ID: 1181647667

View in Genome Browser
Species Human (GRCh38)
Location 22:24242606-24242628
Sequence CAGAAAAAAGAGCAGGAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 863
Summary {0: 1, 1: 0, 2: 4, 3: 73, 4: 785}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181647664_1181647667 18 Left 1181647664 22:24242565-24242587 CCAGCCTGGTGACAGAGCGAAAC 0: 49
1: 2147
2: 8587
3: 11928
4: 11816
Right 1181647667 22:24242606-24242628 CAGAAAAAAGAGCAGGAGACTGG 0: 1
1: 0
2: 4
3: 73
4: 785
1181647663_1181647667 28 Left 1181647663 22:24242555-24242577 CCACTGCACTCCAGCCTGGTGAC 0: 6366
1: 11481
2: 16026
3: 98540
4: 297718
Right 1181647667 22:24242606-24242628 CAGAAAAAAGAGCAGGAGACTGG 0: 1
1: 0
2: 4
3: 73
4: 785
1181647665_1181647667 14 Left 1181647665 22:24242569-24242591 CCTGGTGACAGAGCGAAACAGCA 0: 1
1: 1
2: 56
3: 1223
4: 5287
Right 1181647667 22:24242606-24242628 CAGAAAAAAGAGCAGGAGACTGG 0: 1
1: 0
2: 4
3: 73
4: 785

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181647667 Original CRISPR CAGAAAAAAGAGCAGGAGAC TGG Intronic
900198378 1:1389368-1389390 CAAAAAAAAGAACTGCAGACAGG + Intronic
900623406 1:3597434-3597456 CAGAACAAGCAGCGGGAGACAGG - Intronic
900753218 1:4414120-4414142 CAAAAGAAAGACCATGAGACTGG - Intergenic
900763876 1:4490974-4490996 CAGAAGAAAAAGGAGGTGACAGG - Intergenic
901377909 1:8853032-8853054 CAGAAAATAAAGCAGGGTACGGG + Intergenic
901647336 1:10723722-10723744 GAGAAAAGAGAGTGGGAGACAGG - Intronic
901746540 1:11377419-11377441 CAGAAAACAGGGCGGCAGACGGG - Intergenic
902546519 1:17193842-17193864 CAGAAAAGAGAGCAGGAGGCAGG + Intergenic
902859757 1:19236665-19236687 AAAAAAAAAAAGCAGGTGACAGG + Intronic
902995661 1:20222911-20222933 CAGAAACAAGAGGAGAAAACTGG - Intergenic
904426340 1:30425754-30425776 GAGAAAGAAGGGCAGGAGACAGG + Intergenic
904720931 1:32508058-32508080 CAGAAGAAAGAACAGTAGGCTGG - Intronic
904953170 1:34260791-34260813 AAGAAAAAGGAGAAGGAGAAAGG + Intergenic
905040365 1:34951776-34951798 CAGAATAGAGAGGAAGAGACAGG - Intergenic
905471945 1:38199131-38199153 TAGAAAAAAGAGGTGGAGAGTGG + Intergenic
906063061 1:42960778-42960800 CAGACAGATGAGCAGGAGAGTGG - Intergenic
906482048 1:46205567-46205589 CAGAGAAGAGAGCCAGAGACTGG - Intronic
906647756 1:47488121-47488143 GAGAAAGCAGAGCATGAGACAGG + Intergenic
906952941 1:50349305-50349327 GAGAGAAAAGAGCAGGGGAGAGG - Intergenic
907015620 1:51009869-51009891 CAGAAAAATGCTGAGGAGACAGG + Intergenic
907311305 1:53540598-53540620 AAGAAGAAATAGCAGGAGAGGGG + Intronic
907616294 1:55930196-55930218 CAGAAAGGAGAGCTGGAGATGGG + Intergenic
907813656 1:57897328-57897350 CAGGAACAAGAGAACGAGACAGG + Intronic
908826818 1:68141255-68141277 CACACAAAAGAGCTGGGGACAGG + Intronic
908903573 1:68983174-68983196 GAGAAAAGGGGGCAGGAGACAGG + Intergenic
909349182 1:74629602-74629624 CAGGAAAATGACCAGGAGAATGG - Intronic
909588181 1:77314415-77314437 AAAAAAAAAGACCAGGAGAATGG + Intronic
909684483 1:78331857-78331879 AAGAAGAAAGAGAAGGAGAGAGG - Intronic
909686550 1:78355217-78355239 CAAAAAAAGGAGGAGGAGAAAGG - Intronic
909740476 1:79023649-79023671 GAGAAAAAGGAGCAGGTGAAAGG - Intergenic
909837581 1:80276450-80276472 CAAAAAGAAGAGCAGCAGAGTGG + Intergenic
909862792 1:80630134-80630156 GAGAAAAAGGAGCAGGTGAAAGG + Intergenic
910049072 1:82955774-82955796 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
910176440 1:84435941-84435963 CAGACAAAAGAGCAGTATCCTGG + Intergenic
910707192 1:90142297-90142319 CAGAGCAAAGAGCAGGAGCTGGG + Intergenic
910961641 1:92769893-92769915 CAAAAAAAAGATCATGAGAAGGG + Intronic
911509237 1:98791149-98791171 CAGCAGAAAGAGGAGGAGAGGGG + Intergenic
912123695 1:106506403-106506425 CAGAAACCAGAGCAAGAGAATGG + Intergenic
912423797 1:109567941-109567963 GAGAAAAAAGAGAAGGACTCAGG + Intronic
912531461 1:110326728-110326750 CACAACAAAGAACAGGAGAATGG + Intergenic
912639854 1:111334495-111334517 CACAAGAAAGAGAAGCAGACAGG + Intergenic
913672129 1:121106970-121106992 TAGAATAATGAGCAGGAGAAAGG - Intergenic
913705739 1:121420714-121420736 TAGAAAAATGAGAAGGAGCCAGG + Intergenic
914023893 1:143894327-143894349 TAGAATAATGAGCAGGAGAAAGG - Intergenic
914460972 1:147884888-147884910 TAGAACAAAAAGCAGGAGAAAGG + Intergenic
914662383 1:149802366-149802388 TAGAATAATGAGCAGGAGAAAGG - Intronic
914984211 1:152442321-152442343 CAGAAAAAAAAACAGGAGTGGGG - Intergenic
915242093 1:154530775-154530797 CAGAAGAAAGAACCGGTGACTGG - Intronic
915578093 1:156794636-156794658 AAGAAAAAAATGCAGGAGTCAGG - Intronic
916117549 1:161500056-161500078 GAGAAAAAAGAGCAGGGAAAGGG - Intergenic
916163060 1:161938920-161938942 CAGAAAAGTGAGCTGGTGACTGG - Intronic
916229852 1:162530952-162530974 GAGACAAGAGGGCAGGAGACAGG - Intergenic
916624860 1:166544429-166544451 CACAATAAAGAGCTGGGGACTGG - Intergenic
917512702 1:175681441-175681463 CAGCAAAGAGAGCAGGAGCGAGG + Intronic
917534568 1:175864823-175864845 CAGAAAGGGGAGCAGGAGAGTGG + Intergenic
917588939 1:176457490-176457512 CAAAAAGAAGAGCAGAAGAGTGG - Intergenic
918126503 1:181588644-181588666 CAGACAAAAGACTAGGAGACTGG - Intronic
918210194 1:182343618-182343640 CAGACAAACTAGCAGGAAACAGG + Intergenic
918369072 1:183840361-183840383 GAGAAAGAAGTGTAGGAGACAGG + Intronic
918463826 1:184801682-184801704 CACAGTAGAGAGCAGGAGACAGG - Intronic
918714690 1:187770692-187770714 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
918809454 1:189096765-189096787 CAAATAACAGAGCAAGAGACAGG + Intergenic
918971694 1:191428033-191428055 CACAAAAGAGAGCAAGAGAGAGG - Intergenic
918993221 1:191725600-191725622 GAGAAAAAAGAGAAAGAGAGAGG + Intergenic
919176685 1:194028160-194028182 CAGAATAAAGAGCCTGAGCCAGG - Intergenic
919351607 1:196462834-196462856 AAGAAAAAACAACTGGAGACTGG - Intronic
919567326 1:199205061-199205083 CATAAAAATATGCAGGAGACTGG + Intergenic
919621297 1:199867105-199867127 CATAAAAAAGAACAGGACACTGG + Intergenic
920503667 1:206501389-206501411 CAGAGCACAGAGGAGGAGACAGG + Intergenic
921371549 1:214428156-214428178 CAGAAAAAATGACAGCAGACTGG + Intronic
921906601 1:220501997-220502019 CAGGAACAAGAGCAAGAGGCAGG - Intergenic
922029829 1:221787215-221787237 AAGAAAAAAGAGAATGGGACTGG + Intergenic
922232138 1:223696661-223696683 CAGAGAAGAGAGCAGGTGCCGGG - Intergenic
924178550 1:241418266-241418288 CAGGAAATTGTGCAGGAGACTGG + Intergenic
924616728 1:245618055-245618077 CAGAAGGAAGAGAAGGAGGCAGG + Intronic
1062997007 10:1875283-1875305 CAGTAAAAAGATCAGGAGTTGGG - Intergenic
1063036915 10:2295363-2295385 AAGAAAACAGAGCAGCAGAGAGG + Intergenic
1063105375 10:2987511-2987533 GAGAAAAAAGAGGAAGAGAGAGG - Intergenic
1063479417 10:6361238-6361260 CAAAATAAAGTGCAGGTGACTGG - Intergenic
1063577842 10:7278140-7278162 AAGAAAAAAGTTCAGCAGACAGG - Intronic
1064325748 10:14349649-14349671 CAAAAAAAAGTGGAGGAGAATGG - Intronic
1064620933 10:17216737-17216759 CAGAGAAAAGAGGAGCAGATTGG + Intergenic
1064759214 10:18601553-18601575 CAGAACTAGGAGCAGGAAACAGG + Intronic
1065386417 10:25138118-25138140 CAGAAAAAAAAGCAGGGGAAAGG + Intergenic
1066253951 10:33660842-33660864 CAGAGAAGAGAGCAGGGGAGGGG - Intergenic
1066518060 10:36185790-36185812 CAGAAAAATGACCAGAAGATGGG - Intergenic
1066525041 10:36268411-36268433 CTGAAAAAAGAGCTGTAGATTGG - Intergenic
1067084860 10:43232474-43232496 AAAAAAAAAAAGCCGGAGACTGG - Intronic
1067133040 10:43583576-43583598 CAGAAGAGAAAGCAGGAGAATGG + Intergenic
1067770575 10:49120700-49120722 CAGAAAAATGAGCTGGGCACAGG - Intergenic
1068052517 10:51968356-51968378 CAGAAGAAAGAGCAGGACTGTGG + Intronic
1068080395 10:52312200-52312222 CAGAAAAAAAGGCAAGAGATTGG + Intergenic
1068241381 10:54305892-54305914 CAGAAAAAAGACCAGGAAGCAGG + Intronic
1068621619 10:59189810-59189832 CAGAAGAAAAAGTAGGAGAGGGG + Intronic
1068803753 10:61171666-61171688 AAGAAAAATGAGGAGGGGACTGG + Intergenic
1069055142 10:63837024-63837046 CCCAAAAAAGAGCAGGATTCTGG + Intergenic
1069098098 10:64284679-64284701 AAAAAAAAAGGGCAGGAGAAAGG + Intergenic
1069740154 10:70682208-70682230 CAGAAGAAAGAGAAGAGGACCGG + Intronic
1070357478 10:75654560-75654582 TAGAATAAAGAGAAGGAGAGGGG - Intronic
1070491296 10:76979321-76979343 CAGAAAAGAGAGCTGGGGTCAGG + Intronic
1070630775 10:78082826-78082848 CAGCCCAAAGAGCAGGAGAGAGG + Intergenic
1070796743 10:79221375-79221397 CAGAACAAAGAGCTGGGGGCTGG - Intronic
1071033712 10:81216500-81216522 GAGAAAGAAGGGAAGGAGACAGG + Intergenic
1071762315 10:88622351-88622373 TAGAAAACAGAGCTTGAGACAGG - Intergenic
1071982146 10:91014228-91014250 AAGAAGAAAGGGCAGGAGCCTGG + Intergenic
1072605164 10:96975218-96975240 CAGAAAAAAAAGTAGGAAGCTGG + Intronic
1073140329 10:101242946-101242968 AAGAGAAAACAGCAGGAGCCAGG + Intergenic
1073297533 10:102450277-102450299 GAGAAACAAGTGCAGGAAACTGG + Exonic
1073531731 10:104238658-104238680 GAGAAACAGGGGCAGGAGACAGG - Intronic
1073874919 10:107911817-107911839 CAGCAAAAGGAACAGGAGAGAGG + Intergenic
1074155018 10:110790376-110790398 GAGAGCAAAGAGGAGGAGACAGG + Intronic
1074180917 10:111062078-111062100 CACAAAAAGGAGAAAGAGACAGG + Intergenic
1074181521 10:111069211-111069233 AAGAGAAAAGAGCTGGAGAAGGG - Intergenic
1074672200 10:115804455-115804477 AAGAGCAAAGAGCAGGAGCCAGG - Intronic
1075199449 10:120390014-120390036 CAGACAAGAGAGCAGGTGAAAGG + Intergenic
1075207397 10:120458738-120458760 TAGAAAATAGAGTAGGAGAAGGG - Intronic
1075441276 10:122480994-122481016 CAAAAAATAGAGGAGGAGAGAGG - Intronic
1075828955 10:125387593-125387615 CAGAAAAATGGGCAAAAGACTGG - Intergenic
1075888091 10:125919499-125919521 CAAAAAAAGGAGCAGCAGCCAGG - Intronic
1076464374 10:130668266-130668288 CAGAAATAAAAGCAGCAGAAAGG + Intergenic
1076794736 10:132793086-132793108 AAGAAAAATGAGCAACAGACAGG - Intergenic
1077554084 11:3217720-3217742 CAGAAAATGGAGCTGGAGAGAGG - Intergenic
1078344357 11:10531867-10531889 TAGAAAACAGAGCTGGAAACTGG - Intronic
1078459136 11:11500021-11500043 AAGAAAAAAGATCAAGAGAAAGG + Intronic
1078654832 11:13229029-13229051 CAGAGCAAAGAGAAGGAGACTGG + Intergenic
1078881671 11:15456106-15456128 AGGAAAAAAGAGCATGAGAGAGG - Intergenic
1079016201 11:16870804-16870826 CAGAAGATATAGCAGGAGAAAGG + Intronic
1079244543 11:18743022-18743044 CAGAAAGACCAGCAGCAGACTGG + Exonic
1079492403 11:21003586-21003608 CAGAGTATAGAGAAGGAGACAGG - Intronic
1079514219 11:21248046-21248068 TACAAAAAAGAGCAGGAGGCCGG + Intronic
1079804515 11:24912228-24912250 AAAAAAAAAGAAAAGGAGACAGG - Intronic
1081184466 11:40025180-40025202 CAGAAAAAAGACCATGTGAAAGG - Intergenic
1082757916 11:57096455-57096477 AAGAAAAAAGAGAAGGGGTCTGG - Intergenic
1083101978 11:60317691-60317713 TAGAAAACAGAGCCTGAGACAGG - Intergenic
1084023781 11:66435204-66435226 CAGAGAAGAGAGCAGGAGTTGGG - Exonic
1084118139 11:67053812-67053834 AAAAAAAAAGAGCAGAGGACAGG + Intergenic
1085286853 11:75368351-75368373 GAGAAAAAAGAGCCAGAGCCGGG + Intergenic
1086101134 11:83101157-83101179 AAGAAAAAAGAGAATTAGACAGG + Intergenic
1086134976 11:83436043-83436065 CAGAGCAAAGAGCAGGACAGGGG + Intergenic
1086229656 11:84553051-84553073 CAGAAGGAAAAGCATGAGACAGG - Intronic
1086416342 11:86592249-86592271 TAGAAAAAAAAGCAGCAGCCTGG - Intronic
1086554309 11:88091064-88091086 AAGAAAAAGGACCAGGAGAAGGG + Intergenic
1086607436 11:88712668-88712690 CAGAAAATAGACTAGGAGTCAGG + Intronic
1086775306 11:90823795-90823817 CAGTAAAAGGTGAAGGAGACAGG + Intergenic
1087766037 11:102155140-102155162 CAGAAAAGAGGGCAGGACAGTGG - Intronic
1088181534 11:107118213-107118235 CAGGAAAGAGAGCAAGAGAAGGG - Intergenic
1088330918 11:108650541-108650563 AAAAAAAAGGAGCAGGAGGCAGG + Intergenic
1088412240 11:109547352-109547374 CATAAGAAAGAGAGGGAGACAGG - Intergenic
1089001306 11:115054539-115054561 CAGAAGAAGCAGCAGGAGAAAGG + Intergenic
1089331443 11:117691732-117691754 CAGAAAAAGGAACAGGGGAGGGG + Intronic
1089347749 11:117801888-117801910 GAGAAAGAACAGCAGGAGAGAGG - Intronic
1089559513 11:119336737-119336759 CAGAAAAACCAGAAGCAGACAGG - Exonic
1089784834 11:120900578-120900600 GAGGAAAAAGAGCTGGAGCCGGG + Intronic
1090263568 11:125340047-125340069 TATAAAAATGAGCAGGAGATGGG - Intronic
1090480034 11:127059869-127059891 CAGAGGAAGGAGCAGGGGACAGG + Intergenic
1090728858 11:129552379-129552401 CAGGAAAAAGAACAAGAGAGGGG - Intergenic
1091712813 12:2753541-2753563 CAGAAAAAAAAGGAAGAGAAGGG + Intergenic
1091751852 12:3027260-3027282 CAAAGAAAGGAGCAGGAGGCTGG - Intronic
1091900616 12:4141183-4141205 CAGGTGAAAGAGCAGGAAACGGG + Intergenic
1092473573 12:8799642-8799664 AAGAAAAGAGAATAGGAGACAGG + Intergenic
1092943427 12:13431406-13431428 AACAAAAAAAAGCAGGAGAAGGG - Intergenic
1092973940 12:13725826-13725848 CAGAAATCAGAGCAGGACACAGG + Intronic
1092976066 12:13746078-13746100 CAAAAAATAAAGCAGGAGAAAGG + Intronic
1093268289 12:17026861-17026883 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1093461101 12:19407596-19407618 AAGAAAAAAGAGATGGAGGCTGG - Intronic
1093969358 12:25360840-25360862 CAGAAAAGGGAGCAAGAAACTGG - Intergenic
1094245099 12:28281769-28281791 CAGAAACAAGATCAAAAGACTGG - Intronic
1095694476 12:45129192-45129214 AAGAAAAAAGAAAAGGAGGCCGG + Intergenic
1097158016 12:57026795-57026817 CAGAAAAGAGAGGCAGAGACAGG + Intronic
1097234338 12:57529204-57529226 CAAAAACAAGAGGAGGAAACTGG + Exonic
1097586467 12:61521842-61521864 CAGAATGAAAAGCAGGACACTGG + Intergenic
1097945729 12:65365952-65365974 CCCAAAAAAGAGCAAGAGAAAGG - Intronic
1098085766 12:66841246-66841268 AAGAAAAGAGAGAAGGAGAAAGG - Intergenic
1098504854 12:71237612-71237634 TAGAAAAAAGAGGAGGAGGAGGG - Intronic
1098574564 12:72026621-72026643 GAGAAGAAAGAGCAGGAGGAAGG - Intronic
1098962407 12:76752713-76752735 CAGCAAAGAGAGCAGGATTCAGG + Intergenic
1099035611 12:77583840-77583862 AAGAAAGAATGGCAGGAGACAGG - Intergenic
1099157900 12:79202521-79202543 AAGAAGAAAGAGAAGGAGTCAGG + Intronic
1099580705 12:84443833-84443855 TAGAAAAAGGAGCAGGTGAAAGG - Intergenic
1099764001 12:86959470-86959492 CAGGAAGTAGAGAAGGAGACGGG - Intergenic
1099851478 12:88102506-88102528 GAGAAAAAGGAGCATGAAACAGG - Intronic
1100133440 12:91524189-91524211 CAGAAGAAAAAGTGGGAGACAGG + Intergenic
1100144048 12:91655341-91655363 CAGAAAAAAAAACAGGAGTTGGG - Intergenic
1100235960 12:92661130-92661152 AAAAAAAAAGAGCAGGAAGCAGG + Intergenic
1100393801 12:94167080-94167102 CAGAAATCAGAGAAGGACACCGG + Intronic
1100504228 12:95204324-95204346 AAGAAACCAGAGGAGGAGACTGG - Intronic
1100647229 12:96544460-96544482 GAGAAAAAGGAGCAGGAGAAAGG - Intronic
1100963945 12:99992047-99992069 GAGAAAAAGGAGCAGGTGACAGG + Intergenic
1101074105 12:101110248-101110270 CAGAAAGATGGCCAGGAGACTGG - Intronic
1102250707 12:111385522-111385544 CAGCAGAAAGAGCTGGAGAAAGG + Intergenic
1102646090 12:114404990-114405012 GAGATCAGAGAGCAGGAGACAGG - Intronic
1102688563 12:114742695-114742717 CAGAAAAGAGAGATGGAGGCAGG + Intergenic
1103034692 12:117647054-117647076 GAGAAAAAAGAGAGGAAGACAGG + Intronic
1103582398 12:121925013-121925035 GAGAAAAAAGGAGAGGAGACAGG - Intronic
1103714318 12:122935169-122935191 CAAAAAAAAGAGCAGGTGGCAGG + Intronic
1103795207 12:123498623-123498645 CAGACCAAGGAGCAGGAGATGGG - Exonic
1104500301 12:129278775-129278797 CAGAGAAATTAGCAGGAGACAGG + Intronic
1105220462 13:18321869-18321891 CAAAAAAAGGAGCAGCAGCCAGG + Intergenic
1105559473 13:21477062-21477084 CACAAAAAAAACCAGGAGACTGG + Intergenic
1105923371 13:24985071-24985093 CAGAAGATACAGCAGGAGAAGGG + Intergenic
1105924236 13:24992511-24992533 CACAAAAAAGAGCGGGAGCAAGG - Intergenic
1105939530 13:25135022-25135044 CAGAAATAAGAGGCAGAGACAGG + Intergenic
1106306012 13:28510317-28510339 AAGAAAAAAGAAAAGCAGACAGG + Intergenic
1106524514 13:30528145-30528167 TAGAAAACAGCCCAGGAGACGGG - Intronic
1106538357 13:30667893-30667915 AAGAAAAAAGACCAGGAGGAAGG + Intergenic
1106579436 13:31004905-31004927 AAGAAAGAAAAGCAGGAGCCTGG - Intergenic
1107049461 13:36031963-36031985 GAGAAAAAAGGGAAGGGGACAGG + Intronic
1107242107 13:38248690-38248712 CAGAAGAAGGAGGAGGAGAAAGG - Intergenic
1107442255 13:40438543-40438565 CAGCAAAAAGAAAAGGAAACTGG - Intergenic
1107473744 13:40715068-40715090 CAGAAAAAAGCACAGGATCCAGG - Intergenic
1108020685 13:46124983-46125005 GAGAAAGAAGAGGAGGAGACAGG - Intergenic
1108319210 13:49271277-49271299 GGGAAAAAAGAGCAGGAGGAAGG + Intronic
1108357810 13:49643123-49643145 CAGAAGAAAGAGTACCAGACTGG + Intergenic
1108409836 13:50134402-50134424 CATGAAAATGACCAGGAGACAGG + Intronic
1108770067 13:53688832-53688854 GGGAAAAAGGAGAAGGAGACAGG + Intergenic
1108979205 13:56489414-56489436 CAGAAAAAAAAAAAGGAGAAAGG - Intergenic
1109249876 13:60006712-60006734 AAAAGAAAAGAGGAGGAGACTGG + Intronic
1109843815 13:67957207-67957229 AAGAAAAAAGAGCATCAGATTGG - Intergenic
1110046287 13:70836260-70836282 AAGAAAAAAGAGATGGAGAGAGG - Intergenic
1110431544 13:75429743-75429765 AAGAAAAAAGAGGAGAAAACTGG + Intronic
1110486324 13:76048896-76048918 AAGAAACTAGGGCAGGAGACAGG - Intergenic
1111025826 13:82521575-82521597 AAGAAAAATGAGCAGTAGACTGG - Intergenic
1111232890 13:85366933-85366955 CAGAAACAACAGAAGGAGACGGG - Intergenic
1111556344 13:89885899-89885921 AAGAATAAACAGCAGGAGAAAGG - Intergenic
1111611329 13:90611786-90611808 GAGGAACAAGAGCTGGAGACAGG - Intergenic
1111877994 13:93920524-93920546 CAGAAAGAAGAGCAGTATAGGGG - Intronic
1112554248 13:100452154-100452176 AAGAAAAAAGAGAAGGAGAGAGG - Intronic
1113048761 13:106185364-106185386 CAGAATACAGAGCAAGTGACAGG - Intergenic
1113473917 13:110566356-110566378 AAGAAAAGGGAGGAGGAGACGGG + Intergenic
1113561939 13:111288040-111288062 CTGAAAAAAGGGCAGGAGATAGG - Intronic
1113800437 13:113083573-113083595 CAGAAAACAGCCCAGGAGCCTGG + Intronic
1114029444 14:18563838-18563860 CAGAAAGAAGAGAATCAGACAGG - Intergenic
1114194259 14:20463019-20463041 CAGCAGAAAAAGCAGCAGACTGG - Intergenic
1114528515 14:23380890-23380912 CAGGAAAAAGACCAAGAGAGAGG - Intergenic
1115045726 14:28990707-28990729 CAGAAACCAGTGCAGAAGACAGG - Intergenic
1115103695 14:29734334-29734356 CATATAAAAAAGCAGGAGGCTGG - Intronic
1115631201 14:35247321-35247343 CAGAAAAAATAGTAAGAGAAAGG - Intronic
1116722615 14:48519184-48519206 CAGAAACAAGAGAAGGGTACTGG + Intergenic
1117449538 14:55837495-55837517 GAGAAAGAAGGGCAGGAGACGGG + Intergenic
1117748248 14:58893204-58893226 CAGAAAAAGGGGCAGGAGACAGG + Intergenic
1118247502 14:64125589-64125611 CAGAGAAGATAGTAGGAGACAGG + Intronic
1118608627 14:67522264-67522286 CAGAAATGAGAGCAGTAGAGTGG - Intronic
1118626080 14:67660578-67660600 CAGAAAGAGGAGCAGGAGAAGGG - Intronic
1119101706 14:71885931-71885953 GAGAAAAAAGAGAAGGAGAGTGG - Intergenic
1119236110 14:73020680-73020702 AAGAAAAAAGAGCAGGAGCCAGG + Intronic
1119316864 14:73703820-73703842 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1119414270 14:74459194-74459216 CTCAAAAACCAGCAGGAGACAGG + Intergenic
1119476773 14:74934977-74934999 CAGAGAAGAGAGAAGGAGAAGGG + Intergenic
1119554801 14:75545090-75545112 CAGAAAAAAGAGAAGCTCACAGG + Intronic
1120175704 14:81291096-81291118 GAGAAAAAAGGAAAGGAGACAGG + Intronic
1120855791 14:89211506-89211528 CTGAAGAAAGAACAGGAAACAGG + Intronic
1120916984 14:89719132-89719154 CAGATAGAAAAACAGGAGACAGG + Intergenic
1120940076 14:89939488-89939510 CAGCAACAGGAGCAGGAGGCGGG + Intronic
1121416943 14:93786345-93786367 CAGAGAAGAGAGCAGAAGATGGG + Intronic
1121557361 14:94848539-94848561 GAGAAAATGGAGCAGGAGAGTGG + Intergenic
1121684811 14:95827884-95827906 CAGAAAATGGAGCTGGTGACTGG + Intergenic
1121686304 14:95837854-95837876 CATAAAATAGAGCTGTAGACTGG - Intergenic
1121728171 14:96167936-96167958 CAGAGAAAACAGCATGAGACAGG - Intergenic
1122406375 14:101503513-101503535 GAGAGAAAAGAGCAAGAGGCCGG - Intergenic
1122623044 14:103070603-103070625 CAGAACAAAGAGGAGGAGAGAGG - Intergenic
1122816072 14:104314734-104314756 CACAGAAGAGAGCAGGAGCCAGG - Intergenic
1123159551 14:106264655-106264677 CAGAAAAGTGTGCAGGAGGCCGG - Intergenic
1123190591 14:106565637-106565659 CAGAAAAGCGCGCAGGAGGCCGG - Intergenic
1123216172 14:106811055-106811077 CTGAAGAAAGAGCAGGACCCAGG + Intergenic
1124070443 15:26388037-26388059 CTGAAAACAGAGCAGGAGGTTGG - Intergenic
1124097813 15:26665599-26665621 CAGAAAAAGGAGCTGGTGTCAGG + Intronic
1124427477 15:29574044-29574066 CAGAAAGAAGGGAAGGAGAAAGG + Intergenic
1124841607 15:33247358-33247380 AAAAAAAAAAAGGAGGAGACAGG - Intergenic
1124992741 15:34692025-34692047 AAGAAAGAGAAGCAGGAGACAGG + Intergenic
1125163933 15:36680253-36680275 CAGAAAGAAGGGCAAGTGACAGG - Intronic
1125313498 15:38406316-38406338 CAGAAAAAAGAGGTGCAGATGGG - Intergenic
1125333564 15:38605511-38605533 TAGAAAACAGAGGAGGAGAAAGG - Intergenic
1125433536 15:39622841-39622863 CAGAAAAATGAGCAGCAGTTGGG - Intronic
1125455024 15:39848939-39848961 AAGAAAAAAAAGCAGAAGAGAGG + Intronic
1125811313 15:42543881-42543903 AAGAAAAAGGATCAGGAGACAGG - Exonic
1126139995 15:45429895-45429917 CGGAAAAATGAGCTGCAGACCGG - Intergenic
1126238129 15:46409485-46409507 CAGAAAAAAGAGCAGAGCAATGG - Intergenic
1126252621 15:46587080-46587102 CAGAAAAAAGAATTGAAGACAGG - Intergenic
1126963596 15:54026565-54026587 CAGCAAAATCAGCTGGAGACTGG - Intronic
1127314943 15:57785978-57786000 CAGGAGAAGGAGCAGGTGACGGG - Intergenic
1127454489 15:59144588-59144610 CAGAAAAAAGACCTGGAACCCGG - Intronic
1127479607 15:59366278-59366300 GAGAAAAAAAAGAAAGAGACAGG - Intronic
1127907116 15:63384119-63384141 GAGAAGAAGGGGCAGGAGACAGG - Intergenic
1128671631 15:69578240-69578262 CTGGAATAAGTGCAGGAGACTGG + Intergenic
1129267274 15:74400489-74400511 CAGCAAAGAGAGCAGGAGCTTGG + Intergenic
1129504400 15:76069309-76069331 CAGAAAAAGCAGGAGGAGATAGG + Intronic
1129699270 15:77758281-77758303 CAGAAGAAAGAGCACTGGACTGG + Intronic
1130033896 15:80340958-80340980 CAGGAAACAGAGGAGGAGAAGGG + Intergenic
1130543502 15:84838957-84838979 CTGAGAAAGAAGCAGGAGACTGG - Intronic
1131297096 15:91158723-91158745 GAGAAAAAAGAGGAGAAGAGAGG - Intronic
1132425294 15:101710805-101710827 CAGAAACAAGAGAAGGAGAGGGG + Intronic
1133385924 16:5370449-5370471 AAAAAAAAAGAGGAGGAGGCTGG - Intergenic
1133690458 16:8209662-8209684 GAGGAAAAAGAGGAGGAGCCAGG + Intergenic
1133849665 16:9490299-9490321 CAGAAAACAGAGCAAGATAAAGG + Intergenic
1134187860 16:12098618-12098640 CAGGCAAAAGAGGAGGAGAGGGG - Intronic
1134239860 16:12497600-12497622 CAAATACAAGAGAAGGAGACTGG - Intronic
1135001967 16:18784246-18784268 GAGAAAAAAGAGAGAGAGACAGG - Intronic
1135166792 16:20146271-20146293 CAGAGACAAGAGCAGGAAATGGG - Intergenic
1135271498 16:21073637-21073659 AAGATAAAGGAGCAGGAGAAAGG - Intronic
1135340264 16:21639758-21639780 CAGAAAAATGGGCAGGGGAAAGG - Exonic
1135942134 16:26831057-26831079 CAGCAAGAAGTGCAGGAGGCAGG + Intergenic
1136301095 16:29334847-29334869 CAGCAGAAAGAGCGTGAGACGGG - Intergenic
1137037853 16:35581316-35581338 CATGAAAAATAGCAGGAAACTGG + Intergenic
1137455006 16:48611204-48611226 CAGAAAACAGACCTGGAGAGGGG - Intronic
1137507376 16:49065878-49065900 TAGAAAAAAGAGCAGGTGGAAGG - Intergenic
1137612804 16:49830184-49830206 CAGAAGAAGGAGAAGGAGCCAGG + Intronic
1138091077 16:54175080-54175102 CAGAAAAAATAGCTGCAAACTGG + Intergenic
1138282527 16:55783016-55783038 CAGAAAAAGGAGAAGGAAATTGG + Intergenic
1138286414 16:55813603-55813625 CAGAAAAAGGAGAAGGAAATTGG - Intronic
1138319403 16:56099056-56099078 CAGCAAAAAGAGAAGGAGGTGGG + Intergenic
1139097784 16:63726795-63726817 AAGAAAAAAGAGAAAGAGAAAGG - Intergenic
1139449578 16:67018736-67018758 AAGAAAAAAGAAAAGGAGGCAGG + Intergenic
1139665254 16:68450599-68450621 TTGAAAGAAGAGCAGGAGGCCGG - Intergenic
1139800087 16:69515452-69515474 GAGAAAAAGGGGCAGGAGATAGG - Intergenic
1140357666 16:74320002-74320024 CAGAGAAGAGTGCAGGAGAAAGG - Intergenic
1140836388 16:78798052-78798074 CAGAAACAAAAGGAGAAGACTGG - Intronic
1140866371 16:79066093-79066115 AAAAAGAAAAAGCAGGAGACAGG - Intronic
1141708127 16:85680838-85680860 CAGAGAAAAGAGCTGTAGAGAGG + Intronic
1141931631 16:87208500-87208522 CAGCAAAAAGAGAAGGAGAAAGG + Intronic
1142005116 16:87686001-87686023 GAGACAGAAGAGGAGGAGACAGG + Intronic
1142644027 17:1300663-1300685 CAGAGCACAGAGCAGGAGAAGGG + Exonic
1142774436 17:2125179-2125201 GGGAAAATAGAGAAGGAGACAGG + Intronic
1142883184 17:2896732-2896754 TAGGAAAAAGGGCAGGAGGCGGG - Intronic
1143224203 17:5286844-5286866 AAGAAAACAGAGCAGGAGAAAGG + Intronic
1143228913 17:5334228-5334250 CAAAAAAAAGAGAAGGAAAGGGG - Intronic
1143361204 17:6372771-6372793 GAGAAAAAAAAGAAGGAGGCAGG + Intergenic
1143405931 17:6677260-6677282 CTGGAGAAAGAGCAGGAGCCAGG - Intergenic
1143559448 17:7684005-7684027 CAGAAAACAGAGGAACAGACTGG - Intronic
1143638991 17:8184653-8184675 AAGAAAAAAGAAAAAGAGACTGG + Intergenic
1143711492 17:8739104-8739126 AAGAAAAAAGAGAAAGAGAGGGG + Intronic
1143720142 17:8803558-8803580 CAGAAGAAAGAGGAAGAGTCAGG + Intronic
1144694740 17:17295144-17295166 AAGAAAAAAGAGAATGAGGCCGG - Intergenic
1145255035 17:21317799-21317821 AAGAAAAAAATGCAGCAGACAGG + Intergenic
1145292782 17:21563013-21563035 CAGAAAAATGAACAAGAGAAAGG - Intronic
1146018724 17:29255331-29255353 TATTAGAAAGAGCAGGAGACGGG - Intergenic
1146630848 17:34468272-34468294 GAGAAAAGAGAGAAGGCGACAGG - Intergenic
1146916856 17:36683481-36683503 CAGATTACAGAGCAGGAGGCTGG - Intergenic
1147966202 17:44195524-44195546 CAGAGAAAAGAGAAGGACAGGGG + Intronic
1148038403 17:44686493-44686515 CAGGAAAAGGAGCAGCAGAGAGG + Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1149180012 17:53924670-53924692 CTGAAAGAAGAGCAGCAGGCTGG - Intergenic
1149336332 17:55640099-55640121 GAGAAAAGACAGCAGGAGAAAGG - Intergenic
1149540521 17:57464737-57464759 CAGAGAAAAGAGGAAGGGACAGG - Intronic
1149885594 17:60336867-60336889 CAGAACAACCAGCAGGATACTGG - Intronic
1150562853 17:66309809-66309831 CAGAGAAAGGAGAAGAAGACAGG + Intronic
1150867570 17:68869968-68869990 CAGAAAAATGTGAAGGAAACTGG - Intronic
1151390608 17:73784477-73784499 CAGAGAAAGGAACTGGAGACAGG - Intergenic
1151458942 17:74243382-74243404 CAGGATAAAGAGCAGGAGGTAGG - Exonic
1151986416 17:77546939-77546961 CAGAACAAAGGCCTGGAGACTGG + Intergenic
1152042745 17:77915072-77915094 CAGAGAAAAGGGCAGGAGGATGG - Intergenic
1152329898 17:79666588-79666610 CAGAAAAGAGAGAATGAGGCTGG + Intergenic
1152432592 17:80257630-80257652 CAGAAACAAGACCAGGTGCCGGG + Intergenic
1152432606 17:80257701-80257723 CAGAAACAAGACCAGGTGCCGGG + Intergenic
1152810724 17:82380874-82380896 CAAAAAAAAAAGCAGCAGAAAGG + Intergenic
1153118368 18:1688872-1688894 CAGAAAAAGAAATAGGAGACAGG - Intergenic
1153523680 18:5975864-5975886 CAGAAGACAGTGCAGCAGACAGG - Intronic
1153800122 18:8661347-8661369 CAAGAAAAAGAGCAGGAGAGAGG + Intergenic
1153884654 18:9453355-9453377 CAGAAAAAAGAATAGGATATTGG - Intergenic
1154975432 18:21452819-21452841 CAGAAAAAAGAACAGGAGAAAGG + Intronic
1155356821 18:24961183-24961205 CAGAAGAAGGAGCAAGACACAGG + Intergenic
1155555863 18:27018831-27018853 CAGGAGAGAGAGCAGGAGAATGG + Intronic
1155567106 18:27147444-27147466 CAGAAAAGAAACCAGGAGTCGGG + Intronic
1155608569 18:27636244-27636266 CAGAGAACAGAGCTGGAAACAGG + Intergenic
1156099760 18:33578799-33578821 AATAACAAAGAGCAGGAGCCCGG - Intronic
1157131201 18:45008991-45009013 CAGATGAACGAACAGGAGACTGG + Intronic
1157584701 18:48793637-48793659 AAGAAAAGAGAGGAGGAGAAGGG - Intronic
1157663864 18:49469114-49469136 CAGAAACAAGGGCAAGAGAAGGG + Intergenic
1158189768 18:54813568-54813590 CAGAAGGCAGAGCAGGAGCCAGG - Intronic
1158447882 18:57536867-57536889 CAAAAAACAGAGGAGGAGCCGGG + Intergenic
1158670432 18:59469230-59469252 GAGACATAAGAGCAGGAGAAGGG - Intronic
1158855719 18:61541921-61541943 GAGAACAGAGAGCAGGAGAGCGG + Intronic
1158952732 18:62510361-62510383 AAAAAAAAAGAACAGGAGACAGG + Intergenic
1159502803 18:69295431-69295453 CAGAAAGAAGAGAAGGAGCAAGG + Intergenic
1160045795 18:75386219-75386241 TAGAAAGAGGAGCAGGAGAGAGG - Intergenic
1160622113 18:80178913-80178935 AGGAAGGAAGAGCAGGAGACAGG + Intronic
1160685483 19:434627-434649 CAGAAAGAAGAGCTGGAGGTAGG + Intronic
1161563985 19:4989287-4989309 CAGAAAAAAGAAAGGAAGACTGG - Intronic
1161820789 19:6529659-6529681 CAGATAAAAGAGCCAGAGACAGG + Intergenic
1161820800 19:6529864-6529886 TAGATAAAAGAGCCAGAGACAGG + Intergenic
1161820810 19:6530033-6530055 TAGATAAAAGAGCCAGAGACAGG + Intergenic
1162001062 19:7745314-7745336 CAGAACAGAAGGCAGGAGACTGG + Intronic
1162661781 19:12175131-12175153 GAGAAAAAAGAGCAAGTGAAAGG + Intronic
1162715928 19:12633481-12633503 CAGGAAAATGAGCAGGAAGCAGG - Intronic
1163413200 19:17169791-17169813 AAAAAAAAAAAGGAGGAGACAGG - Intronic
1163764193 19:19153328-19153350 CAGAAGGAAGAGCAGGTGCCAGG + Intronic
1164149930 19:22541984-22542006 AAGAAAAAAGAACAGAAGAATGG - Intergenic
1164211940 19:23106207-23106229 AAGAAAAAAGAGGAGGAGGAAGG + Intronic
1164763164 19:30743389-30743411 CAGCAATAAGAGGAGGAGATTGG + Intergenic
1164937041 19:32223150-32223172 AAGAGAAAAGAGGAGGAGAAAGG + Intergenic
1165020736 19:32922105-32922127 CACAAAAATGAGCAGGACATTGG + Intronic
1165451188 19:35884394-35884416 AAAAAAAAAAAGAAGGAGACAGG - Intergenic
1165637491 19:37354273-37354295 CAGAAACAAGAGGAGGGGAGGGG - Intronic
1165957704 19:39511996-39512018 AAAAAAAAAGAGCCTGAGACTGG - Intergenic
1166135802 19:40776448-40776470 CATAAAAAATAGCAGCAGCCGGG + Intronic
1166161812 19:40959625-40959647 CACAAAGAAGAGATGGAGACAGG - Intergenic
1166229866 19:41420387-41420409 AAAAAAAAAGTGCAGGAGCCTGG + Intronic
1166585603 19:43945332-43945354 CAGAAGACAGAGCTGGAGAAGGG - Intergenic
1166717491 19:44977707-44977729 CAGAAAAAGCAGCTGGAGACAGG + Intronic
1167046877 19:47054903-47054925 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1167428337 19:49441121-49441143 CAGAAAAAGGAACAGGATAATGG + Intronic
1168072015 19:53958652-53958674 CAGAAAAAATAACGGGAGAGGGG - Intergenic
925311799 2:2890009-2890031 CAGCAGAAAGAGCTGCAGACTGG + Intergenic
925742914 2:7021051-7021073 CAGAAACAAGAACAGGAGTAGGG + Intronic
926267110 2:11333852-11333874 CAGAAAAAAGTTAAGGAGAAGGG + Intronic
926753942 2:16221222-16221244 AAGAAAAAAGAGCACAAGGCTGG + Intergenic
927301288 2:21518777-21518799 CAGAAAAATGAGCAGGCAACTGG - Intergenic
927338208 2:21950039-21950061 GAAAAGAAAGAGAAGGAGACAGG - Intergenic
927599637 2:24429609-24429631 GAGAAAAATCAGCAGGACACGGG - Intergenic
927599791 2:24430812-24430834 AAAAAAAAAAAGCAAGAGACTGG + Intergenic
928197568 2:29226494-29226516 AAAAAAAAAGAGGAGGAGAATGG + Intronic
928619336 2:33072596-33072618 GAGAAAAAAGTGCAGGTGAAAGG + Intronic
929783973 2:44975949-44975971 CAGGAGAAAGAGCAGAAGCCGGG + Intergenic
929941085 2:46334475-46334497 TTGAAAGAAGAGCAGGATACAGG - Intronic
930014038 2:46958467-46958489 AAGAGGAGAGAGCAGGAGACAGG - Intronic
930036238 2:47087131-47087153 CTGAAAACAGAGCAGAAAACAGG + Intronic
930714084 2:54576348-54576370 CAGAAAGAAGAGCTGAAGGCCGG - Intronic
931305488 2:61024391-61024413 CAGAAAAGAGAGTAAGATACAGG - Intronic
932452239 2:71818935-71818957 CAGAAGACAGATCAGGACACTGG - Intergenic
932555380 2:72819489-72819511 CAGAGAAAGGAGGAGGAGATAGG - Intronic
932890533 2:75592586-75592608 AAGAAAGAACAGAAGGAGACTGG - Intergenic
933674759 2:85044812-85044834 CAGAAATAAAAGCAAGAGGCTGG - Intronic
933888129 2:86739412-86739434 CAGGAAAAAAAGGAGGAGAAGGG - Intronic
933922049 2:87057294-87057316 CAGGAAAAAAAGGAGGAGAAGGG + Intergenic
934056942 2:88259015-88259037 AAGAAAAAAAAGAAGAAGACTGG + Intergenic
934779086 2:96957732-96957754 AAGAAGAAAGAGCTGGAGAAAGG - Intronic
934858457 2:97743630-97743652 CATAAACAAGAACAGGAGGCCGG - Intergenic
934939273 2:98488781-98488803 CAGGGAAAGGACCAGGAGACTGG + Intronic
935068356 2:99672417-99672439 CAGACAAAAGACCAGCAGCCTGG + Intronic
935225156 2:101046654-101046676 GAGAAAGAAGAGCAGGAAAAGGG + Intronic
935234022 2:101123072-101123094 CCTAAAACAGAGCAGGAAACTGG + Intronic
935408712 2:102736725-102736747 CGGAAACAGGAGCAGAAGACAGG - Exonic
935490002 2:103707459-103707481 CAGAAAAAATAGCAACAGAATGG + Intergenic
936437121 2:112517942-112517964 CCAAAAAAAAAGCAGGAGACAGG - Intronic
936731258 2:115384138-115384160 GAGAAAGAGGAGCAGAAGACAGG - Intronic
937051146 2:118892033-118892055 CCAAAAAAAAAGCAGGAGAAAGG + Intergenic
937237026 2:120437224-120437246 GAGATAAAAGAGCAGGAGAAGGG + Intergenic
937943741 2:127311878-127311900 AAGAAAAAAGAAAAGGAGATTGG - Intronic
938025568 2:127944916-127944938 AAAAAAAAAGAACAGGAGAGAGG + Intronic
938029809 2:127982344-127982366 TAGACAAGAGAGGAGGAGACAGG + Intronic
938067002 2:128286802-128286824 CAGAAAACAGAGCAGGCTGCTGG + Intronic
938143808 2:128817701-128817723 CAGAAAATAGAGAAAGAAACCGG - Intergenic
938190394 2:129274288-129274310 CAGGAAAAGGAGCAGAGGACAGG - Intergenic
938301513 2:130217536-130217558 AAAAAAAAAGAGCGGGGGACGGG - Intergenic
939023983 2:136989984-136990006 AAGAAAAGAAAGCAGAAGACAGG - Intronic
939564497 2:143770956-143770978 CAGAAAACACACCAGGAAACAGG + Intergenic
939675337 2:145065433-145065455 CAGAATAAATACCAGGAGACTGG + Intergenic
939868153 2:147498016-147498038 GAGAAAACAAACCAGGAGACTGG - Intergenic
939931011 2:148232879-148232901 TTGAGAAAAGAGAAGGAGACTGG - Intronic
940255905 2:151729034-151729056 CAGAAAATAAAGCATGAGAGAGG + Intronic
941298546 2:163772088-163772110 GAGATAGAAGAGCAGGACACTGG - Intergenic
941424759 2:165328516-165328538 CAGGAAGTAGAGAAGGAGACAGG + Intronic
942381919 2:175400509-175400531 GAGAAAAAAGAGCAGAAAAAAGG - Intergenic
942419651 2:175794895-175794917 GAGAAAAAGGGGCAGGAGACAGG + Intergenic
942813425 2:180023418-180023440 CAGAAAAAGGAGCATGATGCTGG + Intergenic
943183936 2:184580798-184580820 CAGAATAAAGAACAGGAGGAAGG - Intergenic
943311132 2:186326119-186326141 GAGAAAGAGGAGCAGGAGAAAGG - Intergenic
943328995 2:186536476-186536498 CAGAAAAATGAGATGGTGACTGG + Intergenic
943464958 2:188217867-188217889 AAGAAAAGGGAGCAGGAGGCTGG - Intergenic
943976915 2:194493655-194493677 CAGAGAAAAGAGAAGGAAGCTGG + Intergenic
944832684 2:203548875-203548897 AAGAAAAAAGAGCAGGGCAGAGG - Intergenic
946139862 2:217681239-217681261 GAGAAGAAAGGGCATGAGACAGG + Intronic
946187510 2:217989333-217989355 CAGAGAATAGGTCAGGAGACAGG + Intronic
947601377 2:231452751-231452773 AAGAAAAAGAATCAGGAGACAGG + Exonic
948611807 2:239174344-239174366 CAGAAAAATGGGCAAGAGACTGG + Intronic
948744769 2:240080784-240080806 CAAAAAAAATAACAGGAGGCCGG + Intergenic
949001484 2:241616708-241616730 CAGAAAAAATAACATCAGACTGG + Intronic
1169144993 20:3246603-3246625 AAGAAAAAAGAGAAAAAGACAGG - Intergenic
1169289403 20:4335800-4335822 CAGGAAAAAGAGAGAGAGACGGG - Intergenic
1169321909 20:4640138-4640160 CAGAAAACAGATCAGCAGCCGGG + Intergenic
1169369400 20:5016983-5017005 AAAAAAAAAGAGAAGGAGACAGG - Intergenic
1169384978 20:5141077-5141099 GAGAGAAAGGAGCAGGAGAAAGG - Intronic
1169657785 20:7944121-7944143 CACCAAAAGGAGCAGGAGAGAGG + Intergenic
1170306354 20:14942441-14942463 AAGAAAAAGGAGGAGGAGAAAGG - Intronic
1170522029 20:17196513-17196535 CATAAAAAAGAGCAGGCCACAGG - Intergenic
1170614444 20:17937611-17937633 AAGGAAATGGAGCAGGAGACTGG - Intergenic
1171154853 20:22862526-22862548 CAGAAAAGTGAACAGGTGACAGG + Intergenic
1171255943 20:23689109-23689131 CAGAAAGAGGAGGAGGAGTCAGG - Intergenic
1171272356 20:23826800-23826822 CAGAAAGAGGAGGAGGAGTCAGG - Intergenic
1171453942 20:25256026-25256048 CAAAAGAAAGAGCTGGAGCCAGG - Intronic
1172618164 20:36303436-36303458 AAGAAAAAAGAGCAAAAAACAGG - Intergenic
1172946975 20:38697247-38697269 CAGGAAAAGAAGCAGGAGATGGG + Intergenic
1172982519 20:38955160-38955182 TAGAAATAAGAGCAAGAGCCGGG + Intergenic
1173111960 20:40199424-40199446 CAGAAATATAAGGAGGAGACAGG - Intergenic
1173118576 20:40269552-40269574 CAGAGCAAAGAGCAGGACAGGGG - Intergenic
1173196467 20:40917875-40917897 CTGAAAAATGAGCAGCAGCCGGG + Intergenic
1173447911 20:43137055-43137077 CAGGTAGAAGACCAGGAGACGGG - Intronic
1173470560 20:43320367-43320389 CAGACAGAAGGGCAGGAGGCAGG - Intergenic
1173596960 20:44264620-44264642 CGGAAAAAAGAGGCTGAGACTGG - Intronic
1174554476 20:51383936-51383958 CAGAAAAGAGACCTGGAGGCTGG + Intergenic
1174669261 20:52291332-52291354 CTGACAAAAGAGCAGTAGATGGG + Intergenic
1174891328 20:54398325-54398347 CAGACAGAAGAGCTGGAGAGGGG - Intergenic
1174945360 20:54979527-54979549 TAGAAAAAAGAACAGAAGCCTGG + Intergenic
1175034335 20:55985354-55985376 CAGTAGAAGCAGCAGGAGACTGG + Intergenic
1175723246 20:61300284-61300306 TTGAAAAATGAGCAGGAGAAGGG + Intronic
1175815937 20:61883256-61883278 TAGAAAACACAGCAGGAGAGAGG - Intronic
1176676974 21:9787796-9787818 GATAAGCAAGAGCAGGAGACTGG - Intergenic
1177444676 21:21177709-21177731 GGGAAAAAAGAGAAGGAGAGGGG - Intronic
1177748506 21:25251241-25251263 CAGAGGAAAGAGAAAGAGACAGG - Intergenic
1177759834 21:25390938-25390960 TAGAATGAAGAGGAGGAGACTGG - Intergenic
1177862879 21:26475192-26475214 AAGAAAAAAAAGCATGAAACAGG - Intronic
1178275626 21:31234301-31234323 CTGAAAAGAGAGCAGGAGAGGGG + Intronic
1178549296 21:33522032-33522054 AAGAAAAGAAAGCAGAAGACTGG + Intronic
1178998138 21:37426288-37426310 CATAAAAACGAGCAGTGGACAGG + Intronic
1179045334 21:37839273-37839295 CAGAAATAAGAGCAGGGGAGAGG + Intronic
1179217274 21:39378382-39378404 CAAAACAAAGAGCAGGAGTCTGG - Intergenic
1180453559 22:15490888-15490910 CAGAAAGAAGAGAATCAGACAGG - Intergenic
1180840782 22:18957920-18957942 CTGAAGACAGTGCAGGAGACCGG - Intergenic
1181060704 22:20280854-20280876 CTGAAGACAGCGCAGGAGACCGG + Intronic
1181449387 22:23008395-23008417 AAGAAAAAAAAGCAAGAGGCAGG + Intergenic
1181647667 22:24242606-24242628 CAGAAAAAAGAGCAGGAGACTGG + Intronic
1181752313 22:24997340-24997362 CAGGAAAAAGAGAAGGCGACTGG + Intronic
1182106684 22:27694821-27694843 CTGAATAAAGAGATGGAGACAGG + Intergenic
1182678492 22:32059482-32059504 CATAAACAAAAGCAGGAGGCAGG + Intronic
1183080356 22:35452032-35452054 AAGAAAAAAGGGCAGAAGCCAGG - Intergenic
1183680956 22:39328901-39328923 CAGAAAAATGATGAGGAGACAGG - Intergenic
1183775461 22:39961288-39961310 GAGAAAGAGGAGCGGGAGACAGG + Intronic
1184361454 22:44021387-44021409 GAGAAAAAGGAGCAGGTGAAAGG + Intronic
1184722297 22:46322090-46322112 AAAAAAAAAGAGCAGGAGAGAGG + Intronic
1185085209 22:48737240-48737262 CAGGACAAAGACCATGAGACAGG + Intronic
1185351490 22:50341996-50342018 AAAAAAAAAGAGGAGGAGAGGGG + Intergenic
949459734 3:4277518-4277540 GAGGAAAAGAAGCAGGAGACAGG + Intronic
949494615 3:4619837-4619859 GAGAAAAGAGAGAAGGAGAGGGG - Intronic
949567239 3:5256265-5256287 GAGAAAAAAGAGAAGGAGAAGGG - Intergenic
950183985 3:10933876-10933898 CAGAATAAAGAGCAGCAGGAGGG - Intronic
950335234 3:12187972-12187994 TGGAAAAAAGAGTGGGAGACAGG - Intronic
950394127 3:12720710-12720732 AAAAAAAAAAAGCAGGGGACAGG - Intergenic
950918300 3:16667490-16667512 GAGAAAAGAGAGCAGGAGTGGGG + Intronic
951143404 3:19195903-19195925 CTGAAAAAAGACCAGGACACAGG - Intronic
951226938 3:20131313-20131335 CAGTAAAAAGATCAGGAAATTGG - Intronic
951800519 3:26590631-26590653 CAGGAAAAAGAGAAAGAGAAGGG - Intergenic
951972786 3:28466500-28466522 CAGAAAATAAAGCCCGAGACTGG + Intronic
951976498 3:28516405-28516427 AAGAAAGAAAAGCAGAAGACTGG + Intronic
952062058 3:29522798-29522820 CAGGATACAGAGCATGAGACTGG + Intronic
952108434 3:30095208-30095230 TAGAAAAATGAGCAGGAGATAGG + Intergenic
953423380 3:42772513-42772535 AAGAAGAAAGAGAAGGAGAGGGG - Intronic
953612470 3:44458701-44458723 GAGAAAAAGGAGCAGGTGAAAGG - Intronic
954015594 3:47687382-47687404 CAGAAAAAACAGGAAGAGGCTGG + Intronic
954051952 3:47986635-47986657 CTGAAAGAAGAGCAGGGGACCGG - Intronic
954203204 3:49037736-49037758 AAAAAAAAAGGGCAGGGGACGGG + Intronic
955002778 3:54942591-54942613 AAGAAAAAGAAGCAGGAGCCAGG + Intronic
955092682 3:55768045-55768067 CAGAAAAAGGAGGAAGAGAGTGG - Intronic
955346201 3:58163774-58163796 GAGTAAAAAGAGGAGGAGATAGG - Intronic
955480891 3:59388670-59388692 CAGAATAAAGAGGAAGTGACAGG - Intergenic
955607579 3:60722350-60722372 AAGAAAAGAGAGCAGGAGTTGGG + Intronic
956272422 3:67462199-67462221 AAGAAAAAGGAGCAGGTGAAAGG - Intronic
956696269 3:71921767-71921789 TAGAAAGCAGAGCGGGAGACTGG - Intergenic
957115220 3:76015072-76015094 CAGGAAAAGGAGCCGAAGACTGG - Intronic
957977744 3:87469313-87469335 AAGAAAAAAAAACAGAAGACTGG - Intergenic
958133008 3:89453945-89453967 CAGAAGAGAGAGAGGGAGACAGG - Intronic
958812391 3:98876376-98876398 CAGAAAAACGGGCAAAAGACAGG + Intronic
959114615 3:102161963-102161985 AAGAAATAAGAGGAGGAGGCAGG + Intronic
959245220 3:103858927-103858949 CAGCAAAGTCAGCAGGAGACTGG - Intergenic
959688349 3:109171911-109171933 AAAAAAAAAGAGCTGGAGTCGGG - Intergenic
960538758 3:118842377-118842399 CAGAAAAAAGAAAAGGGGAGGGG + Intergenic
960826183 3:121787116-121787138 CTGAAGAAGGAGTAGGAGACAGG + Intronic
960942029 3:122941183-122941205 AAGGAAAATGAGCTGGAGACAGG + Intronic
961068704 3:123899787-123899809 CAGAAAAAAGATCAGGAGTTTGG - Intronic
961137072 3:124521075-124521097 CACAAGGAAGAGCAGGACACTGG - Intronic
961158150 3:124698270-124698292 GAAAAACAAGAGCAGGAGGCCGG - Intronic
961476115 3:127147391-127147413 GAGGAAGAAGAGGAGGAGACGGG + Intergenic
961991805 3:131199869-131199891 CAGAAGAAAGGGCAAAAGACCGG + Intronic
962299200 3:134222823-134222845 CAGAAGAAAGAGCATCACACTGG - Intronic
962629976 3:137265664-137265686 CAGGAAATAGAGCATGAGGCTGG + Intergenic
962633199 3:137300779-137300801 TAGAAAACAGAGAAGGAGATGGG + Intergenic
962768314 3:138588047-138588069 CAAAAAAAAGAGAAAGAAACAGG + Intronic
962904894 3:139792713-139792735 CAGAGAAGAAAGGAGGAGACAGG + Intergenic
963012235 3:140781321-140781343 CAGGAACAAGAGGAGGAGAGAGG - Intergenic
963631001 3:147729652-147729674 CAGGAAAAAGAGAGGGAGGCAGG + Intergenic
963681353 3:148381822-148381844 CAGCAAAGATAGCAGGAGGCAGG + Intergenic
964245051 3:154642179-154642201 GAGACAGAAGAGCAGGGGACTGG - Intergenic
964586237 3:158306232-158306254 CTGAAAACAGAGAAGGATACAGG - Intronic
965641607 3:170834735-170834757 CAGAATAAAGAGGAGGACAATGG + Intronic
966016546 3:175146284-175146306 CAGAAAAAAGAGAAGGACTGTGG + Intronic
966075616 3:175933476-175933498 CAGGAAAGGGAGCAGGGGACAGG + Intergenic
966278931 3:178207905-178207927 CAGAACAAAGAGCAGGACAGGGG + Intergenic
967149878 3:186638744-186638766 CAGAACAAAGAGGAGGAGAATGG - Intronic
967452027 3:189635778-189635800 CAGGAAAAAGAGCATGATACTGG - Intronic
967468635 3:189837177-189837199 CAGAGGAAGTAGCAGGAGACAGG - Intronic
968533074 4:1105598-1105620 AAGAAAAAACAACATGAGACTGG + Intronic
969328312 4:6456910-6456932 CATAAAAATGAGCATGAGCCAGG + Intronic
969475149 4:7418118-7418140 CAGAAAAAAGGGAAGGAGGAAGG - Intronic
969535072 4:7751604-7751626 GAAAAAAAAGAGCAAGAGAGAGG + Intergenic
969692899 4:8715435-8715457 CAGAAAATAGAGGAGGAGGAAGG - Intergenic
970065330 4:12087407-12087429 AACAGAAAAGAGCAGGATACTGG + Intergenic
970436093 4:16036978-16037000 AAGGAAAGAGAGCAGGAGCCAGG + Intronic
970491121 4:16574719-16574741 CAGAAAGTACAGGAGGAGACTGG + Intronic
970500598 4:16672899-16672921 GAGAAAAAAGATAAGGAGAGGGG - Intronic
971008196 4:22399179-22399201 AAGAAAAAGTAGCAGGAGAATGG - Intronic
971180275 4:24323767-24323789 CAGAGCAAAGAGCAGGAGGATGG - Intergenic
971198113 4:24488602-24488624 CAGAAGGGACAGCAGGAGACTGG - Intergenic
972092244 4:35301659-35301681 CAGACAAAAGAGCAGCAGCAGGG - Intergenic
973618931 4:52708530-52708552 AGGAAAAAAGAACAGGTGACAGG + Intergenic
974032057 4:56784859-56784881 AAAAAAAAAGAAGAGGAGACAGG + Intergenic
974531293 4:63111041-63111063 GAGCAAAAACAGCAGGAGCCGGG + Intergenic
974760535 4:66267833-66267855 CAAAAAGAAGAGGAGGAGAATGG + Intergenic
975193133 4:71489936-71489958 CAGGGAAAAGAGCAGGAGAGAGG + Intronic
975397694 4:73896072-73896094 CAGAAAGAAGAGAAGAAAACAGG + Intergenic
976737917 4:88329195-88329217 GAGAAAAAGGAGCAGGTGAAAGG + Intergenic
977346005 4:95817006-95817028 CATAAAAAAGAGAAGAAAACTGG - Intergenic
977349116 4:95857737-95857759 AAGAAAGAGGAGCAAGAGACAGG + Intergenic
977709990 4:100113912-100113934 GAGAAGAATGGGCAGGAGACAGG - Intergenic
977745174 4:100538475-100538497 CAGAGAAATGAGCAGGAGGGTGG + Intronic
978237916 4:106482374-106482396 CAGCACAGAGAGGAGGAGACAGG + Intergenic
979005656 4:115292619-115292641 CAGAACACAGAGCAGGGGAAGGG - Intergenic
979532059 4:121779510-121779532 CAGAAACAATAGCTGGAGAATGG - Intergenic
980140748 4:128913662-128913684 GAGAAAGAAGGGCAGGAGAGTGG + Intronic
980575925 4:134683072-134683094 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
981616977 4:146652639-146652661 AAGAAAGAAGAGGAGGAGAACGG - Intergenic
981639978 4:146930545-146930567 TAGAAAACAGAACAGGATACGGG + Intronic
981736731 4:147961358-147961380 CAGACAAAAGGGCAAAAGACCGG - Intronic
982396138 4:154918000-154918022 CAGCAAAAACAGCATCAGACTGG + Intergenic
982865463 4:160505182-160505204 GAGAAAAAAGAGCAGTTGAAAGG - Intergenic
983516886 4:168666844-168666866 CAGAAAAAAAAGAAAGAGACTGG + Intronic
983659288 4:170116889-170116911 CAGAACAAAGAGTAGGAGGACGG - Intergenic
983999663 4:174224989-174225011 GAGAAAAGAGGGGAGGAGACGGG - Intergenic
984002194 4:174262993-174263015 CAGAGAGCAGAGCAGGAGAATGG - Exonic
985323928 4:188745970-188745992 CAGAAGACAGAGCATGAGAGAGG + Intergenic
985398568 4:189570988-189571010 GATAAGCAAGAGCAGGAGACTGG + Intergenic
985522906 5:387225-387247 CAGAGGAGAGAGCAGGAGACAGG - Intronic
985909221 5:2865967-2865989 AAGAAAGAAGAGGAGGAGAGTGG + Intergenic
986245019 5:5999208-5999230 CAGAAGAAAGAGTAGGCAACAGG + Intergenic
986263582 5:6172519-6172541 CAGTAAAAACAGCATGATACTGG + Intergenic
986576074 5:9214204-9214226 CGGGAAAAATAGCAGGAGCCAGG + Intronic
987120137 5:14759769-14759791 AAGAAAAAAGAAGAGGAGAGGGG + Intronic
987768477 5:22267845-22267867 CAGAAAATAGAGCTGAAGCCTGG + Intronic
988097325 5:26633606-26633628 AAATAAAAAGAGCAGGAGAAAGG + Intergenic
988104643 5:26728986-26729008 CAGAAATAAGAGCAGAAGATTGG - Intergenic
988918792 5:35921874-35921896 CAGTTAAAAGAGGAGGAAACAGG - Intronic
989226271 5:39033247-39033269 AAAAAAAAAGAGTAGGACACTGG - Intronic
989579865 5:43022152-43022174 CAGAAAAAAGAGAGAGAGATAGG + Intergenic
989751116 5:44895260-44895282 GAGGAAAGAGAGCAAGAGACTGG - Intergenic
990723647 5:58728402-58728424 AAGAAAAAAGAGCAATAGATTGG - Intronic
991222697 5:64234979-64235001 CAAAAAACAAAGCAGGGGACTGG + Intronic
991226983 5:64285142-64285164 CAGAAAACAAAGCAGCAGCCTGG - Intronic
991556436 5:67900180-67900202 CAGGACAAAAAGCAGGAAACTGG + Intergenic
991960202 5:72036768-72036790 AAGGAAACAGAGCAGGAGAATGG + Intergenic
992732420 5:79686073-79686095 GAGAAAACAGAGCAGGAAAATGG - Exonic
992913605 5:81424127-81424149 CAGAAAAAAGAGCAACTGGCCGG + Intronic
993186413 5:84627331-84627353 CAGATAAAAGAACAGCAGAATGG - Intergenic
993781592 5:92073025-92073047 AAGAAAGAAGAGCAGTAGAAAGG - Intergenic
993870512 5:93248153-93248175 GAGGAAACAGAGCTGGAGACAGG - Intergenic
994581786 5:101651866-101651888 TAGAAAAAATAGCAGAAGATGGG - Intergenic
994934674 5:106239014-106239036 AAGAAAAAAGAGAAGGAAAAAGG + Intergenic
995099461 5:108280906-108280928 CAGTAAAAAGAGAAAGAGAGAGG + Intronic
995180629 5:109227303-109227325 CAGAAAAAAGACTTTGAGACAGG - Intergenic
995696371 5:114882819-114882841 GAGAAGGAAGAGCAGGGGACTGG + Intergenic
996008774 5:118456938-118456960 CAAAAAAGAAAGAAGGAGACCGG - Intergenic
996116461 5:119625430-119625452 CAGAAAGAAGAGGAGGAGGAGGG - Intronic
996611991 5:125393317-125393339 CAGAAAACAGAGGAAGAGAATGG + Intergenic
996993571 5:129667271-129667293 CAGAGAAAAGATCAGGACCCAGG - Intronic
997100586 5:130964547-130964569 CAGAAAAATGATGAGAAGACTGG - Intergenic
997348047 5:133207944-133207966 CAGTAAAAAGAGTAGGAGCCAGG - Intronic
998266220 5:140669616-140669638 CAGGAAGAAAAGGAGGAGACTGG + Exonic
998505236 5:142667284-142667306 AAGAAAAAAGAGAAAGAAACAGG + Intronic
998786433 5:145714826-145714848 TAGAAAGAAGAGCAGGAAAGAGG - Intronic
999512775 5:152270129-152270151 CAGAATCAAGAGATGGAGACAGG - Intergenic
999686659 5:154109173-154109195 TAGCAAAAAGAGCACCAGACTGG + Intronic
1000819224 5:165962801-165962823 AAGATAAAAGAGCAAGTGACTGG - Intergenic
1001124956 5:169011034-169011056 CAGAAAGAAGAGCAGGGCTCAGG + Intronic
1001246911 5:170111666-170111688 AAGAAATAAGAGCCGGAGAGAGG + Intergenic
1001423417 5:171604835-171604857 GAAAAAGAAGAGCAGGAGGCTGG - Intergenic
1002405244 5:179025199-179025221 AAAAAAAAAAAGCATGAGACAGG - Intronic
1002493797 5:179598507-179598529 CACAAGAAAGAGCAGGAACCAGG - Intronic
1002647630 5:180668810-180668832 CAGGAAGAAGAGAACGAGACAGG + Intergenic
1002664337 5:180811207-180811229 CAGAACACAGGCCAGGAGACCGG - Intronic
1003149102 6:3533694-3533716 CAGAACAAACAGATGGAGACAGG + Intergenic
1003413353 6:5885744-5885766 CATAAAACAGGGCAGGAGAATGG - Intergenic
1004517043 6:16329082-16329104 GAGAAAAAAAAACAGGAGAGAGG - Intronic
1005487000 6:26310085-26310107 CAGAGAAAAGAGCAAGAAGCGGG + Intergenic
1005518433 6:26576724-26576746 CAGACAAAACAGCAGGACAGAGG + Intergenic
1006016416 6:31084749-31084771 AAAAAAAAAGAGGAGGAGGCAGG - Intergenic
1006230983 6:32586552-32586574 AAGAAAAAAGAACAGGGCACAGG - Intronic
1006326438 6:33357370-33357392 AAAAAAAAAGAGCAAGAGCCGGG - Intergenic
1006941073 6:37752829-37752851 CAGAAAAACAAGCAGGAGCTGGG + Intergenic
1007423201 6:41731964-41731986 CAGAAGAAAGGCCAGGAAACAGG + Intronic
1007909991 6:45504018-45504040 GAGAAAAAAAAGCAGCAAACTGG - Intronic
1008345611 6:50423005-50423027 CAGACAAAACAGCATGACACTGG + Intergenic
1008373795 6:50768307-50768329 GAGAAAAAAGAAAAGGAGAGAGG - Intronic
1008979838 6:57470458-57470480 CCAAAAAAAGAGAGGGAGACGGG - Intronic
1009514533 6:64598163-64598185 AAGAAAAAAGAGAAGGGGCCAGG + Intronic
1009558815 6:65211642-65211664 CAGAAATCAGAGGAGCAGACAGG + Intronic
1009819686 6:68784202-68784224 GAGAAAAGAGAGCAGTAGAAAGG + Intronic
1009932598 6:70194033-70194055 TAAGAAAAAGAGAAGGAGACGGG - Intronic
1009975928 6:70670932-70670954 CAGGATCAAGAGCAGGAAACTGG - Intronic
1010016293 6:71108275-71108297 CAGAGGAAGGAGCAGGAGGCAGG - Intergenic
1011335917 6:86259627-86259649 CAGCAAAAAGGACAGGAGAGGGG - Intergenic
1011357080 6:86482402-86482424 CAAAAAAAAGAGCAAAAGATAGG + Intergenic
1011409874 6:87056858-87056880 GAGAAAAACAAGCAGGAGAGAGG - Intergenic
1011440955 6:87386722-87386744 AAGAAAAAAAAGCAGGGGGCGGG + Intronic
1012150764 6:95748422-95748444 CAGAAAACAGAGCAGGAGTAAGG - Intergenic
1012388917 6:98714803-98714825 AAAACACAAGAGCAGGAGACAGG - Intergenic
1012491215 6:99784239-99784261 GGGAAAAAAGAGCAGGAGCCAGG + Intergenic
1012982285 6:105843382-105843404 CAGAAAAGAGTGCAGGAAAGAGG + Intergenic
1013084516 6:106845013-106845035 CACAAAAATGAGGAGCAGACTGG + Intergenic
1013314024 6:108924219-108924241 TTGAAAAATGAGCAGGAGGCCGG + Intronic
1013560436 6:111298160-111298182 CAGAAAACAGAACCAGAGACAGG + Intergenic
1013780724 6:113725934-113725956 CAAAAAATAGAGCAGGGGCCAGG - Intergenic
1013790156 6:113827396-113827418 GAGAAACTAGAGCAGGAGAGTGG - Intergenic
1014189258 6:118474203-118474225 CAGTAAGAAGAGTAAGAGACTGG + Intronic
1014249084 6:119097792-119097814 GAGAAAAAGGAGCAGGTGAAAGG - Intronic
1014740236 6:125140719-125140741 GAGAAAAAGGAGAGGGAGACAGG + Intronic
1014843948 6:126252883-126252905 CAGGAAGTAGAGGAGGAGACAGG + Intergenic
1015064775 6:129011206-129011228 GAGCAAAAAGAGAAGGAGAGAGG - Intronic
1015120112 6:129692079-129692101 CAGAAAAATGGGCAGGGGCCTGG - Intronic
1015367533 6:132413851-132413873 GAGAAAGAAAAGCAGGAGATAGG - Intergenic
1015747301 6:136523905-136523927 CAAAAACAACAACAGGAGACAGG + Intronic
1016650662 6:146455964-146455986 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1016702857 6:147073057-147073079 GGGAAAAAAGAGATGGAGACGGG + Intergenic
1017297211 6:152811949-152811971 GAGAAAGAAGAGGAGGAGAAAGG - Intergenic
1017624247 6:156332215-156332237 CAGAAGAAACAGCAGCACACAGG - Intergenic
1017969049 6:159294705-159294727 CAGAAGAAATAGCTGGAGAAGGG + Intergenic
1018019961 6:159752752-159752774 CTCAAAAAAGAGGAGGAGAGAGG - Intronic
1018090318 6:160340888-160340910 CAGAGAAAAGCCCAGGAGAATGG - Intergenic
1018118188 6:160608705-160608727 CAGAAAAGAGAACGGGAGATTGG - Intronic
1018582732 6:165321468-165321490 CAGAGAAAAGAGAAGGCAACTGG + Intergenic
1018911486 6:168102843-168102865 CAGAAGGAAGAGGAGGAGAAGGG - Intergenic
1018926189 6:168208654-168208676 CAGAAAAGTGAGCAGGGGCCGGG + Intergenic
1019034811 6:169045514-169045536 CACCAAAAAGAGCAAGAGGCCGG - Intergenic
1019168742 6:170116843-170116865 CAGGAGGAAGAGCAGGAGGCTGG + Intergenic
1019585669 7:1801479-1801501 CAGAAAAATGAGTAACAGACAGG + Intergenic
1019795804 7:3047432-3047454 CAGAAAAAAGGACAGGAGGTTGG - Intergenic
1020172952 7:5859195-5859217 TAGAAAGAAGCTCAGGAGACAGG - Intergenic
1020595001 7:10195453-10195475 GAGAAAAAAAAGAAAGAGACAGG - Intergenic
1020668097 7:11072869-11072891 CAGAGAAAAGAGGAGGTGTCAGG + Intronic
1021083071 7:16386292-16386314 CAGACAAAAGAGCAGCAGAATGG - Intronic
1022095337 7:27137246-27137268 CAGGGGAAAGAGCAGGAGAAAGG + Intronic
1022739193 7:33105350-33105372 AAGAAAGAAGGGCAGGAGACAGG - Intronic
1022834079 7:34097178-34097200 CAAAAAGAGGAGCAGGAGGCTGG + Intronic
1022911003 7:34899487-34899509 GAAAATAAAGACCAGGAGACTGG - Intergenic
1023337653 7:39186935-39186957 CAGAACACAGAGCAGGCGGCAGG - Intronic
1023625321 7:42109543-42109565 CAGAAAAACCAGCAGGGCACTGG + Intronic
1023983995 7:45084897-45084919 CAGAAGACAGAGGAGGAGAGCGG - Exonic
1024009198 7:45253318-45253340 GAGAGAGAAGAGAAGGAGACAGG - Intergenic
1024242726 7:47447995-47448017 CAGAGAAGACAGCAGGAGGCTGG + Intronic
1024403982 7:48956309-48956331 CAGGAAAAAGTGAAGTAGACTGG + Intergenic
1024787649 7:52926680-52926702 CGGAGAAGAGATCAGGAGACTGG + Intergenic
1026076712 7:67178168-67178190 CAGAAAAAAAAACAGGAGGTGGG + Intronic
1026373041 7:69720988-69721010 CAGCAAAAAGAAGAAGAGACTGG + Intronic
1027654193 7:80908727-80908749 CAGAAAAATGGGAGGGAGACAGG + Intronic
1027676486 7:81164681-81164703 CAGAAGAAAGAACAGAACACAGG + Intergenic
1027759762 7:82262695-82262717 GAGAAATATGAGTAGGAGACAGG - Intronic
1027811347 7:82904269-82904291 CAGACAAAAGAGATAGAGACAGG - Intronic
1028326581 7:89534307-89534329 TAGAAAAATGAGGAGGAGGCAGG + Intergenic
1028621947 7:92835462-92835484 CAAAAAAAAGTGGAGGAGAGGGG - Intronic
1028638928 7:93021763-93021785 CAGGAAAAAGAGAAGGAGAAAGG + Intergenic
1028999643 7:97139515-97139537 CAGAGGAAAGAGCACCAGACAGG + Intronic
1029042742 7:97594803-97594825 CAGAAAGAAGAGGAGGAGAAAGG - Intergenic
1029085838 7:98011060-98011082 TAGAAAGAAGCTCAGGAGACAGG + Intergenic
1029112255 7:98218310-98218332 CAGAAAGAGGATCAGGAGGCCGG - Intronic
1029350380 7:100009257-100009279 AAAAAAAAAGAGCAGGGGGCAGG + Intergenic
1029542336 7:101191232-101191254 GAGAAAAAGGAGCAGGAGAGAGG + Intergenic
1030056445 7:105587634-105587656 CAGATAAAAGAGCACTACACTGG + Intronic
1030214365 7:107028702-107028724 AAGAAAAGAGGGTAGGAGACAGG + Intergenic
1031494602 7:122431399-122431421 AAGAAAATAAAGCAGGAGAGGGG + Intronic
1031626713 7:124000709-124000731 CAGAAAGAAGAGAGGGAGAGAGG + Intergenic
1031951189 7:127893954-127893976 CACTAAAAAAAGCAAGAGACTGG - Intronic
1032122125 7:129164393-129164415 CAGCAAAAATAACAGTAGACAGG - Intronic
1032846939 7:135759132-135759154 CAGAAAAAAGAAAAGGGGATGGG - Intergenic
1032869959 7:135974540-135974562 CAAAAAAAAGAGGAGGAGGAGGG + Intronic
1033122342 7:138677198-138677220 TAAGAAAAAGAGCAGGAGGCCGG - Intronic
1033374807 7:140748395-140748417 CAGAAAAAAATGCAGGTGATTGG + Intronic
1033483850 7:141768618-141768640 CAGAAAACAGAGGAGGGGAGGGG - Intronic
1033611785 7:142970295-142970317 CAGCAAAAGGAGCAGGAAAAGGG + Intergenic
1033714165 7:143982157-143982179 CAGAACAAGGATCAGGAGTCAGG - Intergenic
1033862997 7:145652314-145652336 CAGGAAAAAGAGTACGAGACAGG - Intergenic
1034091242 7:148365207-148365229 AAGAAAATAAAGCAGGAGAAGGG - Intronic
1034356722 7:150456392-150456414 CAGAGGAAGGAGCAGGAGCCAGG - Intronic
1034859063 7:154580871-154580893 CAGAAGAAAGAGCAGCAAAAAGG + Intronic
1035287724 7:157816860-157816882 AAGAGAAAAGAGGAGGAGAAAGG - Intronic
1035761091 8:2069399-2069421 CAGAAAAGAGAAAAGGAGGCGGG - Intronic
1036098779 8:5754983-5755005 CAAGAAAATGAGCAGGAGAATGG + Intergenic
1036140520 8:6203685-6203707 AGCAAAAAAGAGCAGAAGACAGG - Intergenic
1036490800 8:9223746-9223768 TTGAAAAAAGGGCAGGAGACTGG + Intergenic
1036639160 8:10571533-10571555 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1038390239 8:27191482-27191504 CACAAAAATGACCTGGAGACTGG - Intergenic
1038428601 8:27481754-27481776 CAGGAATTAGAGCAGGAGGCTGG - Intergenic
1039118565 8:34119967-34119989 GAGAAAGAAGAGAAGGAGAAGGG - Intergenic
1039229970 8:35433952-35433974 CACAAAATAGAGTAGGAGTCAGG - Intronic
1040506815 8:48056561-48056583 CAAAAAAAGGAAAAGGAGACAGG + Intronic
1041135813 8:54757639-54757661 CAGACACAGAAGCAGGAGACAGG + Intergenic
1041369634 8:57145000-57145022 GAGAATCAAGAGAAGGAGACAGG + Intergenic
1041615254 8:59899229-59899251 AAAAAAAAAAAGAAGGAGACTGG - Intergenic
1041811302 8:61913708-61913730 CAAAAACAAGAGTAGGTGACAGG - Intergenic
1041952797 8:63523040-63523062 CAGAAATGAGCGCAGGAAACAGG + Intergenic
1042338968 8:67658890-67658912 CAGACAAAAGAGAATGAGAGAGG - Intronic
1042437120 8:68779502-68779524 CAGAATTAAAAGCACGAGACAGG + Intronic
1042769949 8:72368626-72368648 CAGGAAAGAGAGCAAGAGAAGGG - Intergenic
1042978036 8:74492683-74492705 CAGAAATAAGAGAAGCAGGCAGG - Intergenic
1043173540 8:76996063-76996085 GAGAAATCAGAGCAGGACACAGG + Intronic
1045369051 8:101502827-101502849 AAGAAAAAAAAGAAGGAGAAGGG - Intronic
1045701292 8:104869873-104869895 CAGAGAAAGGAGCAGGAGCCAGG + Intronic
1045865468 8:106860517-106860539 AATAAAAAAGAGAAGGAGGCCGG + Intergenic
1047535601 8:125717056-125717078 CAGAAAAATAATCAGGAAACAGG - Intergenic
1048072590 8:131038577-131038599 TAGAAAAAAAAGGAGGAGAAAGG + Intronic
1048220766 8:132539478-132539500 CAGAACAAAGACCACGAGAAAGG + Intergenic
1048341393 8:133541639-133541661 CAGAAACTAGAGCAGAAGACTGG - Intronic
1048589155 8:135804923-135804945 CATAAAGAAGAGCATGAGACTGG - Intergenic
1048815511 8:138330132-138330154 CAGAAATAAGAGCAGCCGCCTGG - Intronic
1048912592 8:139150351-139150373 AAGAAAAATGGGAAGGAGACTGG - Intergenic
1050050025 9:1589675-1589697 TAGAAAAATGAGCAAAAGACAGG - Intergenic
1050116971 9:2273350-2273372 AAGAAAAAAAAGCAGGACAATGG - Intergenic
1050192348 9:3040537-3040559 CAGTAGCAAGAGCAGGAGGCTGG - Intergenic
1050602040 9:7262596-7262618 CAGAAAAAAGGGAAGTAGGCAGG + Intergenic
1050707897 9:8424662-8424684 CAGAAAATAAAGAAGGGGACTGG + Intronic
1050725751 9:8646119-8646141 CAGAAAACAGTGCATGGGACTGG + Intronic
1051264079 9:15294588-15294610 CACAAAAGAGAGCAGTAAACAGG - Intronic
1051596129 9:18825971-18825993 CAGTACAAAGAGGAGGAAACAGG - Intronic
1051849596 9:21490973-21490995 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1052325549 9:27213645-27213667 CAGAAGCAACATCAGGAGACAGG - Intronic
1052399741 9:27985784-27985806 CAGCAAACAGAGCAGAAGAAAGG + Intronic
1053194301 9:36103742-36103764 CAAAAAAGAGAGCATTAGACTGG + Intronic
1053251267 9:36575888-36575910 GAAAAAAGAGAGCAGGAGAATGG - Intronic
1055763932 9:79640764-79640786 AAGAATGAAGGGCAGGAGACCGG - Intronic
1055826874 9:80338202-80338224 AAGAAATGAGAGAAGGAGACAGG + Intergenic
1055841994 9:80516429-80516451 CCCAAAAAATAGCAGAAGACAGG - Intergenic
1055901186 9:81239879-81239901 TAGACCAAAGAGCAGGAGATTGG - Intergenic
1055910080 9:81340161-81340183 CAGAAAACAAAGAAAGAGACAGG + Intergenic
1056176467 9:84041479-84041501 TTGAAAAAAGAACAGGAGGCCGG + Intergenic
1057465111 9:95306517-95306539 CAACAAAAAGAGCACCAGACAGG + Intronic
1058181951 9:101809259-101809281 TAGAACAAAGAGCAGGAGGAAGG + Intergenic
1058183787 9:101829906-101829928 GAGAAAGAAGAGCATGAGAAAGG - Intergenic
1058845807 9:108957992-108958014 CAGAAAAAAGAACAGACTACAGG - Intronic
1059780532 9:117521730-117521752 CAGAAAAAGGACCAGGAGCATGG + Intergenic
1059913730 9:119075764-119075786 AAAAAAAAAGAGCAGGAGGTGGG - Intergenic
1060424044 9:123489988-123490010 CAGAAAAATTCTCAGGAGACTGG + Intronic
1060430302 9:123545460-123545482 AAAAAAAAAGAACAGGAGACAGG - Intronic
1060438634 9:123617714-123617736 CAGAGCAAAGGTCAGGAGACAGG + Intronic
1061347268 9:130036747-130036769 AAGAAAAAGGAGCAGTAGGCCGG + Intronic
1061729414 9:132601975-132601997 AAGAGAAAAGGGGAGGAGACAGG + Intronic
1061812310 9:133169411-133169433 GAGAAAAAGGAGCAGGTGAAAGG + Intergenic
1061858519 9:133456046-133456068 CTGAAAAGGGAGCAGGAGACAGG - Intronic
1062031472 9:134363929-134363951 CAGAAAAAAGAAGAAGAGAAAGG + Intronic
1185611093 X:1394136-1394158 AAGAAAAAAGAAAAGGAGGCGGG - Intergenic
1185751187 X:2610610-2610632 GAGACAAGAGAGAAGGAGACAGG - Intergenic
1186042302 X:5494300-5494322 CAGAAAAAAGAGCATGTGTAGGG - Intergenic
1186248559 X:7641007-7641029 CAGAACCAAGACCAGGAAACAGG + Intergenic
1186839585 X:13471621-13471643 GAGAAAAAAGAGAGGGAAACAGG + Intergenic
1187413716 X:19074030-19074052 CAGAAAAAGAATCAGGAAACTGG + Intronic
1188829439 X:34878421-34878443 CAGAAATGAGTGGAGGAGACAGG - Intergenic
1189463860 X:41263444-41263466 GAGAAAAAGGAGCAGGTGAAAGG + Intergenic
1190165561 X:48070672-48070694 CAGAAAAATGAACAAAAGACAGG + Intronic
1190306460 X:49085576-49085598 CATAAAAAGAAGCAGGAGGCTGG + Intronic
1190581755 X:51897107-51897129 CAAAGAAAAGAGCAAGAGAGGGG - Intronic
1190938706 X:55019734-55019756 CAGACTAGAGAGTAGGAGACTGG + Intronic
1191068048 X:56371162-56371184 GAGAAAAGAGAGCAGAAAACTGG + Intergenic
1192047312 X:67689532-67689554 TAGAAAAAAAAGCAAGAAACAGG - Intronic
1192617524 X:72643148-72643170 CAGAGAAAAGGGAAGGAGACTGG + Intronic
1194524468 X:94961309-94961331 AAAAAAAAAGACCAAGAGACTGG + Intergenic
1195424197 X:104709464-104709486 CAGAAAAAGGGACAGGAGAGAGG - Intronic
1195468148 X:105203832-105203854 CAGAAAGAATACCAGGAGCCAGG - Intronic
1195508030 X:105681248-105681270 GAGAACAAGGAGGAGGAGACAGG + Intronic
1196310097 X:114153803-114153825 CAGAGAAAAGAGAGGGAGAATGG + Intergenic
1196349544 X:114710021-114710043 CTGGAAAAGAAGCAGGAGACTGG + Intronic
1196931841 X:120689519-120689541 AACAAAAAAGAGGAGGAGAGAGG - Intergenic
1198692332 X:139297927-139297949 CAGAAAACAGATAAGGAGAGTGG - Intergenic
1198755692 X:139979724-139979746 AAGAAAAAAGAAAAGGAGAAAGG + Intergenic
1199098402 X:143768393-143768415 CAGATAAAAATTCAGGAGACGGG - Intergenic
1199862791 X:151816871-151816893 TAGGAGAAAGAGCAGGAGAAAGG - Intergenic
1199992579 X:152995865-152995887 CAGAAAAAAGAGAGAGAGAGAGG - Intergenic
1200379708 X:155822197-155822219 CAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1200610169 Y:5318241-5318263 CTGAAAAAATAGCAGTAGAAGGG - Intronic
1201336585 Y:12887916-12887938 GGGAAAAAAGGGAAGGAGACAGG - Intergenic
1202626637 Y:56866569-56866591 CAAAAAAAGGAGCAGCAGCCAGG + Intergenic