ID: 1181665341

View in Genome Browser
Species Human (GRCh38)
Location 22:24391661-24391683
Sequence CAACAGACCATGCCTCCGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 74}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181665341_1181665345 30 Left 1181665341 22:24391661-24391683 CCTGGCGGAGGCATGGTCTGTTG 0: 1
1: 0
2: 0
3: 8
4: 74
Right 1181665345 22:24391714-24391736 TTGTTACTTCACCAACTAGATGG No data
1181665341_1181665343 -2 Left 1181665341 22:24391661-24391683 CCTGGCGGAGGCATGGTCTGTTG 0: 1
1: 0
2: 0
3: 8
4: 74
Right 1181665343 22:24391682-24391704 TGGCAGCAACAGCAGTAGCTTGG 0: 1
1: 0
2: 3
3: 49
4: 402

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181665341 Original CRISPR CAACAGACCATGCCTCCGCC AGG (reversed) Intronic
902398669 1:16145686-16145708 CAACAGACCCTGCCATCCCCAGG + Intronic
908304926 1:62802815-62802837 CAATAGACCATGCTTTCTCCTGG + Intronic
909534920 1:76725843-76725865 AAACAGGCTATGCCTCAGCCTGG - Intergenic
914239130 1:145839903-145839925 CACCAGACCATGCCCCATCCAGG + Exonic
917155724 1:171996523-171996545 CATCAGACCATTCCTCTGCTAGG + Intronic
920837979 1:209529666-209529688 CAAATGACCATGCCTGAGCCTGG + Intergenic
1067569341 10:47360183-47360205 CAACAAGCCATGCCTCTGCCAGG + Intergenic
1070842693 10:79498570-79498592 CCACAGACCAGTCCTCGGCCAGG - Intergenic
1077467021 11:2738244-2738266 CTCCAGACCCTGCCTCCCCCTGG - Intronic
1077629308 11:3799946-3799968 CAACAGACGGAGCCTCCGACTGG + Intronic
1083200795 11:61119855-61119877 GAAGAGACCTTGCCTCCTCCTGG - Intronic
1083718698 11:64593370-64593392 CCACAGACCCTGCCTCTTCCTGG + Intronic
1089189751 11:116645121-116645143 CGACAGGCCATGCCTGAGCCAGG + Intergenic
1097181724 12:57175510-57175532 GAACACACAATGCCTTCGCCAGG - Exonic
1100181908 12:92095076-92095098 CAAGGGACCCTGCCTCCTCCTGG + Intronic
1104684742 12:130777504-130777526 GAACAGCCCATGCCTCTCCCAGG + Intergenic
1114470600 14:22958342-22958364 CAACAGAGCAAGACTCCGTCTGG - Intronic
1115305058 14:31924990-31925012 CAACTGACCATGTCCCTGCCTGG - Intergenic
1119738307 14:76998114-76998136 CCACAGCCCCTGCCTCTGCCAGG - Intergenic
1121162014 14:91752231-91752253 CACCAGACCCTGCCTCCAACAGG + Intronic
1123474064 15:20576405-20576427 CAGCAGCCCATGCCTTCACCTGG - Intergenic
1123643946 15:22423948-22423970 CAGCAGCCCATGCCTTCGCCTGG + Intergenic
1123734365 15:23171417-23171439 CAGCAGCCCATGCCTTCGCCTGG - Intergenic
1124284871 15:28392725-28392747 CAGCAGCCCATGCCTTCGCCTGG - Intergenic
1124297826 15:28518889-28518911 CAGCAGCCCATGCCTTCGCCTGG + Intergenic
1134118524 16:11567398-11567420 CAACAGAGCAAGACTCCGTCTGG + Intronic
1138273002 16:55709712-55709734 CCACAGACCTTGCCTCCTGCAGG + Intergenic
1142033588 16:87850497-87850519 CACCAGAGCGTGCATCCGCCGGG + Intronic
1142791784 17:2272336-2272358 CCCCAAACCATGCCTCTGCCAGG + Intronic
1146801994 17:35832056-35832078 CAACAGAGCAAGACTCCGTCTGG + Intronic
1153941894 18:9985860-9985882 CAACAGGCCCTGCCTGCCCCAGG - Intergenic
1155330149 18:24707476-24707498 CAACAGAACAAGACTCCGTCTGG - Intergenic
1156473468 18:37391587-37391609 CATCAGACCATGCCTTCCCTTGG + Intronic
1156553623 18:38043597-38043619 CTTCACAACATGCCTCCGCCAGG - Intergenic
1159634122 18:70784595-70784617 GAACAGACCATTCCTCTGTCAGG + Intergenic
1159937824 18:74382740-74382762 CAGCACACCATGCCTGCTCCAGG + Intergenic
1160683951 19:424902-424924 CATCAGACAAGGCCTCCGACAGG + Intronic
1160894417 19:1395945-1395967 AACCAGCCCATGCCACCGCCTGG - Intergenic
1161705830 19:5820999-5821021 GCACAGGCCATGCCTCTGCCTGG + Intergenic
1162580340 19:11525982-11526004 CGACAGAGCAAGACTCCGCCTGG - Intronic
1163824665 19:19516257-19516279 AAGCAGGACATGCCTCCGCCGGG + Exonic
1167010702 19:46805509-46805531 CAACAGTGCATGCCTCTGTCAGG - Intergenic
929992825 2:46804007-46804029 TAACACACCATGCCACTGCCTGG + Intergenic
933841010 2:86285630-86285652 CAACAGAGCCTGCCTTCTCCCGG + Intronic
938548153 2:132353353-132353375 CGCCAGACCCTGCCCCCGCCCGG - Intergenic
941707127 2:168670979-168671001 CAACAGAGCAAGCTTCCGTCTGG - Intronic
942042475 2:172080165-172080187 CCACAGTCCATGCATCCTCCAGG - Exonic
942209731 2:173658462-173658484 CAAGATACCAGGCCTCCCCCCGG - Intergenic
944669759 2:201985048-201985070 ACACAGAGCATGCCTGCGCCTGG - Intergenic
1171877024 20:30586125-30586147 CGCCAGACCCTGCCCCCGCCCGG - Intergenic
1175458572 20:59133801-59133823 CAAGAGTGCATGCCTCCCCCTGG + Intergenic
1181665341 22:24391661-24391683 CAACAGACCATGCCTCCGCCAGG - Intronic
953666490 3:44929639-44929661 CAACAGGCCAGGCCCCAGCCAGG + Intronic
957136818 3:76298911-76298933 CCTCTGACCATGCCTCTGCCAGG + Intronic
960811898 3:121634085-121634107 CAACAGACCTTGCCTAACCCAGG + Intronic
961361591 3:126371383-126371405 CCCCAGCCCATGCCTCCGCATGG - Intergenic
964245845 3:154652401-154652423 CTACAGACCTTCCCTCCCCCTGG - Intergenic
968262223 3:197334666-197334688 CAACAGACCCTGCCCACTCCAGG - Intergenic
969313127 4:6365782-6365804 CATCACACCAAGCCTCGGCCTGG - Intronic
969443625 4:7232170-7232192 CCACAGCCCATGCTTCCCCCAGG - Intronic
984950999 4:185007735-185007757 CAACAGAGCAAGACTCCGTCTGG - Intergenic
986491988 5:8302584-8302606 CAAAAGAACATGCCTGTGCCAGG + Intergenic
987071424 5:14340375-14340397 CAACAGAGCAAGACTCCGTCTGG + Intronic
995865251 5:116683446-116683468 CATCAGAGCATGCCAGCGCCAGG - Intergenic
999428391 5:151506070-151506092 GGCCAGACCATGGCTCCGCCAGG + Exonic
1006093574 6:31642321-31642343 CAGCAGACCATGCCCCCACCAGG - Exonic
1014824527 6:126033729-126033751 CAGCAGACCATGCATCTGCCAGG - Intronic
1015610805 6:135015902-135015924 CAACAGAACAAGACTCCGTCTGG - Intronic
1019931618 7:4227026-4227048 CAGCAGTCCAGGCCTCCGGCTGG - Intronic
1027238476 7:76312179-76312201 CCCCAGCCCATGTCTCCGCCAGG - Intergenic
1031952419 7:127905971-127905993 CAACAGAAAAAGCCTCCACCAGG - Intronic
1032702879 7:134397655-134397677 CAACAGGCCTGGCCTCCACCTGG - Intergenic
1036715807 8:11122939-11122961 AAAAAGCCCATGCCTCTGCCGGG + Intronic
1045189062 8:99865474-99865496 CAACAAAACAGGCCTCCGCCAGG + Intronic
1052697178 9:31892533-31892555 CACCAGACCATGCTGCCGCTGGG - Intergenic
1053526748 9:38837821-38837843 CATCAGGCCATGCCTCTGCTTGG + Intergenic
1053752732 9:41273335-41273357 CCCCAGACCCTGCCCCCGCCCGG + Intergenic
1054198976 9:62062250-62062272 CATCAGGCCATGCCTCTGCTTGG + Intergenic
1054258258 9:62837687-62837709 CGCCAGACCCTGCCCCCGCCCGG + Intergenic
1054639378 9:67526107-67526129 CATCAGGCCATGCCTCTGCTTGG - Intergenic
1061120834 9:128641312-128641334 CATCAGACCATGTGTCTGCCAGG - Intronic
1202800515 9_KI270719v1_random:170688-170710 CGCCAGACCCTGCCCCCGCCCGG - Intergenic
1198379442 X:136070209-136070231 GAAAAGACCATGGCTCGGCCGGG + Intergenic