ID: 1181661456

View in Genome Browser
Species Human (GRCh38)
Location 22:24352910-24352932
Sequence GAATCTAGGCTGTAAGTAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181661456 Original CRISPR GAATCTAGGCTGTAAGTAAG TGG (reversed) Intronic