ID: 1181649939

View in Genome Browser
Species Human (GRCh38)
Location 22:24253195-24253217
Sequence GCTGAGGCCCAGAAATGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181649939_1181649943 2 Left 1181649939 22:24253195-24253217 CCTTCACATTTCTGGGCCTCAGC No data
Right 1181649943 22:24253220-24253242 CAGCTGCAGCAGGTGCCCAGAGG No data
1181649939_1181649940 -8 Left 1181649939 22:24253195-24253217 CCTTCACATTTCTGGGCCTCAGC No data
Right 1181649940 22:24253210-24253232 GCCTCAGCCACAGCTGCAGCAGG No data
1181649939_1181649946 30 Left 1181649939 22:24253195-24253217 CCTTCACATTTCTGGGCCTCAGC No data
Right 1181649946 22:24253248-24253270 ACCAGAGATCCCAGACCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181649939 Original CRISPR GCTGAGGCCCAGAAATGTGA AGG (reversed) Intergenic
No off target data available for this crispr