1191893457 X:65968443-65968465 CTGATTTTTTCAAGAGAAGCTGG + Intergenic
1192161220 X:68789374-68789396 CTGAGGTCGCCCAGAAGAGCTGG + Intergenic
1194541432 X:95177565-95177587 CTGAGGCTGTCCAGAGCAGCAGG - Intergenic
1194715278 X:97280625-97280647 TTCAGGTTGCCTAGAGAAGCTGG + Intronic
1195822051 X:108956411-108956433 CTGAGGCTGCACAGAGCAGCAGG - Intergenic
1196582574 X:117394178-117394200 CTGAGGCTGCACAGAGCAGCAGG + Intergenic
1197706308 X:129637054-129637076 ATGAGATTTCCCACAGCAGCTGG + Intergenic
1198948413 X:142041025-142041047 CTGAGGCTGCACAGAGCAGCAGG + Intergenic
1199134445 X:144234210-144234232 CTGAGGCTGCCCAGGGAAGTGGG - Intergenic
1199241770 X:145555124-145555146 CTGAAGTATTCCAGAGAGGCTGG - Intergenic
1199337957 X:146642119-146642141 CTGAGGCTGCCCAGAGCAGCAGG - Intergenic
1199511672 X:148629876-148629898 CTGGGGGTTCACAGAGAAGAAGG - Intronic
1200459769 Y:3440876-3440898 CTGAGGCTGCACAGAGCAGCTGG + Intergenic
1201231283 Y:11867208-11867230 TTGGGGTTTGCCAGAGAAGCAGG - Intergenic
1201372394 Y:13279363-13279385 CTCAGGATCCCCAGAGTAGCTGG + Intronic
1201921563 Y:19239571-19239593 CTGAGGCTTCACAGAGCAGTGGG - Intergenic