ID: 1181654653

View in Genome Browser
Species Human (GRCh38)
Location 22:24287021-24287043
Sequence CTGTGGCCAGAAAGGTAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 375
Summary {0: 1, 1: 0, 2: 6, 3: 39, 4: 329}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181654648_1181654653 15 Left 1181654648 22:24286983-24287005 CCTAAATGTTGTCTGGATAAAAG 0: 3
1: 0
2: 2
3: 23
4: 225
Right 1181654653 22:24287021-24287043 CTGTGGCCAGAAAGGTAAGAGGG 0: 1
1: 0
2: 6
3: 39
4: 329
1181654647_1181654653 16 Left 1181654647 22:24286982-24287004 CCCTAAATGTTGTCTGGATAAAA 0: 3
1: 0
2: 2
3: 30
4: 295
Right 1181654653 22:24287021-24287043 CTGTGGCCAGAAAGGTAAGAGGG 0: 1
1: 0
2: 6
3: 39
4: 329

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181654653 Original CRISPR CTGTGGCCAGAAAGGTAAGA GGG Intronic
900380123 1:2379784-2379806 CTGTGGGCAGGAAGGTAAAAGGG + Intronic
901489749 1:9590542-9590564 CTGTGGCCAGCAGGGCAGGAAGG - Intronic
902542948 1:17167214-17167236 CTGTGGCCAGGAAGGGAGGGAGG - Intergenic
903260351 1:22128508-22128530 CTGAGACCAGAAATGTGAGATGG - Intronic
903853668 1:26322848-26322870 ATGAGGCCAGAAAGGTTATAAGG - Intronic
904304975 1:29582776-29582798 GTGAGGCCAGAAAGGTCACAGGG - Intergenic
904459267 1:30665933-30665955 CTGGGGACAGAAGGGAAAGAGGG - Intergenic
907947446 1:59148231-59148253 ATGAGGCCAGAGAGGTAAAAGGG + Intergenic
912429210 1:109620329-109620351 CTGTGGCCAGAGTGACAAGAGGG + Intronic
912501901 1:110128358-110128380 CTGTGGCTAGAACAGGAAGAAGG + Intergenic
912619836 1:111144081-111144103 ATGTGGCGAGAAAGGAAAAATGG - Intronic
912714830 1:111975712-111975734 ATGAGGCCAGAGAGGTAACAGGG - Intronic
913295338 1:117313819-117313841 TTGTGGCCAGAAAGGATAGGTGG + Intergenic
913367369 1:118055115-118055137 CTGTGGGCAGAAGGGGAAGATGG - Intronic
914202234 1:145495926-145495948 TTGGGCCCAAAAAGGTAAGAGGG - Intergenic
914236162 1:145813841-145813863 TTGGGCCCAAAAAGGTAAGAGGG - Intronic
914481360 1:148069068-148069090 TTGGGCCCAAAAAGGTAAGAGGG - Intergenic
914931955 1:151942850-151942872 TTGTGGCCATATAGGAAAGAGGG - Intergenic
914964564 1:152243194-152243216 TAGTGGCCAGTAAGGTAGGAGGG + Intergenic
915988884 1:160493145-160493167 ATGAGGCCAGAAAGGAAACAGGG - Intronic
916721980 1:167491206-167491228 CTGTGGGCGGAAAGGTAAAATGG + Intronic
918081805 1:181213614-181213636 CTGTGGTCTGAGAGGGAAGAAGG + Intergenic
918262240 1:182806518-182806540 CTTTGGGCTGAAAGGTAAGAGGG + Intronic
918441853 1:184575894-184575916 CTGTGGCCCAACAGGCAAGAGGG - Intronic
918725509 1:187916881-187916903 CAGTAGCCAGGAAGGTAAGATGG + Intergenic
918838368 1:189500358-189500380 CTCTGGCCAAAAAGGTGAAAAGG + Intergenic
919814892 1:201431101-201431123 CTGGGGCCAGAAATGTCAGGGGG + Intergenic
920183234 1:204145446-204145468 CTGTGGGCTGAAAGGTTGGAAGG + Intronic
921912729 1:220568477-220568499 ATGAGGGCAGAAAGGTAATAGGG + Intronic
922199505 1:223389993-223390015 ATGAGGCCAGAAAGGTAGGCTGG - Intergenic
923055658 1:230424919-230424941 CTGTGGCCACAGTGGTAAGCAGG + Intronic
924619986 1:245651886-245651908 CTGGTGCCAAAAAGGTAAAAGGG + Intronic
924809560 1:247389175-247389197 TTGTGACCAGGAAGGGAAGAAGG - Intergenic
1063020561 10:2122970-2122992 CAGTGGTCAGTAAGGTAAGTTGG - Intergenic
1063336628 10:5221931-5221953 CTATGGACAGAAAGGAAAGACGG + Intergenic
1065205610 10:23355183-23355205 CTGTGGCCACAGAGGAGAGAAGG - Intergenic
1065264650 10:23962235-23962257 CGTTGGTCAGACAGGTAAGAAGG - Intronic
1065965458 10:30766918-30766940 CTGTGGCCACAAAGGAAAGATGG - Intergenic
1066043693 10:31578508-31578530 CTTTGGCCAGAGTGGAAAGAAGG - Intergenic
1068506231 10:57902973-57902995 TTGTTGGCAGGAAGGTAAGATGG + Intergenic
1070274075 10:74987640-74987662 CTGTAAACAGAAAGGAAAGAAGG + Intronic
1071515810 10:86295976-86295998 CTGTTGCCAGAGAGGTTTGAGGG + Intronic
1071517728 10:86310178-86310200 ATGGGGCCAGGAAGGTATGAGGG - Intronic
1071591585 10:86879515-86879537 CTGTTGCCAGCAAGGGAAGGAGG + Intronic
1072543030 10:96412914-96412936 TTGTGTCCAGAAGGGGAAGAAGG - Intronic
1072805870 10:98423817-98423839 CTGTGGTCAGAAAGTTCAGCCGG + Exonic
1074251052 10:111747650-111747672 CTGTGGCCAGAAAAAAAAAATGG - Intergenic
1075732743 10:124646000-124646022 CTGAGGCCAAACAGGTAACAGGG + Intronic
1077458433 11:2695013-2695035 CAGTGGTCAGAGAGGTAAGCAGG + Intronic
1077465655 11:2732621-2732643 CCGTGGCCGGAAAGGTCAGACGG - Intronic
1077870307 11:6257185-6257207 ATGTGGCTAGAGAGGTAAGTGGG + Intergenic
1077918271 11:6625019-6625041 CTGTACCCAGAAAGGGGAGAAGG - Intronic
1078455624 11:11472290-11472312 CTGGGGCTGGAAGGGTAAGAGGG + Intronic
1079594913 11:22231842-22231864 TTGTGTCCAGAAAGGTATGTAGG - Intronic
1080634917 11:34115335-34115357 CTGAGGCCTGAAGGGTAAGTAGG - Intronic
1080737731 11:35033337-35033359 TTGAGGGCAGAAAGGAAAGAGGG - Intergenic
1081492259 11:43577979-43578001 CTGTGGCCAGACAGGTGAGGAGG + Intronic
1084069869 11:66727543-66727565 CTGTGGCCAGGAAGCTGATAGGG - Intronic
1084083149 11:66842496-66842518 CTGAGGCCAGAAAGGTGAGGGGG + Intronic
1084404182 11:68961455-68961477 CTGTGGCCAGGAAGGGAAATGGG - Intergenic
1085212495 11:74793846-74793868 CAGTGGGAAGAAAGGTAAAAAGG - Intronic
1085399470 11:76227101-76227123 CTGGGGCCTGACATGTAAGAGGG + Intergenic
1085512060 11:77093448-77093470 CTCTGGCCAGGAAGGGGAGAGGG + Intronic
1087246877 11:95849665-95849687 CTGTTGCCAACAAGGTCAGATGG - Exonic
1088940373 11:114448156-114448178 CTGTGGGAAGAAAGTTAACACGG - Intronic
1089223432 11:116895123-116895145 ATGAGGTCAGAGAGGTAAGAGGG - Intronic
1090944671 11:131419458-131419480 CTGAGGCCTGAAGGATAAGAAGG + Intronic
1091393561 12:140155-140177 CTGTGACCACAGAGGTGAGAAGG + Intronic
1091508775 12:1100315-1100337 ATGAGGCCAGAGAGGTAACAGGG + Intronic
1092915235 12:13183357-13183379 CTGTGGTCAGCGAGTTAAGAAGG + Intergenic
1093174311 12:15894917-15894939 CTGTGGGCAGAATGGTTAAAGGG + Intronic
1093505127 12:19856266-19856288 CTGTTGCCAGAAAAGTAATTAGG + Intergenic
1094601343 12:31911726-31911748 CAGTGGCCTGACAGGTATGAAGG + Intergenic
1096123613 12:49104439-49104461 CTGGCTCCAGAAAGGTAAGTAGG - Exonic
1096806366 12:54143522-54143544 TTGTAGTCAGAAAGATAAGAAGG - Intergenic
1097280227 12:57840696-57840718 CTGTGGCAAGAAATAAAAGAAGG + Intronic
1097403716 12:59162280-59162302 CTGTGGCAAGAACAGTATGAGGG - Intergenic
1098673687 12:73263183-73263205 CTGTGATCTGAAGGGTAAGAAGG + Intergenic
1099068397 12:78013414-78013436 CTGAGTCCAGAAAGATAAGTAGG + Intronic
1102389266 12:112536448-112536470 CTGAGGCCTGAAAGACAAGAGGG + Intergenic
1103669665 12:122602812-122602834 CTGTAGCTAGAAAGGAAACAAGG - Exonic
1104187673 12:126448295-126448317 CTGTGGCCACCATGGTCAGAGGG - Intergenic
1104387956 12:128367033-128367055 CTGGGGCCAGAATGAAAAGATGG + Intronic
1107136355 13:36948102-36948124 CTGTGCTTAGAAAGGTAAGCTGG + Intergenic
1107617583 13:42187135-42187157 CCGTGGCCAGTAAAGTAAGAGGG + Exonic
1107702524 13:43062270-43062292 CTGTGGCCAAAAAAGAAACAAGG + Intronic
1109561748 13:64058548-64058570 CTGTGACCATAAAGATAATAGGG - Intergenic
1110533390 13:76623051-76623073 TTGTGGTCAGAAGGGAAAGAAGG + Intergenic
1111870592 13:93826720-93826742 AAGTGGACTGAAAGGTAAGATGG - Intronic
1112106041 13:96240797-96240819 CTGTAGCTAGAAAGGTTAAAAGG - Intronic
1112394745 13:99019443-99019465 ATGTGGACAGAAAGGGATGAAGG - Intronic
1113139316 13:107129247-107129269 CTGGGGACAGAAAGCAAAGATGG + Intergenic
1113419945 13:110163481-110163503 CCCTGGCCAGAAAGGAGAGATGG - Exonic
1113464077 13:110501771-110501793 ATTTGGCCTGAAAGGTAAGCAGG + Exonic
1115009819 14:28532038-28532060 CTGTGGACTGAATGGAAAGATGG - Intergenic
1115496158 14:34006908-34006930 CTGAAACCAGAAAGGCAAGATGG + Intronic
1115569840 14:34656048-34656070 CTGTGGCCAGAGAGTGAGGATGG + Intergenic
1116785540 14:49284414-49284436 CTGAGGCCAGAGAGGTAGAAGGG - Intergenic
1119061393 14:71478708-71478730 CTGTGGCTGGAAAAGTAAAAAGG - Intronic
1120841739 14:89091677-89091699 GTGGAGCCAGAAAGGGAAGAGGG - Intergenic
1121711987 14:96045358-96045380 CTGTGTGCACAAAGGCAAGAAGG + Intronic
1121930308 14:97966255-97966277 CTGAGACCAGAAAGGGCAGAAGG + Intronic
1122441303 14:101734089-101734111 ATGTGGCATGAAAGGAAAGAAGG + Intergenic
1123010672 14:105348183-105348205 CTGTGGACAGGCAGGTAGGAGGG - Intronic
1123128345 14:105965865-105965887 CTGTGGACTTAAAGGTAGGAGGG - Intergenic
1123988617 15:25666742-25666764 ATGTGCCCAGAGAGGTAAAATGG - Intergenic
1126974780 15:54163379-54163401 TTCTGGCCAGAATTGTAAGATGG + Intronic
1127230385 15:56985958-56985980 GAGTGGACAGAAAGGGAAGAGGG + Intronic
1127489396 15:59447998-59448020 CTGTGGGGAGAAAGGGAAGAGGG + Intronic
1128453071 15:67818319-67818341 CTGTGGCCAGCAAGTCAAGTGGG + Intergenic
1128515856 15:68341520-68341542 CTTTGACCAGAGAGGTAAGTAGG + Intronic
1129233248 15:74208482-74208504 CTGTGGTCAGCAAGGGAACAAGG - Intronic
1131227604 15:90638466-90638488 CTGTGGGCAGAAAGGAAAGTTGG - Exonic
1131574754 15:93577027-93577049 TTGCAGCCAGAAAGGTAGGAGGG - Intergenic
1132281186 15:100617357-100617379 CTGCAGCTGGAAAGGTAAGAGGG - Intronic
1133501142 16:6367913-6367935 CTGTGGGCAAAAAGTTAAGTTGG - Intronic
1137055132 16:35742051-35742073 CTCTGCCCAGGAAGGAAAGAAGG + Intergenic
1137291217 16:47053281-47053303 CATTGGCCAGCAAGGAAAGAGGG - Intergenic
1137343503 16:47633667-47633689 CAGTGGACAGAAACATAAGATGG + Intronic
1137420907 16:48333146-48333168 CTGTGGCCAGAAACCCAAAATGG - Intronic
1138365707 16:56474937-56474959 CTGTGGCTGTGAAGGTAAGAGGG + Exonic
1139495797 16:67316389-67316411 ATGTGGCAAGAAGGGTAAGGGGG - Intronic
1142159210 16:88548046-88548068 CTGTGGCCAGAAAGATGATCGGG + Intergenic
1142515072 17:422477-422499 TTGTGGCCAGAAGGGGAGGAGGG + Intronic
1144213088 17:13031690-13031712 CAGTGGCCAGGAAGGTAAGATGG + Intergenic
1144687205 17:17234083-17234105 CTATGGCCTGAAAAGTAAGTTGG - Intronic
1144788488 17:17844736-17844758 CAGTGGCCAAAAAGGTAGGCAGG + Intronic
1147463313 17:40589848-40589870 CTTTGGTCAGAAAGAAAAGATGG + Intergenic
1148071762 17:44912626-44912648 CTGTGGACAGGAAGAGAAGAAGG - Intronic
1148573428 17:48689388-48689410 CTATTGCCTGAAAGGAAAGATGG - Intergenic
1148656968 17:49291991-49292013 CTGTTGCCAGACAGGAAAGATGG + Intronic
1150654383 17:67030450-67030472 CTGAGGCCTGAAAGGGAAGCGGG - Exonic
1151413857 17:73948754-73948776 CAGTGGCCAGGGAGGTAGGAGGG + Intergenic
1151450143 17:74193806-74193828 TTGTGAACAGAAAGGTAAGAAGG + Intergenic
1151652861 17:75480931-75480953 CTGTGGCGAGGAAGCTCAGAAGG + Intronic
1152645579 17:81467114-81467136 CTGTGGCAAGAAAGGAAAGACGG + Intergenic
1153168244 18:2286005-2286027 GTGTGACCAGAAAGGTGACAGGG + Intergenic
1153934481 18:9908955-9908977 AAGTGGCCAGAGAGGTAAGTAGG - Intergenic
1154165632 18:12012265-12012287 CTGAAGCCAGAAAGGAAGGATGG - Intronic
1157088191 18:44604081-44604103 CTGTGGACCAAAAGGTAACATGG - Intergenic
1157328079 18:46683518-46683540 CTGAGGGCAGAGAGGGAAGAAGG + Intronic
1157801365 18:50623970-50623992 CTGAGACCTGAAAGGTAAGAAGG - Intronic
1158131920 18:54161712-54161734 CTGTAGGCAGAATTGTAAGATGG + Intronic
1158565289 18:58549856-58549878 CTGTGTCCTGAAAGGGAAGCAGG + Intronic
1162727749 19:12700263-12700285 CTGGGGCCTGAAACGTGAGAAGG + Exonic
1163820328 19:19492785-19492807 CAGCGGCCAGAAAGGTGAAAGGG + Intronic
1164727515 19:30476184-30476206 CTGGGGCCACAGAGGGAAGAAGG - Intronic
1165358773 19:35320710-35320732 CTCTGCCCAGGATGGTAAGACGG - Intronic
1165934921 19:39383476-39383498 CTGTGGTAAGAAAGGGAGGAAGG - Intronic
1166037024 19:40175967-40175989 CTGTGGCCAGCTGGGTCAGAAGG - Intergenic
1166441672 19:42820971-42820993 CTGCAGCTAGAAAGGGAAGAAGG + Intronic
1166449806 19:42888959-42888981 CTGCAGCTAGAAAGGGAAGAAGG + Intronic
1166461111 19:42989257-42989279 CTGCAGCTAGAAAGGGAAGAAGG + Intronic
1166478400 19:43149241-43149263 CTGGAGCTAGAAAGGGAAGAAGG + Intronic
1166501059 19:43341549-43341571 CTGCAGCTAGAAAGGGAAGAAGG + Intergenic
1166509041 19:43391903-43391925 CTGCAGCTAGAAAGGGAAGAAGG - Intergenic
1167858466 19:52262652-52262674 CTGTGGCTGGAAATGTAAGATGG - Intergenic
925231677 2:2238379-2238401 CTGTGGCCACAAAGGAAGGGTGG + Intronic
925258555 2:2510148-2510170 CTGTGGCCAGAAGTGAATGAGGG - Intergenic
925682987 2:6442712-6442734 TTGAGGCCAGAAAAGTAAGTAGG - Intergenic
926269352 2:11353539-11353561 CTGAGGCCACAGAGGTAAAAAGG - Intergenic
926382883 2:12308667-12308689 CTCTGTTCAGAAAGTTAAGAAGG - Intergenic
926643522 2:15263524-15263546 ATGAGGCCAGAAAGATAGGAAGG - Intronic
926981390 2:18574370-18574392 CTGTGGGCAGAAATGTCAAATGG + Intronic
927039695 2:19215983-19216005 CTGTGACCACAAATGGAAGAAGG - Intergenic
927655625 2:24943070-24943092 CTGTGACCAGGGAGGAAAGATGG + Intergenic
928745061 2:34402992-34403014 CTGTCACCAAAAAGGTGAGAAGG + Intergenic
929040882 2:37743435-37743457 CTGTCACCACAAAAGTAAGAAGG - Intergenic
929954084 2:46442312-46442334 CTATGGGGAGAAAGGGAAGAGGG - Intronic
930627615 2:53716197-53716219 CTGGGGTCAGAGAGGTAACATGG + Intronic
932204560 2:69867542-69867564 ATGTGGTCAGAAAGGTGATAGGG - Intronic
932605452 2:73162868-73162890 GTGGGGCCAGAGAGGGAAGAAGG + Intergenic
933508843 2:83214204-83214226 CTGTGGCCAGAAAGGCCATCAGG + Intergenic
935549613 2:104438672-104438694 CTGTGGCCAGGAATGCAAGCAGG + Intergenic
935673779 2:105576894-105576916 CTGAGGCCAGTGAGGAAAGAAGG + Intergenic
936099619 2:109563997-109564019 CTGTTGTCATAAAGGTAAGTTGG - Intronic
936396746 2:112137536-112137558 CAGAGGCCAGAAAGGAAAGCTGG - Intergenic
936529393 2:113265232-113265254 CTGTGGCAAGAGAGCCAAGAAGG + Intronic
937909218 2:127067428-127067450 CTATGGCCAGGATGGTGAGATGG + Intronic
938164473 2:129014708-129014730 CTGAGGTCAGAAGGGTGAGAAGG - Intergenic
939291339 2:140199230-140199252 CTGAAGCCAGAAAGATTAGAGGG - Intergenic
939632266 2:144539073-144539095 CTGAGGCAAGAAATGTAAAATGG + Intergenic
940337289 2:152542806-152542828 CTGTAACCAGGAAGGTAAGATGG + Exonic
940739488 2:157490800-157490822 CTGTGGCCAGAGTGATAAGGAGG - Intergenic
940967475 2:159855782-159855804 CTGTGGCCAGAATGAAAAGGGGG - Intronic
942181865 2:173387894-173387916 CTTTGGACAGAGAGGTAAGGAGG + Intergenic
942296112 2:174518725-174518747 CTGTGCCGATAAAGGTAACAAGG - Intergenic
942765678 2:179453614-179453636 TTGGAGCAAGAAAGGTAAGAAGG + Intronic
942817839 2:180073337-180073359 CTGAGGCCAGAATGGGAATATGG + Intergenic
944383399 2:199137879-199137901 CTGGGGCCAGGAAGGTAAGTAGG - Intergenic
944739883 2:202601537-202601559 CTGTGTCCAGAAAGGTGGGGTGG + Intergenic
944988928 2:205212074-205212096 CTGTACCCAGAAAGGCCAGAGGG + Intronic
948634445 2:239326094-239326116 CAATGGCCAAAAAGTTAAGACGG + Intronic
1169069283 20:2712774-2712796 AAGTGACCAGCAAGGTAAGAGGG + Intronic
1169193709 20:3672627-3672649 CTGGGACCAGAAAGGCAAGAAGG + Intronic
1169748238 20:8964676-8964698 CTGTGGCAAGGAAGGAAGGAAGG + Intronic
1170203280 20:13768301-13768323 CTGTGGACAGAAAGGTTATTGGG + Intronic
1171958881 20:31479405-31479427 CAGTGTCCAGCAAGTTAAGATGG + Intronic
1172693151 20:36804252-36804274 CTTTGGCCTGAAAAGTGAGAGGG - Intronic
1173647066 20:44639959-44639981 CTGTGGCCAGAGAGGTGGGAGGG + Intronic
1173730480 20:45325127-45325149 GTGGGGGCAGAGAGGTAAGAAGG - Intergenic
1173896140 20:46552096-46552118 CTGTGGCCAGAACCCTCAGAGGG + Intergenic
1176094344 20:63333096-63333118 CTGTGGCCGTAAAGGCAGGAGGG - Intronic
1176723673 21:10413094-10413116 GTGTGGCTGGAAAGGTAGGAAGG - Intergenic
1178024929 21:28455623-28455645 ATGTGCACAGAAACGTAAGAAGG - Intergenic
1180107371 21:45629033-45629055 CTGAGGCAAGAAAGGGAGGAAGG + Intergenic
1180304829 22:11065871-11065893 GTGTGGCTGGAAAGGTAGGAAGG - Intergenic
1181503812 22:23337486-23337508 CTGTGGCCAGGAAGGCAAGAGGG + Intergenic
1181577448 22:23803935-23803957 ATGTAGACAGAAAGGTTAGAAGG + Intronic
1181654653 22:24287021-24287043 CTGTGGCCAGAAAGGTAAGAGGG + Intronic
1181708808 22:24667706-24667728 CTGTGGCCAGGAAGGCAAGAGGG + Intergenic
1182779540 22:32856815-32856837 CAGAGGCAAGAAAGGTAATAAGG - Intronic
1183237425 22:36630121-36630143 ATGTGGCCACAGAGGTAAGCAGG + Intronic
1183502845 22:38191402-38191424 CTGTGGCGAGACAGGGAGGAAGG - Intronic
1185358352 22:50388902-50388924 TTGTGGCCAGACAGGTAATAGGG + Intronic
949539298 3:5019939-5019961 CTGTGGCCAGAGAGGAAAGGGGG - Intergenic
949694646 3:6680662-6680684 CTGTGGCCAGAGAGAGAAAATGG + Intergenic
950118559 3:10467009-10467031 CTGAGGCCAAAAAGAGAAGAAGG - Intronic
950231108 3:11276629-11276651 ATGTGCCAAGAAAGATAAGAAGG - Intronic
950484480 3:13264989-13265011 CTGAGGGCAGAAGGATAAGAAGG + Intergenic
950706914 3:14788555-14788577 ATGTGGCCAGGGAGGTGAGATGG + Intergenic
951467237 3:23014502-23014524 CTGTGCTCAGAGAGGTATGAAGG + Intergenic
951819693 3:26794404-26794426 AGCTGGCCAGAAAGGAAAGATGG + Intergenic
953477862 3:43221266-43221288 CTGAGGCCAGAGAGGTCAGCAGG + Intergenic
953707812 3:45244475-45244497 GTGTGTCCAGAATGGTAATAGGG + Intergenic
955694032 3:61617639-61617661 CTCTGGCAAGGAAGGCAAGAGGG - Intronic
956724888 3:72148814-72148836 CTGTGGCCAGAAGGCGAAGGGGG + Intergenic
957552820 3:81729315-81729337 CAGTGGCCAGGAAGTTAAGAAGG + Intronic
957610042 3:82454009-82454031 CTGTGGACAGAAAGGAACAAAGG - Intergenic
958786115 3:98597949-98597971 ATGAGGCCAGAAAGGGATGAGGG + Intergenic
959700533 3:109294650-109294672 CTCTGTGCAGAAAGGGAAGAAGG - Intronic
959847526 3:111051715-111051737 AAGTGGCCAGAAAGGAAAAAGGG - Intergenic
961862973 3:129932482-129932504 GTGTGGTCTGAGAGGTAAGAAGG - Intergenic
962157512 3:132963900-132963922 CTGTGGCCAGAAGGGTGCCAGGG + Intergenic
963285306 3:143429521-143429543 CTGTGGTTAGAAAGGTAGCAGGG - Intronic
965024165 3:163277415-163277437 CAGTGGTCAGAAAGGTAACGGGG - Intergenic
965617653 3:170611425-170611447 ATGTGGTCAGAGAGGTAAGTTGG - Intronic
966342837 3:178944609-178944631 TTGTGCCCAGGAAGATAAGATGG + Intergenic
967178532 3:186883769-186883791 CTGATGCCAGGAAGGTAAAATGG - Intergenic
968172283 3:196520151-196520173 CTGTCCCCAGGATGGTAAGAAGG - Intergenic
968935488 4:3608013-3608035 CTGTGTCCAGCAAGGTCAGATGG - Intergenic
968959303 4:3734869-3734891 CTGTTGCCAGAAAGGAGGGAAGG + Intergenic
969334657 4:6500644-6500666 GTGTGACCAGGAAGGAAAGAGGG + Intronic
969566523 4:7982011-7982033 CTGGGGCCAGAGAGGGGAGAAGG - Intronic
970861559 4:20709207-20709229 CTGAGGCCAGGAAGGTAAAATGG - Intronic
970872276 4:20829534-20829556 TTGTGGCCTGAAAGCAAAGAAGG - Intronic
972248050 4:37267086-37267108 ATGTGGTCATAAAGGGAAGAAGG + Intronic
974351797 4:60757316-60757338 CTGTTGGTAGAAAGGTAAAATGG + Intergenic
974971972 4:68842083-68842105 CTGTTGCCTAAGAGGTAAGATGG + Intergenic
975867741 4:78742108-78742130 CTTTGGCCAGAAAGGTAACCAGG - Intergenic
976297891 4:83489917-83489939 CTGTGGCAGGGAAGGTTAGAGGG - Intronic
977210948 4:94217028-94217050 CTGTTGGCAGAAATGTAAAATGG - Intronic
978285334 4:107071679-107071701 CTGAAGCCAGAGAGGTAAGTGGG - Intronic
978879505 4:113684649-113684671 TTCTGGGCAGAAAGGCAAGATGG - Intronic
980770967 4:137372730-137372752 CTGAGGCCACACAGATAAGAAGG - Intergenic
981602527 4:146506641-146506663 GAGTGGCCTGAGAGGTAAGAAGG - Intronic
981907016 4:149932857-149932879 CTGTGGCCATAAATATGAGAAGG + Intergenic
982983622 4:162175234-162175256 CTGTTGGCAGAAATGTAAAATGG + Intergenic
983862756 4:172728275-172728297 CGGAGGCCAGGAAGGTAAAATGG - Intronic
987069340 5:14321314-14321336 CTGGTGCCAGCAAGGTAACATGG + Intronic
987107213 5:14651946-14651968 CTCTGCCCAGAAAGCTCAGATGG - Intergenic
987840490 5:23217240-23217262 CAGTAGCCAGAAAGTTAACATGG - Intergenic
989171292 5:38472266-38472288 CTGTTGTCAAAGAGGTAAGAAGG + Intergenic
991012069 5:61893807-61893829 CAGTGGCCAGAAAGGGAGAAAGG - Intergenic
991562133 5:67965068-67965090 CTGTGGCCAGAAGGCTCACAAGG - Intergenic
991621990 5:68554793-68554815 TTGTGGACAGAAATGTAAAATGG - Intergenic
992367392 5:76106528-76106550 ATGAGCCCAGAAATGTAAGAAGG - Intronic
992625015 5:78628787-78628809 TTGTGGCCATAAAGGGAAGAAGG + Intronic
992743033 5:79792972-79792994 CTGTGTCCAGTAAGGTCAGGAGG + Intronic
992865301 5:80951801-80951823 CTGTGGCCAGAAGGGGAAAAAGG + Intergenic
992914519 5:81434331-81434353 CTGTGGCTAGAGACCTAAGAGGG + Intronic
993915964 5:93742507-93742529 CTGTGTGCAGAAAGCTAAGGAGG + Intronic
997510709 5:134451903-134451925 CTGTGGCCAGCCAGGGAGGATGG + Intergenic
997736452 5:136215995-136216017 CTGTGGCCAGCAAGGCAACAGGG + Intronic
997871076 5:137505528-137505550 CTGTGGCCAGAAGGGTGAGTGGG - Intronic
997895023 5:137708740-137708762 CTATGGCCAGAGTGGTGAGAGGG + Intronic
998011802 5:138701380-138701402 CTGAGGCCTGAATGATAAGAAGG + Intronic
999409774 5:151340577-151340599 GAGTGGCTAGAAAGGTAGGAGGG + Intronic
1000546515 5:162610187-162610209 CTTTGTCTAGAAAGGTAAAATGG + Intergenic
1001206447 5:169768066-169768088 CTGTAGCAGGAAAGATAAGAAGG + Intronic
1001630007 5:173168019-173168041 GAGTTGCCAGAGAGGTAAGACGG - Intergenic
1002302573 5:178265745-178265767 GTGTGGTCAGAAAGGCAGGAAGG + Intronic
1003214327 6:4095221-4095243 CTGTGGCCACAGAGAAAAGAGGG - Intronic
1003237067 6:4304311-4304333 CTGTGGTCTGAGAGGTCAGAAGG + Intergenic
1004532469 6:16465980-16466002 CTGTGTCCAGGAAGCTGAGATGG + Intronic
1005936788 6:30529186-30529208 CTGTGGCCAGGAAGAAAACAAGG - Intergenic
1006913069 6:37576705-37576727 CTGTATCCAGATAGGTGAGAGGG + Intergenic
1007139137 6:39554257-39554279 GTGTGGCCAGTATGGTAGGAGGG - Intronic
1007172868 6:39876869-39876891 CTGGGGACAGGAAGGAAAGAGGG + Intronic
1008043423 6:46827380-46827402 CTCTGGAGAGAAAGGGAAGATGG - Intronic
1009318446 6:62254499-62254521 CTGAGGCAAGAATGATAAGATGG + Intronic
1009923249 6:70089613-70089635 CTGTGGACAGAATGGTAAGTTGG - Intronic
1012067090 6:94561430-94561452 CTGAGGCCACAGAGGTAGGAAGG - Intergenic
1013420521 6:109962589-109962611 CTGTGTTCAGAGAGGAAAGAGGG + Intergenic
1013855703 6:114569518-114569540 CTGTGGGTAGAAATGTAAAATGG - Intergenic
1014329136 6:120037968-120037990 CTGTGGCAAGAACTGTAACATGG + Intergenic
1015653492 6:135490940-135490962 GAGTGGCCAAAAAGGTCAGAGGG - Intronic
1016060659 6:139626562-139626584 CTTTGGCAAGAAAAGAAAGATGG + Intergenic
1016089244 6:139955771-139955793 CTATAGCCAGAAAAGTAAGCAGG - Intergenic
1017123302 6:151044243-151044265 CTCTGCCCAGAAAGGGCAGAGGG - Intronic
1017606354 6:156138593-156138615 CTGTTGGCAGAAATGTAAAATGG - Intergenic
1019444999 7:1066608-1066630 CCGTGGACAGACAGGTAGGAGGG - Intronic
1020673666 7:11152968-11152990 GTGAGGCCGGAAAGGTCAGAAGG + Intronic
1021508899 7:21414162-21414184 ATAAGGTCAGAAAGGTAAGAAGG - Intergenic
1021915297 7:25425710-25425732 CTGTGGCCCGAAGGGCAAGCTGG - Intergenic
1022308486 7:29173223-29173245 CTAAGGCCAGAAAGCTAAGCAGG + Intronic
1024127721 7:46317730-46317752 CTGTGGCTGGAAACGTAGGATGG + Intergenic
1024661767 7:51502111-51502133 CTGTGGCCAAAAAAGAAAGTTGG + Intergenic
1024722537 7:52153561-52153583 CTGTTTCCAGAAAGTTAAGGAGG + Intergenic
1024996308 7:55275414-55275436 GTGTGGCCAGAAAAGGAACAAGG + Intergenic
1025119295 7:56286690-56286712 CTGTTGGCAGAAATGTAAAATGG + Intergenic
1027761308 7:82282501-82282523 CTGTGGGCAGGAAGGTTAGCAGG + Intronic
1028213758 7:88106887-88106909 ATGTGCCTGGAAAGGTAAGAAGG - Intronic
1029700349 7:102242512-102242534 CTGTGGCTAGAAAGTAGAGATGG - Intronic
1029728639 7:102425151-102425173 CTGTGACCAGAAGGGAAAGGCGG + Exonic
1030296294 7:107931888-107931910 CTGGAGTCAGAAAAGTAAGATGG + Intronic
1030524309 7:110635199-110635221 CTGTGGGCACATAGGTAGGATGG - Intergenic
1030772540 7:113492145-113492167 GTGTGGCAAGAAAGGGAAAAGGG - Intergenic
1031312211 7:120212539-120212561 CTATGTCCAGAATGGTCAGATGG - Intergenic
1032404932 7:131649179-131649201 CTGAGGCTAGAAAGGCAGGAAGG + Intergenic
1032713455 7:134483341-134483363 ATATGGCCAGAAAGGTAAACTGG + Intergenic
1032727798 7:134607246-134607268 CAATGGCAGGAAAGGTAAGAAGG - Intergenic
1033128049 7:138721943-138721965 CTCTGGCCAGAACGGCTAGAAGG + Exonic
1034524114 7:151644777-151644799 CTTTGGGCAGAAATGTAAAATGG - Intronic
1034866454 7:154646479-154646501 CTGTGGCTTGAAGGGTCAGAAGG - Intronic
1036693043 8:10956763-10956785 CTGTGGCCAGTGAGGACAGAAGG + Intronic
1036702584 8:11022961-11022983 CTGTGGCCAGGAAGGGAGGGAGG - Intronic
1036954758 8:13175851-13175873 CTGTGACCAGGAAGGAAAGCAGG - Intronic
1037445312 8:18959598-18959620 GTGTGGGCAGAAAGGCAAGGTGG - Intronic
1037466054 8:19161781-19161803 CTGTGGCCAGAGAGGCAGAAGGG + Intergenic
1037552011 8:19983834-19983856 CTGTCTCCAGATAGGTAAGGTGG + Intergenic
1038919894 8:32071060-32071082 CTGAGGGCAGAAGGATAAGAAGG - Intronic
1039715841 8:40107867-40107889 CTGTGACCTGAAAGGAGAGATGG - Intergenic
1040025393 8:42777141-42777163 CTGTGCCCAGCAAGGTAGCAGGG - Intronic
1042335738 8:67628532-67628554 CAGTGGCTACAAAGGGAAGATGG - Intronic
1043885700 8:85597290-85597312 ATAAGGCCAGAGAGGTAAGACGG - Intergenic
1044721905 8:95159291-95159313 CTGTGGCAAAAAAGTAAAGAAGG - Intergenic
1045248111 8:100460718-100460740 CTGGAGACAGAAAGGTAAGTAGG + Intergenic
1045606078 8:103778410-103778432 CAGAGGCCAGAAAGGGCAGAGGG - Intronic
1045776395 8:105808167-105808189 GTGTGGCTAGAAGGATAAGATGG - Intergenic
1046979202 8:120318361-120318383 CTGGGGCCAGAAAGACAAAAGGG + Intronic
1047214785 8:122867315-122867337 CTGTGGACTGAATGGTAAGAAGG - Intronic
1048509631 8:135050519-135050541 CTCAGGCCACAAAGGTAAGAAGG - Intergenic
1049871257 8:144979358-144979380 CTGAGGTCAGAACAGTAAGAGGG + Intergenic
1050762483 9:9089460-9089482 CTTTGGTCAGAAAGGTTAAATGG - Intronic
1054454695 9:65423843-65423865 CTGTGTCCAGCGAGGTCAGATGG + Intergenic
1056046156 9:82719228-82719250 CTGTGGACAGAAAGTTGAGATGG + Intergenic
1056251412 9:84752072-84752094 GTTTGGCATGAAAGGTAAGAAGG + Exonic
1057276489 9:93678428-93678450 GTGTGGCCAGCAGGGCAAGACGG - Exonic
1057281165 9:93712696-93712718 CTGTGGCCTGAAGGGCATGATGG + Intergenic
1057294983 9:93829669-93829691 CTGGGGCCAGAGAGAAAAGAGGG - Intergenic
1057371569 9:94479282-94479304 GTGTGGCCAAAGTGGTAAGATGG + Intergenic
1059600731 9:115775397-115775419 CTGGGGACAGAAAGATAGGATGG + Intergenic
1060385826 9:123227426-123227448 ATGTGGTCAGAGAGGTAACAGGG + Intronic
1060965682 9:127711208-127711230 GTCTGGCCAGAAAGGTGGGAGGG - Exonic
1062571946 9:137189784-137189806 CTGGGGCCAGAGAAGTGAGAAGG - Intronic
1186334302 X:8570195-8570217 CTATGGCCAGACAGGTAAGATGG + Intronic
1186986708 X:15024225-15024247 CTGAGACCTGAAAGGTAACAAGG - Intergenic
1187410644 X:19048025-19048047 CTTTGGCCAGAACGGGAAGAAGG + Intronic
1187768602 X:22670455-22670477 CTGTGTCCTCAAAGGTAACATGG - Intergenic
1189903151 X:45729178-45729200 CTGTGGCCACAAACATAAGACGG + Intergenic
1190014721 X:46817133-46817155 CTGTGGACAGGAAGGCAGGAAGG + Intergenic
1192338362 X:70240416-70240438 CTGTGGCAAGAAGGCAAAGAAGG - Exonic
1192554412 X:72078538-72078560 CTGTGGTTAGAGAGGAAAGAGGG - Intergenic
1194083927 X:89502633-89502655 CTGTGTCCCCAAAGGGAAGAAGG - Intergenic
1194311558 X:92315456-92315478 CTGAGGCCAGAGAAGTGAGATGG - Intronic
1196048702 X:111282496-111282518 CTGTGTGCAGAAGGGCAAGATGG - Intergenic
1197703849 X:129619549-129619571 CTTTGGCCAGGAAGGAAAGAAGG - Intergenic
1198002739 X:132456079-132456101 CTGTGGCCAGGAGGGTCAGATGG - Intronic
1198137837 X:133771795-133771817 CTCTGGGCAGAGAGGGAAGAAGG + Intronic
1198499235 X:137226205-137226227 AAGTGGCCAGGAAGGGAAGAAGG - Intergenic
1199239655 X:145531407-145531429 ATGTGGCTAGAAAGGTAAGTTGG + Intergenic
1199260727 X:145771257-145771279 ATGTGGCAAGTAAGGTAAGGAGG - Intergenic
1200436574 Y:3158513-3158535 CTGTGTCCCCAAAGGGAAGAAGG - Intergenic
1200619833 Y:5429590-5429612 CTGAGGCCAGAGAAGTGAGATGG - Intronic