ID: 1181648717

View in Genome Browser
Species Human (GRCh38)
Location 22:24247391-24247413
Sequence CCTTCCAAACCCACTCCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181648713_1181648717 22 Left 1181648713 22:24247346-24247368 CCTGGAGGGGCTGCTGATGGTGA No data
Right 1181648717 22:24247391-24247413 CCTTCCAAACCCACTCCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181648717 Original CRISPR CCTTCCAAACCCACTCCCTC TGG Intergenic
No off target data available for this crispr