ID: 1181651524

View in Genome Browser
Species Human (GRCh38)
Location 22:24261685-24261707
Sequence GGGTGCTGCTGAGCCCTGCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 388
Summary {0: 1, 1: 6, 2: 4, 3: 38, 4: 339}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181651524_1181651532 21 Left 1181651524 22:24261685-24261707 CCTCGCAGGGCTCAGCAGCACCC 0: 1
1: 6
2: 4
3: 38
4: 339
Right 1181651532 22:24261729-24261751 CCGCTAGAGCAGCTGCTCATGGG 0: 8
1: 1
2: 0
3: 6
4: 77
1181651524_1181651526 -7 Left 1181651524 22:24261685-24261707 CCTCGCAGGGCTCAGCAGCACCC 0: 1
1: 6
2: 4
3: 38
4: 339
Right 1181651526 22:24261701-24261723 AGCACCCGGTGAACAGCAGCAGG 0: 1
1: 4
2: 4
3: 7
4: 114
1181651524_1181651527 -4 Left 1181651524 22:24261685-24261707 CCTCGCAGGGCTCAGCAGCACCC 0: 1
1: 6
2: 4
3: 38
4: 339
Right 1181651527 22:24261704-24261726 ACCCGGTGAACAGCAGCAGGAGG 0: 1
1: 4
2: 4
3: 15
4: 170
1181651524_1181651530 20 Left 1181651524 22:24261685-24261707 CCTCGCAGGGCTCAGCAGCACCC 0: 1
1: 6
2: 4
3: 38
4: 339
Right 1181651530 22:24261728-24261750 GCCGCTAGAGCAGCTGCTCATGG 0: 8
1: 1
2: 1
3: 10
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181651524 Original CRISPR GGGTGCTGCTGAGCCCTGCG AGG (reversed) Intergenic
900163663 1:1236283-1236305 GGTGTGTGCTGAGCCCTGCGGGG - Intergenic
900302366 1:1984402-1984424 AGGTGCTGCTGAGCAGTGAGAGG + Intronic
901232663 1:7649850-7649872 AGCTGATGCTGAGCCCTGCTAGG + Intronic
901464696 1:9413653-9413675 GGGGCCTGCTGGGCCCTGCCCGG - Intergenic
903224557 1:21887343-21887365 GGATGCTGCTGACCCCTGCCCGG - Intronic
903285405 1:22273691-22273713 GGGTGGTGCTGAGGCCTGAGGGG + Intergenic
903374672 1:22858462-22858484 GGGGGCTGATGATCCCTGCATGG - Intronic
903953490 1:27010021-27010043 GGCTGCTGCTGAGACCTGCAGGG + Intronic
904269949 1:29343438-29343460 GGGAGCCTCTGAGGCCTGCGTGG - Intergenic
905078806 1:35298504-35298526 GGGTGCTGCTGAAACTTGCAGGG + Intronic
906194230 1:43920098-43920120 GTGTGCTGCTGTGGCCTGAGGGG - Intronic
906525378 1:46490476-46490498 GGGAGTTGCGGAGCCCTGGGCGG + Intergenic
906528930 1:46512239-46512261 GGCTGCTGCTGTGCCCTACCTGG + Exonic
910876713 1:91885553-91885575 GGGTCCTTCTGACCCCTGCGGGG - Intronic
911133767 1:94418166-94418188 TGTTGCTACTCAGCCCTGCGAGG - Intergenic
912430085 1:109624345-109624367 TGGGGCTGCTGAGCCCAGGGAGG + Intronic
913706287 1:121426897-121426919 GGGTCTTGCAGAGCCCTGGGTGG - Intergenic
915490021 1:156245678-156245700 GCGTGCAGCTGAGGCCTGAGGGG + Intronic
915587946 1:156854455-156854477 GGCTGCAGGTGAGCCCTCCGGGG - Intronic
916568018 1:165998651-165998673 AGGTGCTGCAGAGCCCAGAGGGG + Intergenic
917181429 1:172302221-172302243 GGGACCTGCTGAGCCAGGCGTGG - Intronic
922994410 1:229944471-229944493 GGGAGCTGCTGAGCGGTGCCAGG + Intergenic
923271067 1:232355444-232355466 GTGTTCTGCAGTGCCCTGCGTGG + Intergenic
923545470 1:234920249-234920271 GGGTGGTGGTGAGCCCAGCCTGG - Intergenic
1063733558 10:8725791-8725813 GGCTTCTGCTGAGCCATGGGTGG - Intergenic
1065753816 10:28912570-28912592 CGGTGCTGCAAAGCCCTGCAAGG - Intergenic
1066542029 10:36457729-36457751 TGGTGCTGCTGAGACCAGCTAGG - Intergenic
1067239773 10:44480635-44480657 GGGAGCTGCTGAGCCAGGCACGG - Intergenic
1067267449 10:44757688-44757710 GGCTGCAGCTGTGCCCTGAGGGG - Intergenic
1067478750 10:46582276-46582298 GGGGGCTGCAGAGCCCTGGCTGG - Intronic
1067541759 10:47160039-47160061 CGGTGCTGGCGAGCCCTGCAAGG + Intergenic
1067542434 10:47165760-47165782 GGGCTCTGCTGTGCCCTGTGAGG + Intergenic
1067615989 10:47759525-47759547 GGGGGCTGCAGAGCCCTGGCTGG + Intergenic
1069716869 10:70526722-70526744 GGGTGCTGGAGAGCCATGCTGGG + Intronic
1069753577 10:70760352-70760374 GTGTGCAGCGGAGCCCTGCACGG + Exonic
1069826323 10:71257164-71257186 GGGCTCTGCTGGGCCCTGAGGGG + Intronic
1070401434 10:76056561-76056583 GGGTGCTGATGAGCACAGCAGGG - Intronic
1070597239 10:77841175-77841197 AGGTCTAGCTGAGCCCTGCGGGG - Intronic
1072891689 10:99330034-99330056 GGGACCTGCTGCCCCCTGCGTGG + Exonic
1075645227 10:124092514-124092536 GGGAGCGGCTGAGCCCCGAGCGG - Intronic
1075946456 10:126437445-126437467 GGGTGATTCTGACCCCTGCTTGG + Intronic
1076197377 10:128529021-128529043 GGCTGCCGGTGAGCCCTGCCTGG + Intergenic
1076527746 10:131123101-131123123 GGGTCCTGCTGAGGGCTGCATGG + Intronic
1076555960 10:131321544-131321566 CGGTTCTGCTCAGCCCTGCGGGG - Intergenic
1076878996 10:133230889-133230911 GGGGGCTGCCGAGGGCTGCGGGG + Intronic
1077007406 11:364741-364763 GCTTGCTGCTCGGCCCTGCGAGG - Intergenic
1077050023 11:562402-562424 GGCTGCTGCACAGACCTGCGGGG + Exonic
1077053856 11:580485-580507 GGGTGCTGCTGAGTCCCCAGTGG - Intronic
1077080016 11:721028-721050 GGGTCCTGCTCAGCCCCGCCGGG - Intronic
1077192840 11:1262621-1262643 GGCTGGTGCTGGGCCCTGCGGGG + Intergenic
1077200465 11:1304513-1304535 GGGTGCTGCTGTGCCTTGTGTGG - Intronic
1077710475 11:4531759-4531781 GGGTCCTGCTGAGCCAGGCACGG - Intergenic
1078051785 11:7971746-7971768 GGGTGGTGCTGTGGCCTGCTCGG + Intronic
1078108390 11:8372918-8372940 GGGTCTTGATGAGCCCTGCCTGG - Intergenic
1078194229 11:9121617-9121639 TGGGGCTGCTGAGCCCAGTGTGG + Intronic
1079472414 11:20790620-20790642 AGCTGCAGCTGAGCCCAGCGAGG + Intronic
1080851409 11:36073434-36073456 GGGCGCTGCTGAGTTCTACGAGG + Intronic
1081636909 11:44727372-44727394 GGGTGCTGCTGGACGCGGCGGGG + Intronic
1081811873 11:45918713-45918735 GGGCGCAGCTGAGGACTGCGAGG - Intronic
1081992330 11:47344517-47344539 TGCTGCTGCTGAGCCCAGGGAGG + Intronic
1082883270 11:58058872-58058894 GGGTGCTGCTGGGCACTGTGCGG + Intronic
1083598594 11:63932316-63932338 GGGTGCTTCAGCCCCCTGCGTGG + Intergenic
1084517479 11:69644559-69644581 GGGCTCAGCTGAGCCCTGAGGGG + Intronic
1084888467 11:72224959-72224981 GGGCGGTGCTGAGCCCTGCGCGG + Exonic
1084960109 11:72712157-72712179 GGGTCCTGCTGTGCTCTGCATGG - Intronic
1089065503 11:115659361-115659383 GGGTGCAGCTGGGCTCTTCGCGG + Intergenic
1090125630 11:124080418-124080440 TGGTGCTGCTGAGCTCTGTCTGG + Intergenic
1090242522 11:125194138-125194160 GGTCTCTGCTGAGCCCTGTGTGG + Intronic
1091193752 11:133715170-133715192 GGGTGCTTCTGCGCCCAGTGAGG + Intergenic
1091344934 11:134846121-134846143 GGCTGCTGCTGTCCCCTGAGTGG + Intergenic
1091356338 11:134940852-134940874 GGAGGCTGCAGAGCCCTGCACGG + Intergenic
1091600249 12:1913635-1913657 TGGAGCTGCTGAGCTCTGCTGGG - Intronic
1092794991 12:12101485-12101507 GGGAGCTGGTGAACTCTGCGTGG - Intronic
1093992896 12:25610130-25610152 GGGACCTGCTGAGCCATGCATGG + Intronic
1094839541 12:34337162-34337184 CGGAGCTGCTGGGCCCCGCGGGG + Intergenic
1094840088 12:34339218-34339240 GGGAGCGGCTGAGCCCTAGGGGG + Intergenic
1094841537 12:34344508-34344530 CGGAGCTGCTGGGCCCCGCGGGG - Intergenic
1096183521 12:49564332-49564354 GGGTGATACTGAGGCCTGAGAGG - Intronic
1096239251 12:49950812-49950834 ACATGCTGCAGAGCCCTGCGGGG - Exonic
1096541226 12:52308396-52308418 GGGAGCTGCTGACGCCTGCAGGG - Exonic
1100592751 12:96044771-96044793 GGAAGCTGCAGAGCCCCGCGGGG - Intergenic
1100738627 12:97566271-97566293 GGGAGCTGCTGAGCCCTTCTTGG - Intergenic
1100808285 12:98311076-98311098 GGGTGCTGCTGAGCCAGGCACGG - Intergenic
1102348152 12:112172683-112172705 GGATGCTGCTGACCCCAGAGTGG - Exonic
1102651215 12:114443914-114443936 TGGCGCTGATGAGCGCTGCGCGG + Intergenic
1103712619 12:122924062-122924084 GGCAGCTGCTGAGCCATGAGAGG - Intronic
1103726751 12:123001017-123001039 GGGTGCTGCAGAGCCTGGGGAGG - Intronic
1104602639 12:130163462-130163484 GGGTGCTCCTGCGCGCTGTGGGG - Exonic
1104864002 12:131941997-131942019 GTGTTCTGCTGAGCACTGCTGGG - Intronic
1105011881 12:132761712-132761734 CGGTGCTGCTGATCGCTGTGCGG - Exonic
1105608581 13:21947693-21947715 GGGTGGTGCTGGGCACTGGGTGG + Intergenic
1105800430 13:23898274-23898296 GGGTGCTCCACAGCCCTGAGTGG - Intronic
1112435740 13:99390173-99390195 GGGTGCTGCTGGGCATGGCGTGG - Intergenic
1113935845 13:113995312-113995334 GGCTGCTGCTCAGGCATGCGTGG - Intronic
1114631634 14:24163094-24163116 GGATGTTGCTGAGCCCTACAAGG + Exonic
1114830999 14:26141439-26141461 GGGTGCTGCTAAACACTGCCTGG - Intergenic
1121449241 14:93996934-93996956 GGGTGGGGCTGAGCCTTGGGGGG + Intergenic
1122117157 14:99533577-99533599 GGGAGCTGCTGACCCTTGCCTGG - Intronic
1122788703 14:104175515-104175537 GGGTACCCCTGAGCCCTGCAAGG + Exonic
1122814063 14:104303706-104303728 GGATCCTGCTGGGCCCTGGGAGG + Intergenic
1122874469 14:104657309-104657331 GGGAACATCTGAGCCCTGCGGGG - Intergenic
1122899258 14:104775441-104775463 TGGGGTTGCTGAGCCCTGCCAGG - Intronic
1122978091 14:105179203-105179225 GGAGGCTGCTGAGGCCTGGGAGG + Intronic
1123038769 14:105481945-105481967 GGGTGCTGCTGTCCCTGGCGGGG - Intergenic
1202835736 14_GL000009v2_random:76366-76388 GGGGGCTGCTGAGTACTGCTGGG + Intergenic
1202837782 14_GL000009v2_random:91110-91132 GTGGGCTGCTGAGCACTGCTTGG + Intergenic
1202907149 14_GL000194v1_random:81122-81144 GTGGGCTGCTGAGCACTGCTTGG + Intergenic
1124338391 15:28874073-28874095 GGTTCCTTCTGAGGCCTGCGGGG + Intergenic
1125004965 15:34806943-34806965 TGGTGCTGCTGAAACCTGGGTGG - Intergenic
1125385388 15:39131195-39131217 GGGTGCTTGTGAGTCCTGGGAGG - Intergenic
1125866574 15:43055974-43055996 GGGTGCTGCATAGGCCTGGGAGG - Intronic
1127499286 15:59541701-59541723 GGGTGCTGCTGGGCACTGGGAGG - Intergenic
1130894587 15:88160215-88160237 GGGTGCTGCTGAGCAGAGAGAGG + Intronic
1132478370 16:153688-153710 GGGAGCTGCAGAGGCCTGGGGGG + Intronic
1132480455 16:164278-164300 GGGAGCTGCAGAGGCCTGGGGGG + Intronic
1132540433 16:505935-505957 TGGTGAGGCTGAGCACTGCGTGG - Intronic
1132575008 16:660213-660235 AGGTGCTGGGGAGCCCTGCGGGG - Intronic
1132589879 16:721979-722001 AGGTGCGGCTGACACCTGCGAGG + Intronic
1132607355 16:799177-799199 GGGTTCAGCTCAGGCCTGCGGGG - Intronic
1132764502 16:1527347-1527369 GGGCTCTGCAGAACCCTGCGTGG - Intronic
1134119179 16:11571631-11571653 GGCTGCTTCTGAGCCCAGGGCGG - Intronic
1134508177 16:14824642-14824664 CGCGCCTGCTGAGCCCTGCGCGG - Intronic
1134695875 16:16223407-16223429 CGCGCCTGCTGAGCCCTGCGCGG - Exonic
1134975951 16:18571281-18571303 CGCGCCTGCTGAGCCCTGCGCGG + Intergenic
1135588243 16:23687627-23687649 GGGTACTGCGGGGCCCTGGGCGG + Intronic
1136020977 16:27439851-27439873 AGGGGCTGCTCAGCCCAGCGAGG - Intronic
1138260363 16:55615768-55615790 GGGACCTGCTGAGCCATGCTCGG - Intergenic
1138537591 16:57668099-57668121 GGGAGCTGCTGAGCCCACCCAGG - Intergenic
1141346747 16:83253573-83253595 AGGGGCTGCTCAGCCCTTCGGGG + Intronic
1141892273 16:86934324-86934346 GGGTGCTGGTGACCCGGGCGTGG + Intergenic
1142196183 16:88740309-88740331 GTGTGCAGCTGCGCCCTGGGCGG - Intronic
1142363252 16:89637071-89637093 GGTGGGTGCTGAGCCCTGAGTGG + Intronic
1142623845 17:1180224-1180246 GGATCCTGCTGAGCCCGGCGCGG - Intronic
1143358051 17:6345448-6345470 GGGGGCTGCTGGTCCTTGCGGGG - Intergenic
1143635780 17:8163062-8163084 GGGCGCTGCGGGGCGCTGCGGGG + Intronic
1143873501 17:9974833-9974855 GGGTGGGGGTGAGCCCTGGGTGG - Intronic
1146844967 17:36176664-36176686 GGGTGCTGCTGACCCGGGCAAGG - Intronic
1146863342 17:36323776-36323798 GGGTGCTGCTGACCCGGGCAAGG + Intronic
1146880542 17:36439595-36439617 GGGTGCTGCTGACCCGGGCAAGG - Intergenic
1147661753 17:42120753-42120775 GGCTGCTGCAGATCCATGCGGGG + Exonic
1148786355 17:50148038-50148060 GGGTGCAGCTGAGCCTGGGGCGG + Intronic
1148792888 17:50183542-50183564 GGGGTCTGCTGAGCCTGGCGAGG - Exonic
1151472379 17:74326293-74326315 GGGTGCGGCTGAGCCATGCCCGG + Exonic
1151856353 17:76725000-76725022 GGGGGCTCCTGAGGCCTGCCTGG - Intronic
1152034460 17:77863638-77863660 GGTTGCTGGTGAGCCCAGAGAGG + Intergenic
1152128103 17:78459549-78459571 AGGTGCTGCTGACCTCTGTGGGG + Intronic
1152256465 17:79242843-79242865 GGTTGCTGTGGAGCCCTGCCCGG - Intronic
1152303488 17:79508517-79508539 CGGTGCTGCAGAGGCCTGTGGGG - Intronic
1152412195 17:80132974-80132996 GGGGTCTGCTGAGCCTTGCTAGG - Intergenic
1152801476 17:82332804-82332826 GGCTGCTGCTGAGCCCAGAGCGG - Intronic
1152808668 17:82371188-82371210 GGGAGCTGCAGGGCCCCGCGGGG - Intergenic
1152809300 17:82374035-82374057 GGGTCCTGCTGGGGCATGCGGGG + Intergenic
1152855402 17:82662684-82662706 GGGTCCTGCTGGGGCCTGGGGGG + Intronic
1152862817 17:82705610-82705632 GGGTGCACCTGAGCACTGTGGGG + Intergenic
1152904498 17:82962923-82962945 TGCTGCTGCTGAGACCTGAGAGG + Intronic
1152932300 17:83116038-83116060 GGGTGCTGCAGAGGCCGGCAAGG + Intergenic
1154434753 18:14335020-14335042 TGGGGCTGCTGAGCACTGCAGGG + Intergenic
1155988452 18:32255015-32255037 GGGTGCTGCAGAACCCAGTGTGG + Intronic
1155993124 18:32301600-32301622 TGGTGCTGCTGAGCCCTGATTGG - Intronic
1156462720 18:37330630-37330652 GGGCCATGCTGGGCCCTGCGTGG - Intronic
1157482806 18:48066334-48066356 GGGTGCTGCCAAGCCCTGGGGGG + Intronic
1157610309 18:48951515-48951537 GGCGGCGGCTGAGCCCGGCGGGG + Intergenic
1157699417 18:49751531-49751553 TGGGGCTGCTGAGCCCTACCGGG - Intergenic
1158145725 18:54309879-54309901 GGGACCTGCTGAGCCTTGCCTGG + Intronic
1159123081 18:64192630-64192652 GGGTGCTGATGGGCCATGCCTGG + Intergenic
1160005926 18:75069106-75069128 GGGTGCCTGTGAGCTCTGCGTGG + Intergenic
1160509583 18:79445718-79445740 GGCTGCTCCTGTGCCCTGCCTGG + Intronic
1160535144 18:79587579-79587601 GGGGGCTGCAGAGGCCTGTGCGG + Intergenic
1160585450 18:79911216-79911238 GGGGGCTGGTTAGCCCTGAGGGG + Intronic
1160797875 19:954114-954136 GGGTGCTGGGGGGCCCTGGGAGG + Intronic
1160932625 19:1577894-1577916 GGGTGCTCCTGGGCCCTGCCTGG - Exonic
1160994568 19:1876705-1876727 GGAGGCTGGTGAGCCCTGCTGGG - Intergenic
1161575841 19:5053825-5053847 GGCTGGTGCTGAGCGCTGCTGGG - Intronic
1162015697 19:7845405-7845427 GGGTTCTGCTGTGGCCTGTGTGG - Intronic
1162791175 19:13063887-13063909 GGGTGATGCCCAGCCCTGGGAGG + Intronic
1163557233 19:17999698-17999720 GGCAGATGCTGAGCCCTGGGTGG + Exonic
1163778071 19:19229497-19229519 GGGTGCTGGGGAGCCATGCAAGG + Intronic
1165145060 19:33725453-33725475 GGTCCCTGCTGAGCCCTGCGTGG + Intronic
1165323154 19:35098760-35098782 TGGTGGCGCTGAGCCCTGCCAGG + Intergenic
1166047696 19:40239015-40239037 GGGCTCTGCTGAGCCATGCCAGG + Intronic
1166080316 19:40440158-40440180 ATGTGCTGCTGAGCCCAGAGGGG - Intergenic
1167055984 19:47112061-47112083 GGGTGCTGCGGAGACCCACGGGG - Intronic
1167236999 19:48321316-48321338 CGGTGCTGCGGAGCCCTGAGAGG + Intronic
1167495021 19:49812656-49812678 AGGTGCAGCTGAGCTCTGCGAGG - Exonic
1167659287 19:50786399-50786421 GGGTGCTGGGGAGCCATGAGAGG + Intergenic
1168335125 19:55593044-55593066 GGCTGCTCCTGGGCCCCGCGGGG - Exonic
1168662888 19:58182102-58182124 GAGGGCTGCTGAGACCTGCCAGG + Intergenic
1202634868 1_KI270706v1_random:36228-36250 GTGGGCTGCTGAGCACTGCTTGG - Intergenic
1202636904 1_KI270706v1_random:50997-51019 GGGGGCTGCTGAGTACTGCTGGG - Intergenic
1202650351 1_KI270706v1_random:173877-173899 GTGGGCTGCTGAGCACTGCTTGG + Intergenic
1202650670 1_KI270707v1_random:822-844 GTGGGCTGCTGAGCACTGCTTGG + Intergenic
925609457 2:5691834-5691856 GGGAGCGGCCGAGCCCCGCGAGG + Intergenic
925774724 2:7323629-7323651 GGGTGCTGCTGGCCCCTACTGGG + Intergenic
926219329 2:10924671-10924693 TGGTGCTGCCGAGGACTGCGGGG + Intergenic
927400297 2:22703442-22703464 GGGTGCTGCTTGGCCCTCCAGGG - Intergenic
930024965 2:47024279-47024301 GCCAGCTGCTGAGCCCTGTGTGG - Exonic
930651788 2:53970937-53970959 GCGTGCTGCTGGGCCCCACGCGG + Intronic
931219464 2:60276293-60276315 TGCTGCTGCTGAGCCCTGGGTGG - Intergenic
932699943 2:73985296-73985318 GGGTGCTGCGGGGCGCTGTGCGG + Intergenic
934491286 2:94763292-94763314 GGGGACTGCTGAGCCCTGATGGG - Intergenic
934531592 2:95093056-95093078 GGGACCTGCTGAGCCATGCCTGG - Intronic
934926081 2:98382598-98382620 GGGGTCTGCAGTGCCCTGCGAGG + Intronic
935025273 2:99270675-99270697 GGGTTCTGCCGAGACCTGCTTGG + Intronic
935575025 2:104700530-104700552 GGCTGCTTCTGAGCACTTCGTGG + Intergenic
937354867 2:121191956-121191978 GGGTGCTTCTGGGCCGGGCGTGG + Intergenic
938279188 2:130052440-130052462 GGGGACTGCTGAGCGCTGCTTGG - Intergenic
938291421 2:130152771-130152793 GGCACCTGCTGAGCCCTGTGGGG - Exonic
938436181 2:131284908-131284930 GGGGACTGCTGAGCGCTGCTTGG + Intronic
940693937 2:156955893-156955915 GGTTCCTGCTCAGCCCTGGGAGG + Intergenic
943741606 2:191416107-191416129 AGCTGCTTCTGAGCCCTGCAAGG - Exonic
946619523 2:221545984-221546006 GGGAGATGCTGAGTCCTGCTGGG - Intronic
947194380 2:227546277-227546299 GGGACCTGCTGAGCCAGGCGCGG + Intronic
947532008 2:230915231-230915253 GGGTGCTGCTGAGACCTCCCCGG - Intronic
947999459 2:234555835-234555857 GGCTGCTGCAGAGCCCAGAGAGG + Intergenic
948246240 2:236488923-236488945 GGGTGCAGGTGAGGCCTGTGTGG + Intronic
948246284 2:236489095-236489117 GGGTGCAGGTGAGGCCTGTGTGG + Intronic
948246315 2:236489210-236489232 GGGTGCAGGTGAGGCCTGTGTGG + Intronic
948246323 2:236489238-236489260 GGGTGCAGGTGAGGCCTGTGTGG + Intronic
948246363 2:236489382-236489404 GGGTGCAGGTGAGGCCTGTGTGG + Intronic
948379041 2:237540545-237540567 GGGTCCTGCTGAGACCTCTGGGG - Intronic
948869417 2:240790825-240790847 GGCTGCTCCTGAGCCATGAGGGG - Intronic
1169340908 20:4795567-4795589 GGGAGCTGCTGAGTCATACGAGG - Intronic
1169845119 20:9981885-9981907 GGGAGCTGCTGAGCCCAGAGTGG + Intergenic
1169935168 20:10875784-10875806 TGGTTCTGCTGAGCCATGCCAGG - Intergenic
1171050485 20:21853763-21853785 GGGACCTGCTGAGCCATGTGCGG - Intergenic
1171883032 20:30631927-30631949 GGGGGCTGCTGAGCACTACTGGG - Intergenic
1172091100 20:32433569-32433591 GGGGACTGCTCAGCCCTGCTGGG - Exonic
1172227939 20:33317601-33317623 AGGTGCTGGTGAGCCTGGCGTGG - Intergenic
1172625265 20:36343052-36343074 GGGGACTGCTCAGCCCTGAGGGG + Intronic
1172773229 20:37393384-37393406 GGGAGCTGGTGAGACCTGGGTGG - Intronic
1174406276 20:50305335-50305357 GGGTGGTGCTGGGCCTTGTGGGG - Intergenic
1175253280 20:57622602-57622624 GGCTCCGGCTGAGCCCTGCAAGG + Intergenic
1175852310 20:62100147-62100169 GTGCGCTGCTCAGGCCTGCGTGG - Intergenic
1175893839 20:62327365-62327387 GGGTGCTGCTGAGCACTGACCGG - Exonic
1175909165 20:62396457-62396479 GGCTGCCACTGACCCCTGCGGGG - Intronic
1176002339 20:62838173-62838195 GCCTGCTGCTGAGCCGTGCACGG - Intronic
1176216736 20:63951639-63951661 GTGCTCTGCTGAGCCCTGGGTGG - Intronic
1176216750 20:63951681-63951703 GTGCCCTGCTGAGCCCTGGGCGG - Intronic
1176216764 20:63951723-63951745 GTGCCCTGCTGAGCCCTGGGCGG - Intronic
1176216778 20:63951765-63951787 GTGCCCTGCTGAGCCCTGGGCGG - Intronic
1176382365 21:6119805-6119827 GGGTGCCACTGAGCCCCGCGGGG - Exonic
1176601461 21:8798688-8798710 GTGGGCTGCTGAGCACTGCTTGG - Intergenic
1176626512 21:9096041-9096063 GTGGGCTGCTGAGCACTGCTTGG + Intergenic
1176647082 21:9361997-9362019 GTGGGCTGCTGAGCACTGCTTGG - Intergenic
1176842278 21:13850686-13850708 GGGGGCTGCTGAGCACTGCAGGG - Intergenic
1179485880 21:41710556-41710578 GGTTGCTGCCCAGCCCTGGGAGG + Intergenic
1179663416 21:42893039-42893061 GGGCGCGGCGGAGACCTGCGGGG - Intronic
1179741107 21:43418434-43418456 GGGTGCCACTGAGCCCCGCGGGG + Exonic
1180343746 22:11690225-11690247 GTGGGCTGCTGAGCACTGCTTGG - Intergenic
1180365843 22:11937000-11937022 GTGGGCTGCTGAGCACTGCTTGG + Intergenic
1180417024 22:12776906-12776928 GTGGGCTGCTGAGCACTGCTTGG + Intergenic
1180825156 22:18856567-18856589 GGGTGCTGCTGACCCCTGCGAGG - Intronic
1180874212 22:19167299-19167321 CGGTGGTGCTGAGCCCTGAACGG + Intergenic
1181187574 22:21117980-21118002 GGGTGCTGCTGACCCCTGCGAGG + Intergenic
1181211624 22:21292513-21292535 GGGTGCTGCTGACCCCTGCGAGG - Intergenic
1181397882 22:22634373-22634395 AGGTGCTGCTGACCCCTGCGAGG + Intergenic
1181500627 22:23313744-23313766 GGGTGCTGCTGACCCCTGCGAGG + Intronic
1181651524 22:24261685-24261707 GGGTGCTGCTGAGCCCTGCGAGG - Intergenic
1181705851 22:24649054-24649076 GGGTGCTGCTGACCCCTGCGAGG + Intergenic
1183406008 22:37631018-37631040 GGCTGCTGCGGAGGCCTGGGGGG - Exonic
1183654388 22:39176428-39176450 GGGTGCTGCTGTGCCGTGTCGGG - Intergenic
1184686072 22:46096904-46096926 GTGGGATGCTGAGCCCTGAGTGG - Intronic
1185188194 22:49415837-49415859 GGGATCTGCTGAGTCCTACGAGG - Intronic
1203215329 22_KI270731v1_random:2919-2941 GGGTGCTGCTGACACCTGCGAGG + Intergenic
1203275301 22_KI270734v1_random:82470-82492 GGGTGCTGCTGACCCCTGCGAGG - Intergenic
950724215 3:14906064-14906086 GGGTGCTGCTGTGACCTGTGGGG + Intronic
952964228 3:38611105-38611127 GAGTGCCTCTGAGCCCTGGGTGG - Intronic
953970480 3:47343469-47343491 GGGGGCTGCTGTGCCCTGCACGG + Intronic
956048350 3:65220521-65220543 GGGACCTGCTGAGCCAGGCGTGG + Intergenic
959692912 3:109218919-109218941 GGGACCTGCTGAGCCAGGCGTGG - Intergenic
961435920 3:126916603-126916625 GGGTGCTGCACTGCCCTGCAGGG + Intronic
964476024 3:157098404-157098426 GGGTGCTGCTGAGGACAGGGAGG + Intergenic
966256060 3:177917720-177917742 GGGTGCTGATGAGCACGGGGGGG + Intergenic
967228367 3:187314451-187314473 AGATGCTGCAGAGCCCTGCCAGG - Intergenic
967553803 3:190831424-190831446 GAGTGCTGCTGAAGCCTGTGCGG - Intergenic
968090988 3:195898061-195898083 GGGTGATGCTGAGCCCAGTTTGG - Intronic
1202739800 3_GL000221v1_random:42995-43017 GTGGGCTGCTGAGCACTGCTTGG + Intergenic
968804054 4:2761318-2761340 TGAAGCTGCTGAGGCCTGCGTGG + Intergenic
969360315 4:6659003-6659025 GGGTGGAGCTGAGACCGGCGGGG + Intergenic
969535841 4:7755661-7755683 GGCTCCTGCTGAGCCATGCAGGG - Intergenic
973364784 4:49200480-49200502 GTGGGCTGCTGAGCACTGCTTGG - Intergenic
973366693 4:49214243-49214265 GGGGGCTGCTGAGCACTACTGGG - Intergenic
973393901 4:49578068-49578090 GGGGGCTGCTGAGTACTGCTGGG + Intergenic
973395809 4:49591970-49591992 GTGGGCTGCTGAGCACTGCTTGG + Intergenic
977554769 4:98477474-98477496 GGGTGCTGATGAGCTCAGTGGGG - Intronic
978165297 4:105600121-105600143 GCCTGCTCCTGAGCTCTGCGTGG + Intronic
1202762177 4_GL000008v2_random:122136-122158 GTGGGCTGCTGAGCACTGCTTGG - Intergenic
1202764219 4_GL000008v2_random:136868-136890 GGGGGCTGCTGAGTACTGCTGGG - Intergenic
985639407 5:1056698-1056720 GGGGGCTCCTGGGCCCTGTGGGG - Intronic
985671191 5:1207438-1207460 GGCTGCCGCTGAGCTCTGAGAGG + Intronic
985672868 5:1215085-1215107 GGGAGCTCCTGAGGCCTGGGTGG - Intronic
985781844 5:1875715-1875737 GGGGGCTGCAGAGCCCCGCCAGG + Intergenic
986256240 5:6103304-6103326 GTGTGCTGCTGAGGCCTGAAGGG - Intergenic
987411578 5:17620518-17620540 GGGTGCTGAAGAGCCCTCCTGGG - Intergenic
988671745 5:33389008-33389030 GGGAGCTGCTGAGCCAGGCATGG - Intergenic
990532500 5:56688224-56688246 AGGAACAGCTGAGCCCTGCGAGG - Intergenic
991200015 5:63980695-63980717 GGGACCTGCTGAGCCATGTGTGG + Intergenic
991387501 5:66106278-66106300 GGGACCTGCTGAGCCAGGCGTGG - Intergenic
996230599 5:121059252-121059274 GGCTGCTACTGAGACCTGCGTGG + Intergenic
997224415 5:132198172-132198194 GTGTGCTGATGAGCCCTAAGGGG - Intronic
997661551 5:135593033-135593055 GGGTCCTGCTGAGCTCTGGTGGG - Intergenic
999153432 5:149441770-149441792 GGGTGCGGCTGATCACTGCAGGG + Intergenic
1001258179 5:170201253-170201275 GGGTGCTGGTGTGCCCAGAGTGG - Intergenic
1001401884 5:171450913-171450935 GGGTGCCGCTGGCCCCTGCTGGG - Intronic
1001799142 5:174528272-174528294 GGGGGTTGCTGAGGCCAGCGTGG + Intergenic
1002271101 5:178072949-178072971 TGGTGGTGCTGAGTCTTGCGTGG - Intergenic
1002443713 5:179277103-179277125 GTGTGCTCCTGTGCCCTCCGAGG - Intronic
1005781899 6:29201420-29201442 GGGTGCTGCTGAGGGCAGCTTGG + Intergenic
1006457914 6:34142615-34142637 GGGAGCTGCAGAGCCCTTCTAGG + Intronic
1006474927 6:34247516-34247538 GGGGGCTGCTGAGCCCAGGAAGG + Intronic
1007018324 6:38492203-38492225 GGGTGCTGTTGAACCCTGAATGG - Intronic
1007277536 6:40686213-40686235 GGCTGCTGCTGAGCCGTCAGAGG - Intergenic
1007505376 6:42331609-42331631 GGGTGCTGCAGATCCCTAAGCGG + Intronic
1009688192 6:66990861-66990883 GGTTGCTGCTCAGCCCTGTTAGG + Intergenic
1015446845 6:133316043-133316065 AGGTGGTGCTGAGCCCAGCCAGG - Intronic
1017393855 6:153973333-153973355 GGGTGGTGCTGGGCCCTGATTGG + Intergenic
1017639243 6:156474935-156474957 GGGTGCCGCTGAACTCTGTGTGG + Intergenic
1018413874 6:163584067-163584089 GTCTGCTGCTAAGCCCTGAGCGG - Intergenic
1019338785 7:498108-498130 GGGTGCTGGTGGGCTCTGCAGGG - Intronic
1019500427 7:1361872-1361894 GGCTGGTGCTGAGACCTGCCCGG + Intergenic
1021798187 7:24278784-24278806 GGGACCTGCTGAGCCATGTGTGG + Intergenic
1021925450 7:25529636-25529658 GGTTCATGCTGGGCCCTGCGGGG - Intergenic
1022510178 7:30929955-30929977 GGGTGCAGCTGGGACCTGGGGGG + Intergenic
1022536194 7:31100155-31100177 GAGTGCTGCTGAGCCCGCTGTGG - Exonic
1023688209 7:42758852-42758874 GGATGCAGCTAAGCCCTGCCTGG - Intergenic
1023863393 7:44227980-44228002 GGGTGCTGCTGCGGACAGCGTGG + Intronic
1023968518 7:44975931-44975953 GGCTGCAGCTGAGGCCTGGGAGG - Intronic
1024270833 7:47640154-47640176 GAGTGCTGCTAACCCCTGTGTGG + Intergenic
1026941615 7:74290508-74290530 GGGTGGGGCTGGGGCCTGCGTGG - Intronic
1029424397 7:100487064-100487086 GGGTGCTGCTGTCCTCTGTGAGG - Exonic
1029653002 7:101906500-101906522 GGGTTCTGGGGAGCCCTGGGTGG + Intronic
1029705607 7:102274243-102274265 GGGTGCCGCTGAGCACCGCCTGG + Intronic
1032241365 7:130161878-130161900 GGTCGCTGCTGTCCCCTGCGGGG + Intergenic
1032405828 7:131654820-131654842 AGCTGCTCCTGAGCCCTGCCTGG + Intergenic
1034166383 7:149028260-149028282 GGGGGCTGCAGAGCTGTGCGGGG - Intronic
1034234658 7:149557260-149557282 GGGTGTGAGTGAGCCCTGCGTGG - Intergenic
1034239438 7:149598492-149598514 GGGTGTGAGTGAGCCCTGCGTGG - Intergenic
1034274651 7:149818713-149818735 GGGTGCGGCTGCGCCATGCAGGG - Intergenic
1034971539 7:155422774-155422796 GGCTCCTGCTGCACCCTGCGGGG - Intergenic
1035037060 7:155902339-155902361 GGGGGCCGCTGAGCACTGAGAGG - Intergenic
1035552171 8:537152-537174 GGGCACTGCTGAGCCCCACGTGG + Intronic
1035564979 8:635392-635414 TAGTGGTGATGAGCCCTGCGGGG - Intronic
1036859458 8:12335173-12335195 GGGTGCTGCAAAGTCCTGTGTGG + Intergenic
1040104882 8:43535894-43535916 GGGGGCTGCTGAGCATTGCTGGG + Intergenic
1041718183 8:60950913-60950935 AGGAGCTGCAGAGCTCTGCGGGG + Intergenic
1044956619 8:97487942-97487964 GGGACCTGCTGAGCCATGCTCGG + Intergenic
1048592817 8:135837212-135837234 GGCTGCTGCTGGGATCTGCGGGG + Intergenic
1048970084 8:139640500-139640522 GGGGGCTGTGGAGCCCAGCGAGG - Intronic
1049182079 8:141228046-141228068 GGGTGAGGCAGAGCCCTGAGGGG + Intronic
1049586310 8:143434166-143434188 GGCTCCTGCTAAGCCCTGCCTGG - Intergenic
1052880482 9:33598578-33598600 GGGGGCTGCTGAGCACTGCTGGG + Intergenic
1053046426 9:34922985-34923007 GGGTGCTGCTGGGCCGGGCCTGG + Intergenic
1053420673 9:37975587-37975609 GGCTGCTGCTCAGTCCTGGGAGG + Intronic
1053495494 9:38545633-38545655 AGGGGCTGCTGAGCACTGCTGGG - Intronic
1053666692 9:40322389-40322411 TGGGGCTGCTGAGCACTGCTGGG + Intronic
1053916288 9:42947479-42947501 TGGGGCTGCTGAGCACTGCTGGG + Intergenic
1054377842 9:64462417-64462439 TGGGGCTGCTGAGCACTGCTGGG + Intergenic
1054517918 9:66053894-66053916 TGGGGCTGCTGAGCACTGCTGGG - Intergenic
1055985733 9:82055666-82055688 GGGGGCTGCTGAGCACTGCTGGG + Intergenic
1056562878 9:87747830-87747852 TGGTGCTGCTTGGCCCTGCCTGG + Intergenic
1056585606 9:87925453-87925475 GGGGGCTGCTGAGCACTGCTGGG - Intergenic
1056611273 9:88127491-88127513 GGGGGCTGCTGAGCACTGCTGGG + Intergenic
1056765769 9:89443607-89443629 GGGTGCAGCTGAGCGCTGCAGGG - Intronic
1057187404 9:93064654-93064676 GTGTTGTGCTGAGCCCTGTGGGG - Intronic
1057204414 9:93162828-93162850 GGTTTCTGCTGATCCCTGCCTGG + Intergenic
1057675383 9:97132991-97133013 GGGGGCTGCTGAGCACTGCTGGG - Intergenic
1058335132 9:103818615-103818637 GTGACCTGCTGAGCTCTGCGTGG - Intergenic
1060542744 9:124441597-124441619 GGCTGCTGCTGGGTCCTGAGTGG - Intergenic
1060994652 9:127869089-127869111 AGGGGCTGCTGAGTCCTGGGGGG + Intronic
1061074021 9:128329863-128329885 GGGTGCTGCTGAGTACTCAGAGG + Intronic
1061612389 9:131755788-131755810 TGGCGCTGTGGAGCCCTGCGTGG + Intergenic
1061971726 9:134048840-134048862 CGGTGCTGCAGAGACCTGGGAGG + Intronic
1062212660 9:135373087-135373109 GGGTGCTGCTGGGCACTGATGGG - Intergenic
1062287671 9:135780313-135780335 GCGAGCTGCTGGGACCTGCGTGG + Intronic
1062345387 9:136112089-136112111 GGGGGCTGAAGAGCCCTGTGGGG - Intergenic
1062394625 9:136347862-136347884 GGGTGTCGCTCAGCCCTGCGGGG - Intronic
1203749684 Un_GL000218v1:66455-66477 GTGGGCTGCTGAGCACTGCTTGG + Intergenic
1203708442 Un_KI270742v1:72952-72974 GTGGGCTGCTGAGCACTGCTTGG + Intergenic
1203542940 Un_KI270743v1:107017-107039 GTGGGCTGCTGAGCACTGCTTGG - Intergenic
1203544967 Un_KI270743v1:121741-121763 GGGGGCTGCTGAGTACTGCTGGG - Intergenic
1188811300 X:34656901-34656923 GGGCGGTGCTGAGCCCGGCCTGG - Exonic
1189002089 X:36958020-36958042 GGGCGGTGCTGAGCCCGGCCTGG + Intergenic
1189282520 X:39828799-39828821 GGGAGCTGCTGAGCCCTGCCTGG + Intergenic
1190737942 X:53268019-53268041 GGGTGCTGCTGAGCAGTACCAGG + Intronic
1192247770 X:69387782-69387804 GGGGGCTGCTGAGCCCACAGGGG + Intergenic
1195302341 X:103542976-103542998 CTGTGATGCTGAGCCCTGGGTGG - Intergenic
1200151751 X:153954636-153954658 GGGTGCTGGGGAGCCCCGCATGG - Exonic
1200214467 X:154361457-154361479 GGGTGCAGCGGTGCCCTGCAAGG - Exonic