ID: 1181652889

View in Genome Browser
Species Human (GRCh38)
Location 22:24270741-24270763
Sequence GCGCAGTGAAGGAATGTAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 118}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181652874_1181652889 26 Left 1181652874 22:24270692-24270714 CCGGAGATGGGGGAAGGGGAGGG 0: 1
1: 2
2: 9
3: 139
4: 1065
Right 1181652889 22:24270741-24270763 GCGCAGTGAAGGAATGTAGGCGG 0: 1
1: 0
2: 1
3: 14
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181652889 Original CRISPR GCGCAGTGAAGGAATGTAGG CGG Intergenic
901463415 1:9405257-9405279 GCTCAGAGAAGGAAGGTAAGTGG + Intergenic
901464031 1:9409363-9409385 GCTCAGGGAAGGAAGGTAAGTGG + Intergenic
903572008 1:24312973-24312995 GCTCCAGGAAGGAATGTAGGTGG + Intergenic
903862541 1:26373491-26373513 GGGCAGTGAAGGAAAGAAGGGGG + Intronic
916072139 1:161176660-161176682 GCGAAGTGAAGGAAAGTGGTTGG + Intronic
921350729 1:214231594-214231616 GTACAGTGAAAGCATGTAGGAGG - Intergenic
1062916029 10:1241803-1241825 GGGCAGTGCAGGAATGTGGGGGG + Intronic
1063294213 10:4786512-4786534 GGGCAGTGAAGGCAGGTGGGAGG + Intergenic
1064617683 10:17179056-17179078 GCACAGTGAAGGAATCTACAAGG + Intronic
1065361795 10:24895951-24895973 GTGCAGTGAAAGAAAGAAGGGGG - Intronic
1066048745 10:31617095-31617117 GGGCAGAGAAAGAATGGAGGTGG + Intergenic
1077068251 11:654560-654582 TTCCAGTGAATGAATGTAGGGGG - Intronic
1077343231 11:2035290-2035312 GGGCACTGAGGGAATGCAGGCGG - Intergenic
1077705296 11:4479490-4479512 GAGCAGTGATGGAATATAAGGGG - Intergenic
1078065746 11:8078202-8078224 GGGGAGTGAAGGAATGCATGGGG - Intronic
1079105777 11:17571487-17571509 GGGCAGTGAAGGGAGGAAGGGGG - Intronic
1085776780 11:79373592-79373614 ACGCAGTGAAGGAAAGAAGAAGG + Intronic
1085924584 11:81000778-81000800 GCACAGTGAAGGAAAGAAGGAGG - Intergenic
1086279003 11:85163833-85163855 GCTCAGCCAAAGAATGTAGGAGG - Intronic
1089839194 11:121399732-121399754 GCTCAGTGAAGGCATCTTGGAGG - Intergenic
1089883898 11:121800949-121800971 GGGCTGTGAAGGAATGTAGGTGG + Intergenic
1090473528 11:127000516-127000538 GCGCAGCGAAGGAAAGCCGGCGG + Exonic
1090629499 11:128633725-128633747 GCTCAGTGAAGGAAAGTAGATGG + Intergenic
1202826217 11_KI270721v1_random:90479-90501 GGGCACTGAGGGAATGCAGGCGG - Intergenic
1093923311 12:24883813-24883835 GTGCATTGCAGGAATCTAGGTGG - Intronic
1095630003 12:44365222-44365244 GCAAAGTGAAGGAATGGAAGTGG - Intronic
1096321070 12:50613331-50613353 AGGCAGTGAATGAATGTAGAAGG + Intronic
1098524265 12:71469126-71469148 GCTCAGAGAATGAATGTAGAAGG - Intronic
1103240619 12:119410431-119410453 GCCCAGTGAAGGACTGAAGATGG - Intronic
1104927742 12:132322348-132322370 GCGCAGTTCAGGAATGCAGCAGG + Intronic
1104971458 12:132532708-132532730 GCGCAGTGCAGGAGGGTGGGAGG + Intronic
1105205198 13:18217471-18217493 GCGCACTGAAGGAATGTGACCGG - Intergenic
1113180592 13:107620810-107620832 GTGCAGTGAGGGAATGAGGGAGG + Intronic
1118789614 14:69078014-69078036 ACACTGTGAAGGAATGTTGGAGG + Intronic
1119473266 14:74912195-74912217 GCACAGTGCAGGGATGTAGTAGG + Intronic
1119954729 14:78784683-78784705 GAGCAAAGAATGAATGTAGGGGG + Intronic
1122914984 14:104854570-104854592 GGGCAGTGGAGGGATGGAGGGGG + Intergenic
1122915038 14:104854735-104854757 GGGCAGTGGAGGAATGGAGGGGG + Intergenic
1126464777 15:48951648-48951670 GCAAAGTGAAGGCATGGAGGTGG - Intronic
1129205971 15:74037174-74037196 GCCCAGTGAAGAAAGGCAGGCGG - Intronic
1134084786 16:11348907-11348929 GGGCAGTGGTGGAAGGTAGGAGG + Intronic
1136287261 16:29251851-29251873 GGGCAGTACAGGAATGTGGGCGG + Intergenic
1136588694 16:31203888-31203910 GCTGAGTGAAGGAATGAATGAGG + Intergenic
1140545047 16:75799728-75799750 GTGCAGTGAAGCAATCTTGGTGG + Intergenic
1144346774 17:14356529-14356551 GCAAACTGAAGGAATTTAGGGGG + Intergenic
1144798205 17:17906943-17906965 CAGCAGTGCAGGAATGCAGGAGG + Intronic
1150641187 17:66950884-66950906 ACGCATTGAGGGAATGTAGGTGG + Intergenic
1150859439 17:68786296-68786318 GAGCAAAGAAGGAAGGTAGGAGG - Intergenic
1153329521 18:3859646-3859668 CAGGAGTCAAGGAATGTAGGTGG + Intronic
1153909890 18:9697474-9697496 GCGCAGGGAAGGTGGGTAGGTGG + Intergenic
1155114863 18:22754133-22754155 GCCCAGTAAGGGAATCTAGGAGG - Intergenic
1156458316 18:37307082-37307104 GAGCGGTGAGGGAAGGTAGGTGG + Intronic
1160417813 18:78723742-78723764 GCGGAGTCAGGGAAGGTAGGGGG + Intergenic
1163211332 19:15842537-15842559 GTGCAGTGAAGGGAAGTAGATGG - Intergenic
1164039736 19:21483839-21483861 GCGCTGGGAAGGAAGGTTGGCGG + Intronic
1164249615 19:23465645-23465667 GAGAAGTGAAGGAGAGTAGGAGG - Intergenic
1165755524 19:38290613-38290635 GCTCAGTCAAGGAAGGGAGGAGG - Intronic
1166934092 19:46320661-46320683 GCGCAGGGAAGGGAGGCAGGAGG - Intronic
1167587163 19:50381758-50381780 GCCCAGTGAAGGAATGAATGAGG - Intronic
1167628762 19:50609870-50609892 GGGCAATGAAGGGATGAAGGGGG - Intergenic
1168583836 19:57577029-57577051 GCCCAGGGAAGGAAGGTTGGGGG - Intronic
925157933 2:1661526-1661548 GGGCAGTGCAGGGATGCAGGTGG + Intronic
926180157 2:10635617-10635639 GCGCTGTGAAGGAAGGCAGCAGG - Intronic
928825641 2:35417820-35417842 ACACAGTGAAGGAATAAAGGAGG + Intergenic
933668713 2:84986441-84986463 GCCAAGTGAGAGAATGTAGGAGG + Intronic
934658892 2:96132681-96132703 GCGCAGTGGAGGGATGCAGGTGG - Exonic
934902086 2:98167519-98167541 GCACAGAGGAGGAACGTAGGTGG + Intronic
935620655 2:105126860-105126882 GAGCAGTGCAGGAGTGTAGATGG + Intergenic
937488972 2:122345754-122345776 GAGCAGTGAGGGCAGGTAGGAGG + Intergenic
939516538 2:143175592-143175614 GCACAGTGAAGAAAAGTAGTGGG + Intronic
942542608 2:177030475-177030497 GTGCAGCTAAGGAGTGTAGGAGG - Intergenic
942715124 2:178882936-178882958 GAGGAGTGAAGTAATGTACGGGG + Intronic
948149247 2:235731938-235731960 GCGCAGGGAAGAAATGGAAGGGG + Intronic
1170033955 20:11970469-11970491 GGGCAGTGAAGCAATGAAAGAGG + Intergenic
1175805325 20:61825081-61825103 GTGGGGTGAAGGAATGAAGGAGG - Intronic
1179471381 21:41612991-41613013 GGGCAGGGAAGGAATCTGGGAGG - Intergenic
1179575711 21:42307118-42307140 GAGCAGTGAATGAATGGATGTGG + Intergenic
1180018088 21:45100712-45100734 GTGAAGTCAAGGAATGGAGGCGG + Intronic
1180829037 22:18888511-18888533 GCGCACTGAAGGAATGTGACCGG + Intergenic
1181652889 22:24270741-24270763 GCGCAGTGAAGGAATGTAGGCGG + Intergenic
1182230990 22:28837402-28837424 GCGCAGCAAAGGAATGAAGCTGG - Intergenic
1203279128 22_KI270734v1_random:114498-114520 GCGCACTGAAGGAATGTGACCGG + Intergenic
954795375 3:53158795-53158817 GGGCAGAGAAGGGATGAAGGTGG - Intronic
957128170 3:76189074-76189096 CAGCAGTGAAGAAATGTGGGAGG + Intronic
959539547 3:107523707-107523729 GGGCAGTGGAGGAAGGTACGAGG + Intronic
960914527 3:122682079-122682101 GCGCACAGAAGGAAGGAAGGAGG + Intronic
963734921 3:149008610-149008632 ATGCAGTGAAGGAATGTACGTGG - Intronic
964835229 3:160930671-160930693 GCGGAGTGAAGGAGTTTAAGAGG + Intronic
969481284 4:7448417-7448439 GAGAAGAGAAGGAATGAAGGAGG - Intronic
971355185 4:25888845-25888867 GGGAAGTGAAGCAATGGAGGAGG - Intronic
976845413 4:89483537-89483559 GCGCAGGCAAGGGATCTAGGTGG + Intergenic
980086439 4:128395116-128395138 GTGCAATGAAGGAATGTGGGTGG - Intergenic
980099692 4:128529311-128529333 GCACAGTGATGGCATGTAGCAGG - Intergenic
981966939 4:150615147-150615169 GTGAAATGATGGAATGTAGGAGG + Intronic
985150912 4:186946228-186946250 GCACAGTCAATGAATGTAAGAGG + Intergenic
991259881 5:64655522-64655544 AAGAAGTCAAGGAATGTAGGTGG - Intergenic
993622638 5:90186884-90186906 GCTCTGGGAAGGAATTTAGGAGG + Intergenic
995289011 5:110428135-110428157 GGGCTGGGAAGGAAAGTAGGGGG - Intronic
999347264 5:150835117-150835139 GCGCTGAGAAGGAATGGAGTGGG - Intergenic
1001799765 5:174532762-174532784 GCACACTGAAGGAAGGGAGGAGG + Intergenic
1007842118 6:44725137-44725159 GCGCAGTGAGGGGCTGTAGAAGG + Intergenic
1010507261 6:76675657-76675679 ACGCAGGGAAGGAAGGAAGGAGG - Intergenic
1013684484 6:112563600-112563622 GGGCGGTGAAGGAATGTCAGTGG + Intergenic
1019622478 7:1999399-1999421 GCGCAGTGGAGGGAGGGAGGCGG - Intronic
1021387195 7:20045644-20045666 GGGCAGTAATGAAATGTAGGGGG - Intergenic
1022105096 7:27191664-27191686 GCGCAGTGAAGGATTCTTGGGGG + Intergenic
1029198703 7:98824511-98824533 GCGCAGGGAAAGGATGCAGGGGG - Intergenic
1029688230 7:102163525-102163547 GAGCAGTGAAGAATCGTAGGCGG + Intronic
1034285432 7:149880583-149880605 GCTCAGAGAGGGAGTGTAGGGGG - Exonic
1035065790 7:156104375-156104397 GCACAGTGAATGCATGGAGGAGG - Intergenic
1035943307 8:3929267-3929289 TCTCATTGAGGGAATGTAGGGGG - Intronic
1036586654 8:10130517-10130539 TCCCAGTGAAAGAATGTCGGAGG - Intronic
1036778297 8:11628565-11628587 GGGCACTGGAGGAATGGAGGAGG + Intergenic
1041408266 8:57525774-57525796 GCAGAGTGAAGGGATGGAGGTGG - Intergenic
1042244119 8:66693865-66693887 CCACAGTCAAGGAATGCAGGTGG - Intronic
1043624168 8:82233721-82233743 ACGCTGAGAAGGTATGTAGGTGG + Intergenic
1044815840 8:96111322-96111344 GCCCAGAGAAGAAATGTTGGGGG - Intergenic
1048555536 8:135472280-135472302 GAGCAGTGAAGGTATGTACGTGG - Intronic
1048679838 8:136828886-136828908 GTGCAGTGAAGGCATGTAGAAGG - Intergenic
1050731732 9:8716828-8716850 GCCCAGTATTGGAATGTAGGGGG + Intronic
1052277453 9:26693323-26693345 GAGCAGGGAAGGAATGTTGGTGG + Intergenic
1052504826 9:29340324-29340346 GATCAGTGAAGGAAAGTAAGTGG - Intergenic
1054723399 9:68625823-68625845 GGGCAGTGAAAGATTGCAGGTGG - Intergenic
1054914772 9:70485704-70485726 GAGGAGTGGAGGAAGGTAGGAGG - Intergenic
1055538231 9:77271655-77271677 GGGCAGTGATTGAGTGTAGGGGG + Intronic
1187007272 X:15245233-15245255 GCTCAGGGAAGGAAAGGAGGAGG + Intronic
1189427275 X:40912658-40912680 GCCCAGGGGAGGAGTGTAGGAGG - Intergenic
1192222539 X:69207243-69207265 GCTCAGTATAGGAATGGAGGTGG - Intergenic
1192246961 X:69380711-69380733 GCCCAGAGAGGGCATGTAGGTGG + Intergenic
1192638708 X:72844220-72844242 GGGGAGTGAATGAATGCAGGAGG + Intronic
1192643004 X:72876588-72876610 GGGGAGTGAATGAATGCAGGAGG - Intronic
1193750710 X:85339859-85339881 GAGCATTGAAGGAATTTATGTGG + Intronic
1196025934 X:111041454-111041476 GCACAGTGAAGGAGTGTTTGGGG - Intronic
1199500602 X:148501627-148501649 GCGCAGCGCAGGGATGGAGGTGG - Intronic