ID: 1181661720

View in Genome Browser
Species Human (GRCh38)
Location 22:24355309-24355331
Sequence CACATTTAGCACCTGGATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 352
Summary {0: 1, 1: 1, 2: 2, 3: 38, 4: 310}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181661720_1181661727 30 Left 1181661720 22:24355309-24355331 CCAAGATCCAGGTGCTAAATGTG 0: 1
1: 1
2: 2
3: 38
4: 310
Right 1181661727 22:24355362-24355384 GTCCCTCTCTGGATAGAACTAGG 0: 1
1: 0
2: 1
3: 4
4: 97
1181661720_1181661724 -7 Left 1181661720 22:24355309-24355331 CCAAGATCCAGGTGCTAAATGTG 0: 1
1: 1
2: 2
3: 38
4: 310
Right 1181661724 22:24355325-24355347 AAATGTGCTCATTGCTACTGGGG 0: 1
1: 5
2: 50
3: 134
4: 499
1181661720_1181661722 -9 Left 1181661720 22:24355309-24355331 CCAAGATCCAGGTGCTAAATGTG 0: 1
1: 1
2: 2
3: 38
4: 310
Right 1181661722 22:24355323-24355345 CTAAATGTGCTCATTGCTACTGG 0: 2
1: 17
2: 65
3: 194
4: 475
1181661720_1181661723 -8 Left 1181661720 22:24355309-24355331 CCAAGATCCAGGTGCTAAATGTG 0: 1
1: 1
2: 2
3: 38
4: 310
Right 1181661723 22:24355324-24355346 TAAATGTGCTCATTGCTACTGGG 0: 2
1: 19
2: 66
3: 216
4: 531
1181661720_1181661725 19 Left 1181661720 22:24355309-24355331 CCAAGATCCAGGTGCTAAATGTG 0: 1
1: 1
2: 2
3: 38
4: 310
Right 1181661725 22:24355351-24355373 CACAGCCTTTAGTCCCTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181661720 Original CRISPR CACATTTAGCACCTGGATCT TGG (reversed) Intronic
901588372 1:10317490-10317512 CATACTTAGCACCTAGATCTTGG - Intronic
903784237 1:25847144-25847166 TACATTTAGCAGCTGGAAATTGG - Intronic
905011207 1:34748128-34748150 CACTTTTAGCACCTGGAGCCTGG - Intronic
905744992 1:40408004-40408026 CAACTTTAGCAACTGGATTTGGG - Intronic
907760006 1:57348476-57348498 CACAGTTAGCATCTGGTACTGGG - Intronic
908676462 1:66609862-66609884 CAGATTTGGCATTTGGATCTTGG + Intronic
910735014 1:90444071-90444093 CACACTTAGTACCCAGATCTTGG + Intergenic
911286835 1:96005088-96005110 CACAGACAGCACCTAGATCTTGG - Intergenic
911503524 1:98719175-98719197 CACATTTAGCACTATGAGCTAGG - Intronic
913714981 1:121524383-121524405 TATATTTAGCACCCAGATCTTGG + Intergenic
914257572 1:145973160-145973182 CACACCTAGCACCCAGATCTTGG - Intronic
916324390 1:163540650-163540672 CACATCTTGCACATGCATCTGGG + Intergenic
917658716 1:177155931-177155953 CACACTTAGTTCCCGGATCTTGG + Intronic
918404300 1:184196166-184196188 CACATTCTGCACATGGATCCTGG + Intergenic
918792896 1:188853525-188853547 CACACTTAGCACCCAGATCTTGG - Intergenic
919290906 1:195629081-195629103 CACTTCTAGAACCTGGATGTTGG - Intergenic
924389813 1:243541572-243541594 CACATCTAGCAGCCAGATCTGGG - Intronic
1063293509 10:4776927-4776949 CATACCTAGCACCTAGATCTTGG + Intergenic
1064045307 10:12008704-12008726 CACATTCTGCACATGTATCTTGG - Intronic
1064436508 10:15315573-15315595 CAGACTTAGCACTTGTATCTGGG + Intronic
1065464499 10:26004540-26004562 CACATCTAGCACCTAGCTTTTGG + Intronic
1065649135 10:27868804-27868826 CACATTCTGCACATGTATCTTGG + Intronic
1065686190 10:28287392-28287414 CACGTTTATCACCTGGATTGTGG + Intronic
1067487693 10:46666931-46666953 TACACCTAGCACCTAGATCTTGG + Intergenic
1067520780 10:47001717-47001739 AACATTTAGAAACTGGATTTGGG + Intronic
1067607113 10:47675071-47675093 TACACCTAGCACCTAGATCTTGG - Intergenic
1068117641 10:52751965-52751987 CAGATTTAGCCCATGGCTCTGGG + Intergenic
1068329389 10:55541816-55541838 CAAAGTTAGCACCAGAATCTAGG + Intronic
1068369040 10:56090253-56090275 CACATTTTGCACATGTATCCTGG + Intergenic
1068564556 10:58558764-58558786 TACTGTTAGCACCTTGATCTTGG - Intronic
1068721592 10:60251923-60251945 CTCATTTCACACCTGCATCTGGG + Intronic
1069027876 10:63563341-63563363 CACACTTAGCTCCCAGATCTTGG + Intronic
1069385810 10:67882809-67882831 CACATTCTGCACCTGTATCCTGG - Intergenic
1069951182 10:72019316-72019338 AACCTGCAGCACCTGGATCTTGG + Intergenic
1070530123 10:77329507-77329529 ATCAGTTAGCACCTTGATCTTGG + Intronic
1070864032 10:79695089-79695111 CACCTTTAGAACCTGGGCCTGGG - Intergenic
1071221661 10:83474275-83474297 CACATTCAGCACCTGAACCATGG + Intergenic
1071493225 10:86150877-86150899 CAGATCCAGCACCTTGATCTTGG + Intronic
1071630929 10:87217315-87217337 CACCTTTAGAACCTGGGCCTGGG - Intergenic
1071775650 10:88784956-88784978 CAAAATTAGCCCTTGGATCTTGG + Intergenic
1076186086 10:128450492-128450514 CAGCTTTAGCACCTGGAGCACGG + Intergenic
1076310020 10:129498810-129498832 CACACTCAGCACCCAGATCTTGG - Intronic
1077393590 11:2310696-2310718 CCCATGCAGCCCCTGGATCTTGG - Intronic
1077972358 11:7207753-7207775 AACATGTAGTACCTGTATCTTGG + Intergenic
1078635937 11:13050094-13050116 CACACTTAGCGCCCAGATCTTGG - Intergenic
1079599850 11:22298074-22298096 GACATGTAGCACCCAGATCTTGG + Intergenic
1079686724 11:23368044-23368066 CACATTCTGCACATGTATCTTGG + Intergenic
1079990798 11:27244396-27244418 CACTCTTAGCACCCAGATCTTGG + Intergenic
1080844264 11:36013318-36013340 CACATTCTGCACATGTATCTCGG - Intronic
1080851706 11:36076074-36076096 CACACCTAGCACCCAGATCTTGG - Intronic
1081074451 11:38652564-38652586 AACATTTAGCATCTGTGTCTTGG + Intergenic
1082704447 11:56476566-56476588 CACACTTATCACTTGGTTCTAGG + Intergenic
1082927366 11:58564160-58564182 GACATTGAGCTCCTGGATATTGG + Exonic
1083649920 11:64196730-64196752 CAAATTTAGCACCTTGAAATGGG + Intronic
1086984123 11:93229924-93229946 CACTCCTAGCACCTAGATCTTGG - Intergenic
1087792634 11:102423049-102423071 CACCTTTAGCAGCTTGAGCTAGG - Intronic
1088418168 11:109612687-109612709 CACATTAAGCAGCTGGTTGTGGG + Intergenic
1088617746 11:111648341-111648363 CACCATTGGCACCTTGATCTAGG - Intronic
1088774057 11:113064979-113065001 CACATCTAGCACCCATATCTTGG + Intronic
1090730523 11:129569807-129569829 CACACTTAGCACCCAGATCTTGG + Intergenic
1091090423 11:132765796-132765818 AACAGCTAGCACCTTGATCTTGG + Intronic
1091769790 12:3143905-3143927 CGCACCTAGCACCTAGATCTTGG - Intronic
1092329040 12:7565857-7565879 CACATTCTGCACATGTATCTGGG + Intergenic
1092535347 12:9381393-9381415 CACATTCAGCTCCCGGTTCTTGG + Intergenic
1093164069 12:15785648-15785670 CACACCTAGCACCCAGATCTTGG + Intronic
1093800747 12:23369374-23369396 CACATTTATCTCCCAGATCTTGG + Intergenic
1093806588 12:23440380-23440402 CACATTCAGCACTTGTATCCCGG + Intergenic
1093864040 12:24203404-24203426 CACATTTGGTACCTAGTTCTTGG - Intergenic
1095166032 12:38973104-38973126 CACACTTAGCACTCAGATCTTGG - Intergenic
1095199645 12:39368336-39368358 CACATTTGGCACATGTTTCTAGG - Intronic
1095701804 12:45198270-45198292 TACGTTTAGCACCCAGATCTTGG - Intergenic
1095753936 12:45741804-45741826 CACACCTATCACCTCGATCTTGG - Intronic
1096040683 12:48513647-48513669 CACATCTAGCACCCAAATCTTGG + Intronic
1096564044 12:52461176-52461198 CACATCTTGTACCTAGATCTTGG - Intergenic
1097230781 12:57509319-57509341 CACATCTACCACCTAGATTTTGG - Intronic
1100278578 12:93095533-93095555 AATGTTTAGCACCTGGCTCTGGG + Intergenic
1100465166 12:94837896-94837918 CACACTTAGTATCTGGATCTTGG + Intergenic
1100953440 12:99878678-99878700 CACATTCAGCACATGTATCCCGG - Intronic
1101470611 12:104993402-104993424 GACACTGAGCACCTGGATCCAGG - Intronic
1102125763 12:110479213-110479235 CACACCTAGCACCCAGATCTTGG - Intronic
1102811432 12:115827532-115827554 CACACTTGGCACCTGGAGGTAGG + Intergenic
1102997719 12:117362554-117362576 CACACTTGGCACCTGGCTCTGGG + Intronic
1103702902 12:122856851-122856873 CCCATGTAGCCCCTGGGTCTGGG - Intronic
1104507866 12:129349740-129349762 CACATTTACCAGTTGGATCAAGG + Intronic
1105643813 13:22294985-22295007 CAGATTCAGCCCCTCGATCTTGG + Intergenic
1105748547 13:23400080-23400102 TACAATTATCTCCTGGATCTGGG + Intronic
1105812986 13:24010860-24010882 CACCCTGAGCACCTGGTTCTAGG + Intronic
1105813071 13:24011260-24011282 CACCCTGAGCACCTGGTTCTAGG + Intronic
1106077100 13:26469889-26469911 CACATTTGGTGCCTGGAGCTTGG + Intergenic
1106792006 13:33165194-33165216 TACATTTAGAACCTGCACCTGGG + Intronic
1107050371 13:36041081-36041103 CACATATAATACCTGGATTTTGG - Intronic
1107265372 13:38546869-38546891 CACACTTGGCACCCAGATCTTGG + Intergenic
1109417701 13:62064548-62064570 CACATTCTGCACATGTATCTTGG + Intergenic
1110130317 13:72001079-72001101 GACAGTCAGCACCTGGAGCTGGG - Intergenic
1110338463 13:74360744-74360766 CATACCTAGCACCTAGATCTTGG - Intergenic
1111889109 13:94059657-94059679 CAAATCTAGCACCTTGATCTTGG - Intronic
1113117005 13:106884985-106885007 CACTCTCAGCACCTGGATCAGGG + Intergenic
1115136183 14:30111027-30111049 CATATTTAGCACGTGGCTATAGG - Intronic
1115644545 14:35359293-35359315 CACATCTAGCACCCAGATCTTGG + Intergenic
1116637743 14:47418422-47418444 AACTTTCAGCACCTTGATCTTGG - Intronic
1116650052 14:47578379-47578401 CACATTCTGCACTTGTATCTTGG + Intronic
1117060558 14:51958323-51958345 CACATTTGGCATCTAGATCTTGG - Intronic
1117287871 14:54304901-54304923 CACATCTAACACCCAGATCTTGG - Intergenic
1117414552 14:55481696-55481718 CACATCTAGCACCCAGATCTTGG + Intergenic
1118168853 14:63365131-63365153 CACATCTAGCATCCAGATCTTGG + Intergenic
1118400089 14:65371823-65371845 CACATCTAGCACCCAGATCTCGG - Intergenic
1119585433 14:75830264-75830286 CAAAGTGAGCACCTGCATCTGGG + Intronic
1119828109 14:77674953-77674975 CAAGTTTTGCACCTGCATCTCGG - Intronic
1120093959 14:80366643-80366665 TACACCCAGCACCTGGATCTTGG + Intronic
1120617854 14:86730171-86730193 CAAATCTGGCACCTAGATCTTGG + Intergenic
1121525872 14:94618966-94618988 CTCATTTAGCACAAGGAACTAGG + Intronic
1122675557 14:103410208-103410230 CAGATGCAGCCCCTGGATCTTGG - Intronic
1123798209 15:23794876-23794898 CACATACAGCACCAAGATCTTGG + Intergenic
1124910386 15:33914895-33914917 CACACCTAGAACCTGTATCTTGG + Intronic
1125820046 15:42621837-42621859 CACATCTAGCACCCAGAACTTGG - Intronic
1126676949 15:51167836-51167858 TACATCTAGCACTTAGATCTTGG - Intergenic
1127322499 15:57860911-57860933 CACACCTAGCACCCAGATCTTGG - Intergenic
1127993870 15:64140904-64140926 CACATTTGGCACCCAGATCTTGG - Intronic
1129643919 15:77412688-77412710 CACACTTAGCATCCAGATCTTGG + Intronic
1130832176 15:87612158-87612180 CACTTGTAGCTCCTGGATCTGGG - Intergenic
1131318359 15:91362027-91362049 CACATTCTGCACCTGTATCCTGG + Intergenic
1132989235 16:2784661-2784683 CACATATAGCCCCTGGATTCAGG - Exonic
1133331348 16:4976607-4976629 CACAATTAGCATCTGGAGATGGG - Intronic
1134075628 16:11289379-11289401 CACATCTTGCACCCTGATCTTGG - Intronic
1135392407 16:22104921-22104943 GACTTTTAGCATCTGCATCTGGG - Intronic
1135618317 16:23931253-23931275 CACCTTTAGCTCCAGAATCTTGG - Intronic
1136384930 16:29918314-29918336 CATAATTGGCCCCTGGATCTAGG - Intronic
1139145020 16:64312955-64312977 CACATTGAACATCTGTATCTAGG - Intergenic
1140676265 16:77333434-77333456 CACATTCTGCACATGTATCTTGG + Intronic
1142760768 17:2040844-2040866 CACATTTAGTACCTGGTACAGGG - Intronic
1143245099 17:5477912-5477934 CACATCTAGCACCCAGATCTTGG + Intronic
1144277458 17:13687441-13687463 CACATCTAGCATCTAGATTTTGG - Intergenic
1144446858 17:15339243-15339265 CAGATGTAGCCCCTGGATCTTGG + Intronic
1146066924 17:29643384-29643406 CACATTTATCCTCTGGATCTAGG - Intronic
1148634488 17:49137481-49137503 CAGATGTGGCCCCTGGATCTTGG + Intronic
1149619149 17:58029113-58029135 CACACCTAGCACCCAGATCTTGG + Intergenic
1150515907 17:65809017-65809039 CAGATGTAGCACCTTGATCTTGG + Intronic
1154936388 18:21062128-21062150 CACACCTAGCACCCAGATCTTGG + Intronic
1156564308 18:38167061-38167083 CACACTTAGCACCCTGTTCTTGG + Intergenic
1156985745 18:43349522-43349544 CACATTAAGGACTTGAATCTGGG - Intergenic
1158351495 18:56568760-56568782 CACATTCTGCACATGTATCTCGG + Intergenic
1158676519 18:59524619-59524641 CACATCTCGCACATGTATCTTGG - Intronic
1158711378 18:59841157-59841179 CACACCTAGCACCCCGATCTTGG + Intergenic
1158886792 18:61836093-61836115 CACACTTAGTTCCTAGATCTTGG + Intronic
1159637471 18:70822625-70822647 CACTTTTTGCATCTGGATGTCGG - Intergenic
1160133340 18:76249394-76249416 CACATTCTGCACATGTATCTGGG + Intergenic
1160618994 18:80156850-80156872 CACATTGAGCACCAGCATCCTGG - Intronic
1161565437 19:4999486-4999508 CACACGGAGCACCTGGATCTCGG - Intronic
1161773927 19:6247260-6247282 CACACTTAGCTCCCAGATCTTGG + Intronic
1164781273 19:30895596-30895618 CACATCTGACACTTGGATCTTGG - Intergenic
1165341770 19:35217633-35217655 CACTTCTGGCACCTTGATCTTGG - Intergenic
926278386 2:11424039-11424061 CACATATTGCACCTGTATCCCGG + Intergenic
929912604 2:46103382-46103404 CACACTTCGCACCTAGATTTTGG - Intronic
931050119 2:58403991-58404013 CACACCTAACACCTAGATCTTGG + Intergenic
932361662 2:71113377-71113399 CACACTTAGAACCTAGATCTTGG + Intronic
932589047 2:73052238-73052260 CACATGTAGCACCCAGATCTTGG - Intronic
933237159 2:79877867-79877889 CACATTTTGCACGTGTATCCTGG - Intronic
933775501 2:85768974-85768996 CACGTTAAGCACCTGGCTCTGGG + Intronic
935542324 2:104363107-104363129 CACGTTCTGCATCTGGATCTTGG - Intergenic
936752093 2:115656167-115656189 CACATTTATTACCTTGATTTTGG + Intronic
937035925 2:118781824-118781846 CAGATTTAGCCTCTGGCTCTGGG - Intergenic
937107852 2:119335301-119335323 CACATCTAGTACCTAGATCCTGG + Intronic
938510200 2:131934601-131934623 CCCACTTAGCACTTAGATCTTGG + Intergenic
939316207 2:140553029-140553051 AACATTTAGCATCTGGGTGTTGG - Intronic
939468552 2:142589683-142589705 CACATTCAGCAACTAGAGCTGGG + Intergenic
940732526 2:157409110-157409132 CACACATAGCACCAAGATCTTGG - Intergenic
940901161 2:159127833-159127855 CACATTTTGCACATGTATCCTGG + Intronic
941282480 2:163570653-163570675 CAAATCCAGCACCTTGATCTTGG + Intergenic
942872000 2:180746264-180746286 CACATTCTGCACGTGTATCTTGG - Intergenic
944724339 2:202454892-202454914 GTCATCTAGCACCTTGATCTTGG - Intronic
944900377 2:204207786-204207808 AACAGTTAGCAGCTGGTTCTGGG - Intergenic
945184718 2:207128033-207128055 CACACTTAGCCCAGGGATCTTGG + Intronic
946314488 2:218901032-218901054 CACATCTAGCACCCAGATCTTGG - Intergenic
946799296 2:223393038-223393060 CACACTTAGCACCCAGATCTTGG - Intergenic
947525308 2:230873748-230873770 CACATTTAGCCCCTTGTCCTGGG + Intronic
947567582 2:231204417-231204439 AAGATTGAGCACCTGGATCTGGG - Intronic
948254657 2:236557353-236557375 CACACTTTGCACCCAGATCTTGG + Intergenic
948662205 2:239514559-239514581 CACAGTAAGAACCTGGGTCTTGG - Intergenic
948778879 2:240304868-240304890 CTCCTTTGGCCCCTGGATCTTGG - Intergenic
1169616915 20:7458073-7458095 CACATGCAGCACCTTGATCTTGG + Intergenic
1169766139 20:9150140-9150162 CACATTACACACCTGGATATAGG - Intronic
1170781085 20:19426020-19426042 CACAGTTAGCACATGGACCTGGG - Intronic
1172088155 20:32406009-32406031 AACATTTAGAAACTAGATCTTGG - Intronic
1172576645 20:36014288-36014310 CACACTTAACACTTGGATCTTGG + Intronic
1172602602 20:36194341-36194363 TACCTTTAGCTCCTTGATCTTGG - Exonic
1174728187 20:52887482-52887504 CACACCTAGCACCTAGATCTTGG + Intergenic
1174864232 20:54120117-54120139 CACGTTTACCACCAGGATGTGGG + Intergenic
1175223174 20:57429143-57429165 CACGTTCAGCAGCTGGATCCTGG - Intergenic
1175369483 20:58478291-58478313 CACACCTAGCACCCAGATCTTGG - Intronic
1175459157 20:59137989-59138011 CACATTTAACACCTGGTGTTTGG - Intergenic
1176249917 20:64115746-64115768 CACATTTTGGAGCTGGATATAGG - Intergenic
1176783620 21:13228720-13228742 CCCACTTAGCACTTAGATCTTGG - Intergenic
1176991976 21:15507916-15507938 CAGATGTGGCCCCTGGATCTTGG + Intergenic
1177981272 21:27917489-27917511 CCCACTTAGCACTTAGATCTTGG - Intergenic
1178603079 21:34011959-34011981 CACATTTAGCACCTAGATCTTGG - Intergenic
1178630419 21:34254861-34254883 CACACCTACCACCTAGATCTTGG - Intergenic
1179072581 21:38085635-38085657 CAAATTTAGAACCAAGATCTGGG + Intronic
1180116688 21:45711149-45711171 TACATTCAGCACCTAGATATTGG - Intronic
1181661720 22:24355309-24355331 CACATTTAGCACCTGGATCTTGG - Intronic
1182089910 22:27587329-27587351 CAGATGTAGCTCCTTGATCTTGG - Intergenic
1183125231 22:35772524-35772546 CACATTTAGCACTTGAAATTTGG - Intronic
949100809 3:142798-142820 CACATTTAGCACACAGATCTTGG - Intergenic
949103928 3:180455-180477 CACATTTTGCACATGTATCATGG + Intergenic
949147158 3:715650-715672 CACCTCTAGCACCCAGATCTTGG - Intergenic
949215526 3:1562581-1562603 CACAGCTCGCACCTGGATCCTGG - Intergenic
950131303 3:10548606-10548628 CACTGTGGGCACCTGGATCTGGG - Intronic
950268838 3:11596882-11596904 AACACCTAGCACCTGGATCTGGG + Intronic
950390867 3:12695546-12695568 CACATTCTGCACATGCATCTTGG + Intergenic
951639663 3:24822522-24822544 CACACTTAGCATCCAGATCTTGG - Intergenic
953239609 3:41137128-41137150 AACAATTGGCACCTTGATCTTGG - Intergenic
953358722 3:42276598-42276620 CAAATATACCACCTGCATCTAGG - Intergenic
955735801 3:62037128-62037150 CAGATTTGGAACCTGGAGCTAGG + Intronic
956226148 3:66961329-66961351 CACATCTAGCACCCAAATCTTGG - Intergenic
956660236 3:71590400-71590422 CACACCTAGCACCCAGATCTTGG + Intergenic
956819611 3:72941917-72941939 CACACCTAGCACCTAGATATTGG + Intronic
960095655 3:113687405-113687427 GACAGGCAGCACCTGGATCTTGG - Intronic
961073420 3:123959730-123959752 CACATCTAGTACCTAGATCTTGG - Intronic
961310158 3:125992088-125992110 CACATCTATTACCTAGATCTTGG + Intergenic
962122131 3:132572941-132572963 CACATTTTGCACTTGTATCCCGG - Intronic
962390512 3:134967648-134967670 CAGATGTAGCACCTTGACCTTGG + Intronic
962418668 3:135207776-135207798 CCTAGTTAGCACCTTGATCTTGG - Intronic
965051850 3:163661123-163661145 TAGATTTAGAACCTAGATCTTGG - Intergenic
965112195 3:164441526-164441548 CACATCTACTACCTAGATCTTGG + Intergenic
966685593 3:182691354-182691376 CACACCTAGCACCCAGATCTTGG + Intergenic
967850972 3:194082506-194082528 CCAAATTAGCACCTTGATCTGGG + Intergenic
970687082 4:18580769-18580791 CACATTTTGCACATGTATCCTGG - Intergenic
973015294 4:45130196-45130218 CACCTTTGGCCACTGGATCTAGG + Intergenic
973276779 4:48318594-48318616 CACACTTAGTACCCAGATCTTGG - Intergenic
974662328 4:64908223-64908245 CACAACTAACACCTAGATCTTGG - Intergenic
975169197 4:71213867-71213889 ATCAGCTAGCACCTGGATCTTGG + Intronic
976794400 4:88916139-88916161 CAGATATAGCACCTTGAGCTTGG + Intronic
977350459 4:95878707-95878729 CCCACTTAGTACTTGGATCTTGG + Intergenic
977389533 4:96390376-96390398 CACATTTTTCACCTGTAGCTGGG + Intergenic
978668512 4:111216235-111216257 CACATTTAACTCCTGGACATGGG + Intergenic
978730092 4:112015388-112015410 CACATTCTGCACATGGATCCCGG + Intergenic
982016506 4:151159661-151159683 CAAATCTAGCACATAGATCTTGG - Intronic
983402562 4:167284010-167284032 CACATTGTGCACGTGTATCTCGG - Intergenic
984280369 4:177663165-177663187 AACATTTAAAACCTGGATCCTGG + Intergenic
986503220 5:8423401-8423423 CACATCTAGCACCCAGATCTTGG + Intergenic
986938567 5:12920666-12920688 CAAAGACAGCACCTGGATCTTGG - Intergenic
987036070 5:14019549-14019571 CACATTCTGCACCTGTATCCCGG + Intergenic
987749354 5:22019639-22019661 CACTGATGGCACCTGGATCTTGG + Intronic
988149188 5:27353876-27353898 CAAATCTAGCACCTTGTTCTGGG + Intergenic
988377449 5:30455645-30455667 CACGTTTAGCACATGTATCCCGG - Intergenic
989467509 5:41774369-41774391 CACACCTAGCACCCAGATCTTGG + Intronic
989541469 5:42623588-42623610 CAAATTTAGCACCTGTCTCAAGG + Intronic
990798133 5:59567274-59567296 CACCTTTAGCAACTGGACATTGG - Intronic
991282314 5:64929251-64929273 TACATTTAGCACCCAGATCTTGG + Intronic
991988099 5:72310247-72310269 GACACCTAGCACCTAGATCTTGG + Intronic
992502662 5:77357532-77357554 CACAGTTCTCACCAGGATCTAGG + Intronic
992813879 5:80416819-80416841 CATACTTAGCACCCAGATCTTGG - Intronic
993618684 5:90142972-90142994 CATCTTTAGCTCCTGGACCTTGG - Intergenic
994311523 5:98277957-98277979 CACAGCTGGCACCTTGATCTTGG - Intergenic
995805434 5:116047048-116047070 CTCAATTGGCACCTTGATCTTGG + Intronic
996054389 5:118967384-118967406 CACACCAAGCACCCGGATCTTGG + Intronic
996433197 5:123403212-123403234 CATACCTAGCACCTAGATCTTGG + Intronic
996592958 5:125168667-125168689 CACACTTAGAACCCAGATCTTGG + Intergenic
996614837 5:125428925-125428947 CAAATTTAGCCCCTAGATCAGGG + Intergenic
998726195 5:145017461-145017483 CACATTTAGCACCTGCTACATGG - Intergenic
999168026 5:149567884-149567906 CACATTTGGTACCCAGATCTTGG - Intronic
1000242408 5:159420740-159420762 CACATGCAGCCCCTCGATCTTGG - Intergenic
1003139893 6:3462510-3462532 CACACCTAGCACCCAGATCTTGG + Intergenic
1003981578 6:11395159-11395181 CACATTCTGCACATGTATCTTGG + Intergenic
1004218950 6:13728904-13728926 CACACTGAGCACCTAGATTTTGG - Intergenic
1004247749 6:13996412-13996434 CAAATATAGCACCTTGACCTTGG - Intergenic
1004799260 6:19128149-19128171 CACACCTAGCACCAAGATCTTGG + Intergenic
1005102891 6:22192385-22192407 CACATTTAGCATCCATATCTTGG + Intergenic
1005348889 6:24915201-24915223 CATATTTTGGCCCTGGATCTGGG - Intronic
1007993858 6:46285505-46285527 CCCATGTATCACCTGCATCTGGG - Intronic
1008243453 6:49141990-49142012 CACACATAGCACCCAGATCTCGG - Intergenic
1008564032 6:52749856-52749878 CACATATACCATCTGTATCTTGG + Intergenic
1008572794 6:52831129-52831151 CACATATACCATCTGTATCTTGG + Intergenic
1008590780 6:52991723-52991745 GACATCTAGCACCCAGATCTTGG + Intronic
1009649765 6:66460237-66460259 CACATGTAGCCCCTAGATCCTGG + Intergenic
1009786563 6:68347958-68347980 CTCATTTAGTACCTGGATCTTGG - Intergenic
1011907960 6:92396092-92396114 CACATCTAGCTCCTAGATTTTGG - Intergenic
1018037492 6:159893803-159893825 CACATTTTACACCCAGATCTTGG + Intergenic
1018375897 6:163212350-163212372 CACATCTGGTACCTGGATTTTGG + Intronic
1019017754 6:168892144-168892166 CAGGTTTTCCACCTGGATCTTGG + Intergenic
1019017798 6:168892380-168892402 CAGGTTTTCCACCTGGATCTGGG + Intergenic
1019017811 6:168892459-168892481 CAGGTTTTCCACCTGGATCTCGG + Intergenic
1019017840 6:168892618-168892640 CAGGTTTTCCACCTGGATCTGGG + Intergenic
1019017880 6:168892856-168892878 CAGGTTTTCCACCTGGATCTGGG + Intergenic
1019106949 6:169675850-169675872 CTCAATTATCTCCTGGATCTGGG + Intronic
1019885624 7:3902116-3902138 CACACTTAGCAGCCAGATCTTGG - Intronic
1020913430 7:14161778-14161800 CACATTCTGCACATGGATCCTGG + Intronic
1026207496 7:68270889-68270911 CACATTCACCCCCTGGCTCTAGG + Intergenic
1027461194 7:78455927-78455949 CACTTTCAGAACCTGGGTCTGGG + Intronic
1027497847 7:78910226-78910248 CACATTTTGCACGTGAATCCTGG + Intronic
1027690989 7:81344455-81344477 GACACCTAGCACCTAGATCTTGG + Intergenic
1028041304 7:86058265-86058287 CACAGCCAGCACCTGAATCTGGG - Intergenic
1028278869 7:88895547-88895569 CACATCCAGCACCAAGATCTTGG + Intronic
1028293131 7:89092887-89092909 TACATCTAGCACCCAGATCTTGG - Intronic
1029529432 7:101115517-101115539 CACAGTAAGAACTTGGATCTAGG - Intergenic
1030429254 7:109421102-109421124 TATACTTAGCACCTAGATCTTGG - Intergenic
1031035915 7:116787452-116787474 CACATGTGGCCCCTTGATCTTGG - Intronic
1031715003 7:125097952-125097974 CACATTCAGCACATGTATCCCGG + Intergenic
1032473221 7:132193329-132193351 CAGATGTAGCCCCTAGATCTTGG + Intronic
1032978718 7:137256216-137256238 CACATTCTGCACATGTATCTTGG - Intronic
1034821508 7:154220652-154220674 GACTGTTGGCACCTGGATCTTGG + Intronic
1034868937 7:154665624-154665646 CACAGTTAGCACCCAGATCTTGG - Intronic
1037063100 8:14541162-14541184 CACATTCAGTACCTGTATCCCGG - Intronic
1037067216 8:14596800-14596822 CACATTTTGCACATGTATCCTGG + Intronic
1037553689 8:20001501-20001523 CACTGTTAACACCTTGATCTTGG - Intergenic
1038487377 8:27946500-27946522 CCCTGTTAGCACCTTGATCTTGG + Intronic
1039192140 8:34988306-34988328 CACATTTAGTGCCCAGATCTTGG - Intergenic
1039590072 8:38738797-38738819 CACATCTAGCACCAAGATTTTGG - Intronic
1040386194 8:46916473-46916495 CACATTTCAGCCCTGGATCTAGG - Intergenic
1040733386 8:50476748-50476770 CACACCTAGTACCTAGATCTTGG + Intronic
1041100750 8:54394601-54394623 CAAATTAGGCACCTGGGTCTTGG - Intergenic
1042203337 8:66303359-66303381 CAGATGTAGCCCCTCGATCTTGG + Intergenic
1043109865 8:76167533-76167555 CACATTCTGCACGTGTATCTCGG + Intergenic
1043288624 8:78568048-78568070 CAAATATAGCACCCAGATCTTGG - Intronic
1044708425 8:95031184-95031206 CACACCTAGCACCCAGATCTTGG - Intronic
1045783339 8:105894207-105894229 CACATCTAGCACCCAGATTTCGG + Intergenic
1045878076 8:107005829-107005851 CACATTTTGCACTTGTATCCTGG + Intergenic
1047767109 8:127999010-127999032 CACATCTAGCACCCAGATCTTGG - Intergenic
1047846443 8:128810909-128810931 CACACTTAGCACTCAGATCTTGG + Intergenic
1048030115 8:130623221-130623243 CACATCTAGCACCTAGATCTTGG - Intergenic
1050070184 9:1802480-1802502 CACACTTAGCACCCAGATCTTGG + Intergenic
1050186645 9:2982019-2982041 AACCTGCAGCACCTGGATCTTGG - Intergenic
1050632931 9:7579795-7579817 CACATTGAGCACAGGGATCTTGG + Intergenic
1050752590 9:8958123-8958145 CACATTTAGCACCTGCAGGATGG - Intronic
1051029180 9:12653945-12653967 CACATGTAGGACCCAGATCTTGG - Intergenic
1051294650 9:15582894-15582916 CACATTCTGCACATGTATCTCGG + Intronic
1051943330 9:22535227-22535249 CACATTTTGCACATGTATCCTGG + Intergenic
1052171198 9:25399352-25399374 CAGATATAGCTCCTCGATCTTGG - Intergenic
1052341912 9:27372049-27372071 CACATGAAACACATGGATCTTGG + Intronic
1052798688 9:32947279-32947301 CACAATTAGCACCTGTACTTGGG - Intergenic
1055492204 9:76816996-76817018 CACAATGAGCACCTAGAACTTGG + Intronic
1056928723 9:90856945-90856967 CCCAGTGAGCACCTGGATGTGGG - Intronic
1057104390 9:92397667-92397689 CACACCCAGCACCTGCATCTTGG - Intronic
1057403840 9:94749436-94749458 CACAACTGGCACCTAGATCTTGG - Intronic
1057640220 9:96812496-96812518 CACATGTGGCCCCTTGATCTTGG - Intergenic
1058930693 9:109715987-109716009 AACATTTAGCATCTGCAGCTGGG + Intronic
1059464235 9:114457169-114457191 TACACCTAGCACCTGGATCTTGG + Intronic
1059530560 9:115031593-115031615 CCCATTGAGTGCCTGGATCTTGG + Exonic
1060049962 9:120371555-120371577 CACATTTATCTTCTGGAACTGGG - Intergenic
1061678407 9:132230960-132230982 CACTTCTCTCACCTGGATCTGGG + Intronic
1186115654 X:6302898-6302920 CACATTCTGCACATGTATCTGGG - Intergenic
1186604273 X:11073420-11073442 CCAATTTAGCACCCAGATCTTGG + Intergenic
1186766383 X:12774555-12774577 CACATTCTGCACATGTATCTCGG + Intergenic
1189523035 X:41790236-41790258 CAACTTTAGCACCTGGAGATGGG + Intronic
1191614883 X:63159531-63159553 CACATCTAGCACAAAGATCTTGG + Intergenic
1191621413 X:63219392-63219414 CACATCTAGCACAAAGATCTTGG - Intergenic
1192847702 X:74923885-74923907 CATATTTTGCTTCTGGATCTTGG - Intronic
1195250381 X:103038699-103038721 CACATTTTGCACATGTATCCCGG - Intergenic
1195638521 X:107146931-107146953 CACACCTAGAACCTAGATCTTGG - Intronic
1196217902 X:113076351-113076373 CACATTTTGCATATTGATCTTGG - Intergenic
1196434979 X:115666179-115666201 AACAATTAGCACCTGTACCTGGG - Intergenic
1196676862 X:118429172-118429194 CACATTCTGCACATGTATCTTGG + Intronic
1201566118 Y:15366892-15366914 CAGATTTATCACCTGGTGCTGGG - Intergenic