ID: 1181656016

View in Genome Browser
Species Human (GRCh38)
Location 22:24299517-24299539
Sequence GCTGAGATGCAGACTGTTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 2, 2: 1, 3: 17, 4: 163}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181656016_1181656018 16 Left 1181656016 22:24299517-24299539 CCTTGAACAGTCTGCATCTCAGC 0: 1
1: 2
2: 1
3: 17
4: 163
Right 1181656018 22:24299556-24299578 CTGTGTTTCTTTTCTCCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181656016 Original CRISPR GCTGAGATGCAGACTGTTCA AGG (reversed) Intronic
900717867 1:4156765-4156787 GCTGAGATGCAGACTGACCAGGG - Intergenic
902930153 1:19725542-19725564 GCTCAGATGCTGGCTGTTCCTGG + Intronic
904710356 1:32425517-32425539 GCTGAGCTGCGGCCTGTTCCTGG + Intergenic
905019402 1:34798027-34798049 GCTGTGAGGGAGACTGTTCCAGG + Intronic
910405211 1:86881839-86881861 GCTTTAATGCAGGCTGTTCATGG + Intronic
912640670 1:111342587-111342609 GCTGAGTTACAGAGTTTTCAGGG + Intergenic
914247015 1:145893721-145893743 GCTGAGAGGCATAATGTTGAGGG + Intronic
914286977 1:146236204-146236226 ACTGAGATCCAGACTGTGCCAGG - Intergenic
914548010 1:148686946-148686968 ACTGAGATCCAGACTGTGCCAGG - Intergenic
915972863 1:160366627-160366649 CCTGAGAGGGAGACTCTTCAAGG - Intergenic
917666666 1:177231672-177231694 GCTTAGATGCAGTCTGGTCCTGG + Intronic
1063720237 10:8573342-8573364 GCAGAGATCCAGAGTGCTCATGG - Intergenic
1065326897 10:24557292-24557314 CCTGAGATGCAGCCTCTTAAAGG - Intergenic
1066476666 10:35753545-35753567 GCTGAGAGGCAGTCTTTCCAGGG + Intergenic
1068025748 10:51641519-51641541 GCCAAGATGGAGACTGTTTAGGG - Intronic
1068939180 10:62664177-62664199 GTTAAGAAGCAGACTGTGCAGGG + Intronic
1072039956 10:91597585-91597607 ACAGAGATACAGACTGTTAATGG - Intergenic
1073442361 10:103559629-103559651 GCTGAGATGCAGACAGATGAAGG - Intronic
1074066162 10:110016055-110016077 CCTGAAATGCTGACTGGTCAAGG - Intronic
1076123404 10:127954187-127954209 GCAGGGATGGAGGCTGTTCATGG + Intronic
1076992809 11:284540-284562 GCTGAGATCCAGGGTGGTCAGGG - Exonic
1078338663 11:10483631-10483653 TGTGAGATGCAGGCAGTTCAAGG - Intronic
1078368706 11:10727518-10727540 GCTGAGATACAGACTCATGATGG + Intergenic
1079347450 11:19665364-19665386 GCTGAGAAGCAGATGGTGCATGG + Intronic
1086906083 11:92419414-92419436 GCATAGATCCAGACTATTCATGG + Intronic
1087056846 11:93945167-93945189 ACTGAGATCCAGACTGTGCCAGG + Intergenic
1087194722 11:95293761-95293783 GGTGAGATGCAGCATGTTCAGGG + Intergenic
1088878046 11:113952068-113952090 GCTGAGATGGAGTCTGATCGAGG - Intergenic
1090950974 11:131473161-131473183 GGTGAGAGGCTCACTGTTCAAGG - Intronic
1091596783 12:1883710-1883732 GGAGAGACACAGACTGTTCAGGG - Intronic
1098088197 12:66871183-66871205 TCTGGAATGCAGACTGTTGAAGG + Intergenic
1102429208 12:112868543-112868565 GCTCAGGAGCAGGCTGTTCAGGG - Exonic
1103328647 12:120138438-120138460 GCAGAGATGCAGATTCCTCAGGG - Intronic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1106416942 13:29553742-29553764 GCTGACAGGCAGACTGTACCTGG + Exonic
1106693185 13:32141856-32141878 GGTGAGATGCAGAGGGTCCAGGG + Intronic
1108027801 13:46196799-46196821 GGTGGGATGCAGATTGTCCAAGG - Intronic
1108595030 13:51942276-51942298 GCTGTGCGGCAGACGGTTCATGG - Intronic
1108956738 13:56167343-56167365 TCTAAGATGCAAAATGTTCAAGG - Intergenic
1110020441 13:70462664-70462686 GCTGATATCCAGAATGTACAAGG + Intergenic
1112071021 13:95850574-95850596 GCAGAGATGGAGACTGTGTACGG + Intronic
1112685979 13:101827694-101827716 TATGAGATTCAGACTATTCATGG + Intronic
1118744051 14:68761461-68761483 GCTGAGCTGCAGCTTGTCCAGGG - Intergenic
1119448544 14:74687900-74687922 ACTCCCATGCAGACTGTTCAGGG - Intronic
1120024781 14:79570548-79570570 CCTGAGATGCTGACTGTGCAAGG + Intronic
1121932678 14:97987284-97987306 GCTATGATGAAGACTGTTTAAGG - Intergenic
1122405500 14:101498422-101498444 GCTGAGATGGAGACGGTGCGAGG - Intergenic
1123954931 15:25325324-25325346 TTTCAGATGCAGACTGTTCTTGG + Intergenic
1127545751 15:59993369-59993391 GGAGAGAAGCAGACTCTTCACGG - Intergenic
1133889169 16:9862446-9862468 GCAGAGATGCGGGTTGTTCATGG - Intronic
1133932672 16:10244957-10244979 GCTGGGCTGCAGACTGGTGAAGG + Intergenic
1135526003 16:23214170-23214192 ACTGAGATGCAGATTGGTTAAGG - Intronic
1135705155 16:24668626-24668648 GCAGAGATGCAGTCTGCTCTAGG + Intergenic
1139349531 16:66326576-66326598 GCTGACAGGCAGAATGGTCAAGG - Intergenic
1139483489 16:67243866-67243888 GCTGAGCTGCAGACTGGTGAGGG - Intronic
1139594257 16:67948889-67948911 GCTGGGATGGAGCCTGCTCAGGG + Intronic
1139600471 16:67983520-67983542 AATGAGATGCAAACTGATCAGGG - Intergenic
1140709175 16:77660534-77660556 ATTGAGAAGCAGACTCTTCAAGG + Intergenic
1142769847 17:2088743-2088765 ACTGAGAGGCAGAATGTCCAGGG + Intronic
1145870875 17:28271986-28272008 GCAGAGAGGCAGCCTGTTCCTGG + Intergenic
1146086522 17:29835515-29835537 GCTGAGCAGAAGACTGCTCATGG - Intronic
1147922385 17:43925881-43925903 GCTGAGCTGCAGCCTGTTCCTGG + Intergenic
1148061307 17:44838413-44838435 GCTGAGCTGCATACTTTTGATGG + Intergenic
1149403277 17:56321035-56321057 GAAAAGATGCAGACTGCTCACGG - Intronic
1156250783 18:35350724-35350746 GGGGAGATGTAGAGTGTTCATGG - Intergenic
1157196472 18:45624069-45624091 GCTGGGATGCACACAGCTCATGG + Intronic
1157872706 18:51245275-51245297 GCTGAGATTCCCTCTGTTCAGGG - Intergenic
1157928212 18:51789709-51789731 GCTGAAAGACAGACTGTGCATGG + Intergenic
1158672158 18:59486112-59486134 GCTGAGCTTCAGACTCCTCATGG + Intronic
1162725013 19:12684991-12685013 GCTGAGATGCAGAAAGATCAGGG - Intergenic
1168684543 19:58340236-58340258 GCTGAGATGCAGGCTGCTCTGGG + Exonic
926283854 2:11471963-11471985 GATGAGATGCAGACAGCTAATGG + Intergenic
926292627 2:11542701-11542723 GCTGAGCAGCAGTGTGTTCATGG + Intronic
926712648 2:15894290-15894312 GCTGAGGTGCAGACTGGGGAGGG - Intergenic
927214190 2:20657526-20657548 GCTCAGATGGAGACTGGTGATGG + Intergenic
927319365 2:21724530-21724552 TCTGAGATCCAGATGGTTCAAGG + Intergenic
927744560 2:25605275-25605297 GCTGTGATACAGACTGTGCTGGG - Intronic
928270656 2:29851897-29851919 GCCAAGATGCAGAATGTCCAAGG + Intronic
929872400 2:45770233-45770255 GGTCAAATGCAGACTGGTCAGGG + Intronic
931482972 2:62661241-62661263 GCTCAGATGCACAATTTTCATGG - Intergenic
936562334 2:113551826-113551848 GCTGAGGTGGCGACTGTTGAAGG + Intergenic
939569647 2:143825477-143825499 GCTGAGATGCAAGCTGATCTAGG - Intergenic
942728650 2:179038974-179038996 GGTGAGGTGCAGAGTGTTAAAGG - Intronic
943706280 2:191038259-191038281 GCAGAGAGGAAGACTGTGCAGGG - Intronic
946163647 2:217850545-217850567 GCTGGGCTGCTGACTGTACAGGG - Intronic
947477381 2:230462479-230462501 GCTGAGATGAAGACTTCTAAGGG - Exonic
948171696 2:235908738-235908760 GATTACATGCAGAATGTTCATGG + Exonic
1170032083 20:11954566-11954588 GCTTAGATGCAAGTTGTTCAAGG - Intergenic
1170119260 20:12894135-12894157 GCTGATATGCAGAGTGCTGAGGG - Intergenic
1171191186 20:23160933-23160955 GCTGAGATGGGGCATGTTCAGGG + Intergenic
1172477406 20:35249126-35249148 CCTGAGATGGGGAGTGTTCAGGG + Intronic
1173853669 20:46235581-46235603 GCTGAGATGGGGACTGCTCCAGG - Intronic
1176364622 21:6025403-6025425 GCTCAGGTGCAGCCTGTCCAAGG - Intergenic
1178943532 21:36927205-36927227 GCTGAGATGCAGGCTGTGGGCGG - Intronic
1179758896 21:43513142-43513164 GCTCAGGTGCAGCCTGTCCAAGG + Intergenic
1180220324 21:46354509-46354531 TCTGGGATGTAGACTGTTCTGGG + Intronic
1181444363 22:22957369-22957391 GCTGAGATTCAGACTTTTCCAGG - Intergenic
1181504902 22:23346896-23346918 GCTGAGATGCAGACTGCTCAAGG - Intergenic
1181656016 22:24299517-24299539 GCTGAGATGCAGACTGTTCAAGG - Intronic
1181709890 22:24677143-24677165 GCTGAGATGCAGACTGCTCAAGG - Intergenic
1181925981 22:26359011-26359033 GCTAAGGTCCAGACTGTTTATGG + Intronic
1183526517 22:38326276-38326298 GCTGAAATTCAGACTGACCAGGG - Intronic
1184606776 22:45578916-45578938 GCTGAGATGCAAAGTCCTCAGGG - Intronic
949230639 3:1745928-1745950 GCTGTGATGAAGACTGTTCCAGG + Intergenic
950913732 3:16621478-16621500 GCAGATCTGCAGACTGTCCAGGG - Intronic
951657395 3:25025020-25025042 GATGAGATTGAGAGTGTTCAGGG - Intergenic
953186442 3:40642355-40642377 GCTGAGGTGCAGGTTGTTCTGGG + Intergenic
954803323 3:53200248-53200270 GATGACATGCAAAATGTTCATGG - Intergenic
954947663 3:54440427-54440449 TCTGAATTGCAGACTTTTCAAGG + Intronic
957002853 3:74906874-74906896 GCTGAGATGCCCAGTGTTCTAGG + Intergenic
959146085 3:102546567-102546589 GCTGAGATGCAGGCAGGTCTGGG + Intergenic
966986624 3:185186235-185186257 TCTGAGATGCAGCCTGTTGAGGG + Intergenic
967788428 3:193522088-193522110 GCTGAGCTGCAGTCTGATTATGG + Intronic
969284620 4:6195102-6195124 CCTGAGTTGCAGAGGGTTCAGGG + Intronic
970360041 4:15300114-15300136 ACTGACAGGCAGACTGATCACGG - Intergenic
970440784 4:16079631-16079653 GTTGAAATGCAGACTATTAATGG + Intronic
970743880 4:19271371-19271393 GCTAATATGCAGAATCTTCAAGG + Intergenic
971368772 4:25998610-25998632 TCTGAGATTCAGAATGTTCTAGG + Intergenic
979716952 4:123851454-123851476 GCTCTGATGCAGACTGTCCCAGG + Intergenic
980788869 4:137592530-137592552 GCAGAGTTGCAGACTGATAATGG + Intergenic
982285852 4:153733678-153733700 GGAGAAATGCAGACTGTGCAAGG - Intronic
982786833 4:159545986-159546008 GCAGAGATGGAGGCTATTCATGG - Intergenic
983514344 4:168640828-168640850 GCTGAAATACAGAAAGTTCAAGG - Intronic
983979917 4:173983059-173983081 GCTCAGATTCACATTGTTCAAGG + Intergenic
985010124 4:185573712-185573734 CCTGAGGTGCAGACTGCTCTTGG - Intergenic
986359199 5:6959625-6959647 GCTGAGCTGCAGAGTGTCCTAGG + Intergenic
987235937 5:15941684-15941706 TCTGAGATGCAGACACTTCCTGG - Intergenic
987367750 5:17164390-17164412 GCTTAGATGCAAACGTTTCATGG - Intronic
990025844 5:51187605-51187627 GGTGAGCTGCAGTCTGTTTATGG + Intergenic
995251307 5:109996210-109996232 TCTGTGATGCATACTCTTCAGGG - Intergenic
996535506 5:124573085-124573107 TCTCCGTTGCAGACTGTTCAAGG - Intergenic
997528736 5:134569565-134569587 GCTGACAAGCAGGCTGTGCAGGG + Intronic
1000101780 5:158023612-158023634 GCTGAGATGAAGAATGAGCAGGG + Intergenic
1000204725 5:159047929-159047951 TCTGAAATGCAGACAGTTCTGGG - Intronic
1000642971 5:163726671-163726693 GATAAGTTGCATACTGTTCAGGG + Intergenic
1002206890 5:177569146-177569168 CCTGAGTTGCAGACAGTGCAGGG - Intergenic
1004504672 6:16238471-16238493 GTTGAGAGGCAGACTGGTTAGGG - Intergenic
1006809769 6:36812305-36812327 GCTGATGTGGAGACTGTACAGGG + Intronic
1006964353 6:37967399-37967421 GCTGGGATGCAGAAAGTACAAGG - Intronic
1011939117 6:92820640-92820662 GCAGAGATGCAAACTGTGCCAGG - Intergenic
1013026013 6:106272381-106272403 GCAGAGACGCTGCCTGTTCAGGG - Intronic
1013967460 6:115972059-115972081 GCTAAGATGCAGACATTTCTAGG + Intronic
1017396329 6:154003315-154003337 GCTGAGATGCATTCAGTTTAAGG + Intergenic
1018300808 6:162400795-162400817 CCTGATATGCAGTCTCTTCAAGG - Intronic
1018422889 6:163654646-163654668 GCAGAGATGGAGACTATGCATGG - Intergenic
1018726734 6:166618457-166618479 ACTGAGGGGCAGACAGTTCAGGG + Intronic
1021387586 7:20050798-20050820 GCTGAGAGGCAGACTGTAGAAGG - Intergenic
1022630259 7:32077991-32078013 TCTGAGAGGCAGAATGTCCACGG - Intronic
1024607108 7:51031055-51031077 ACGGAGACGCAGATTGTTCATGG + Intronic
1028341082 7:89720237-89720259 GCAGAGATTCAGATTGTTCATGG - Intergenic
1028714109 7:93944411-93944433 GCTAGAACGCAGACTGTTCAAGG + Intergenic
1029873265 7:103718612-103718634 GATGTGATGCAGACATTTCATGG - Intronic
1034272762 7:149811348-149811370 GCTGCAAGGGAGACTGTTCAAGG + Intergenic
1035445218 7:158936648-158936670 GCTGAGGTGCAGAATTTTCAGGG - Intronic
1035814874 8:2528289-2528311 GCTGAGATGAAGACAGATCCGGG - Intergenic
1043466326 8:80511405-80511427 TCTGAAATGCAGTCTGTTCAAGG - Intronic
1047828766 8:128608963-128608985 GTTGATATCCTGACTGTTCATGG - Intergenic
1048268768 8:133011266-133011288 GTTGGGATGCAGGCTGTCCATGG + Intronic
1049052026 8:140205766-140205788 GCTGAGATGGAGACTGTAGGAGG - Intronic
1049495104 8:142926375-142926397 GCTGAGGTGCAGACTCAGCAGGG - Intergenic
1049890350 9:63506-63528 GCTGAGGTGGCGACTGTTGAAGG - Intergenic
1051437593 9:17049332-17049354 GCTGAGATGTACACTGTCTAAGG - Intergenic
1051973414 9:22919373-22919395 GCTGTGATGCAGACTGTCAATGG - Intergenic
1053647107 9:40130084-40130106 GCTGAGATGGAAAGGGTTCAGGG + Intergenic
1053758617 9:41333759-41333781 GCTGAGATGGAAAGGGTTCAGGG - Intergenic
1054537472 9:66246086-66246108 GCTGAGATGGAAAGGGTTCAGGG - Intergenic
1054696645 9:68367029-68367051 GCTGAGGTGGCGACTGTTGAAGG + Intronic
1055151684 9:73008269-73008291 GCTGAGATCCACACAGCTCAGGG + Intronic
1055440037 9:76328219-76328241 ACTGAGAAGAAGGCTGTTCATGG - Exonic
1058936506 9:109774084-109774106 GCTGACTTGCAGAATGTACACGG + Intronic
1061897055 9:133653688-133653710 GCTGGACTGCAGACAGTTCAAGG + Intronic
1062044107 9:134417327-134417349 GGTGAGTTGCAGCCTGTGCAGGG + Exonic
1062209008 9:135353207-135353229 GGAGAGCTGCAGACTGCTCACGG + Intergenic
1062367106 9:136215956-136215978 GCTGAGAAGCAGACGGTGCCGGG - Intronic
1194703687 X:97148132-97148154 ACTGAGATGCAGAATGATAAAGG + Intronic
1196046054 X:111257706-111257728 GCTGAGATGCAGAGTGCAGATGG + Intronic
1197881483 X:131171274-131171296 GCTGACAAGCAAACTGATCAAGG - Intergenic
1198219641 X:134587610-134587632 GTTAAGATGCAGACTGCTCTAGG + Intronic
1198413095 X:136391339-136391361 GCTGAGATGCTGCCTGTTCTGGG - Intronic
1198698702 X:139372931-139372953 GCTGATATCCAGAATGTACAAGG - Intergenic
1199859651 X:151789811-151789833 GCTGAGTCCCAGACTGGTCATGG + Intergenic
1201714845 Y:17033240-17033262 CCTGAGATGCAGTCTCTTCAAGG + Intergenic
1201786688 Y:17790717-17790739 ACTGAGATCAACACTGTTCAAGG - Intergenic
1201814865 Y:18115271-18115293 ACTGAGATCAACACTGTTCAAGG + Intergenic