ID: 1181665944

View in Genome Browser
Species Human (GRCh38)
Location 22:24397168-24397190
Sequence CTGTTTTGGCAGAGGGAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 489
Summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 449}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181665944 Original CRISPR CTGTTTTGGCAGAGGGAAAA TGG (reversed) Intronic
900671564 1:3857779-3857801 CCGTTTTGGAAGAGGAAAAGCGG - Intronic
901567816 1:10133164-10133186 CTGCTTTGCCAGAGGAGAAAAGG + Intronic
901866585 1:12110470-12110492 TTGGTTTGTCAGAGGGAAATGGG + Intronic
902128029 1:14233765-14233787 CTCTTTTGGCAGAGGCAGTAGGG - Intergenic
902898157 1:19493924-19493946 CTGATTTGGCATAGGGTAGAAGG - Intergenic
905240833 1:36580567-36580589 CTGTTCTTGCAGGGGGGAAAGGG - Intergenic
905676439 1:39828854-39828876 CAGTTTTGCCATATGGAAAATGG + Intergenic
905745995 1:40417820-40417842 TTATTTTGGAAGAGGGAAGAAGG - Intronic
906175260 1:43765890-43765912 CTGTTATGGCTGAGGGAAAGAGG - Intronic
906534103 1:46542230-46542252 CAGCTTTGGCAGAAGGACAAAGG - Intergenic
907366627 1:53966201-53966223 GTGTTTATGGAGAGGGAAAAAGG + Intronic
909386864 1:75067953-75067975 CTGTTTTGGCTTGAGGAAAAAGG - Intergenic
909913406 1:81288715-81288737 CTGTGTTGCAAGTGGGAAAATGG - Intergenic
910734970 1:90443599-90443621 CTGCTGTGGCAGATGAAAAATGG - Intergenic
910860283 1:91736783-91736805 CTGTGCTGGCAGTGGGACAAAGG - Intronic
910938050 1:92503122-92503144 GTGTTGTGGCAGAGGGCAAAGGG - Intergenic
912902968 1:113672496-113672518 GTGGTTTGTCAGAGGGAAAATGG + Intronic
913425130 1:118720280-118720302 GTGTTTTGGTAGAGGAACAAGGG - Intergenic
914334671 1:146703575-146703597 CTGGTGAGGCAGAGGAAAAAAGG - Intergenic
914995622 1:152541104-152541126 TTGTATTGGGAGATGGAAAAGGG - Intronic
915002912 1:152609777-152609799 TTGTATTGGGAGATGGAAAAGGG + Intergenic
915426674 1:155833338-155833360 CTTTTTTTGCAGTGGGAGAATGG - Intronic
916360242 1:163959769-163959791 CAGTTTCTGCAGGGGGAAAAGGG - Intergenic
916661188 1:166923502-166923524 CTTTTTTGGGAGAGGGGAAGAGG - Intronic
916713022 1:167428706-167428728 CTGGCTTGGCAGAGAAAAAATGG - Intergenic
917662430 1:177190486-177190508 CTGTTTTGGAGAAGGGAAGAAGG - Intronic
917690195 1:177460808-177460830 CTGTTTTGGCAAAGCACAAAGGG - Intergenic
918047576 1:180950811-180950833 CTTTGTTGGCAGGGGGAGAAGGG + Exonic
919413639 1:197278507-197278529 TTTTAATGGCAGAGGGAAAAAGG + Intronic
919418435 1:197340835-197340857 CTTTATTAGCAGAGTGAAAATGG - Intronic
919597117 1:199578046-199578068 CTGCTTGGGAAGAGGTAAAATGG + Intergenic
920034470 1:203056887-203056909 CTGTTTGGGAAGAAGGAGAAGGG + Exonic
921837070 1:219789217-219789239 CTATTTTGATAGAAGGAAAATGG + Intronic
921951793 1:220937705-220937727 CTCTTATGCCAGAGGGAAAAGGG - Intergenic
921951890 1:220938743-220938765 CTCTTATGTCAGAGGGAAAAGGG + Intergenic
922458384 1:225796046-225796068 CGGTTTTGTCAGAAAGAAAAGGG - Intergenic
922626154 1:227045781-227045803 CTGTTTTTGTTGAAGGAAAAAGG - Intronic
923220180 1:231885742-231885764 CTATGGTGGCAGTGGGAAAAGGG + Intronic
923420249 1:233807347-233807369 CTTCTTTGGCAGAGGAAAAAAGG - Intergenic
923519415 1:234724507-234724529 CATGTTTGGCAGAGGGAAAGAGG - Intergenic
923556957 1:235008739-235008761 CTTTATTGGCAGTGTGAAAACGG - Intergenic
923702228 1:236310882-236310904 CTGGGTTGGCAAAGGGAAAAAGG + Intergenic
1064583278 10:16815316-16815338 ATGTCTTGGCAGAAGGAAAAGGG - Intronic
1065710608 10:28513566-28513588 CGGTTTTGTCAGTGGGTAAAAGG + Intergenic
1065776735 10:29127325-29127347 CTCTTTTGCCAGAGGGTGAAAGG + Intergenic
1067321272 10:45223426-45223448 ACGTCTTGGCAGAAGGAAAAGGG - Intergenic
1069506555 10:69003559-69003581 CTGTTTTGGAAGACGTAAGAGGG + Intronic
1069945223 10:71981084-71981106 CTGTTTTTTCAAAGGGAAGAAGG + Intronic
1073649487 10:105343407-105343429 CTGTCTAGGTAGGGGGAAAAAGG - Intergenic
1075236732 10:120737268-120737290 CTGCTCTGGCACAGGGAGAATGG - Intergenic
1075273549 10:121074157-121074179 CTGTTTTGGAAAAGGCAAGAAGG - Intergenic
1075746330 10:124730434-124730456 CTGCTGTGGCAGAGGGAACCTGG - Intronic
1076242176 10:128916828-128916850 CTCCACTGGCAGAGGGAAAAGGG + Intergenic
1078379041 11:10823054-10823076 CAGTGTTGGGAGAGGGAAAGAGG + Intronic
1078464589 11:11540873-11540895 CTGGGTTGTCAGAAGGAAAATGG + Intronic
1080084529 11:28262714-28262736 CTGTTTTGGCTCAGGAAAGATGG - Intronic
1080182424 11:29441476-29441498 CAGTTATGGCAGAAGGCAAAGGG + Intergenic
1080310543 11:30886554-30886576 CTGATATGGCAGAGAGAAAGAGG + Intronic
1080690077 11:34549121-34549143 CAGTTTGGGCAGGGAGAAAATGG - Intergenic
1081343243 11:41952970-41952992 CAATTTTCTCAGAGGGAAAAAGG + Intergenic
1081501106 11:43667493-43667515 TTATTATGGCAGAAGGAAAAGGG - Intronic
1082708650 11:56525752-56525774 CTGTCGTGGCAGAAGGAGAAAGG + Intergenic
1083554830 11:63617835-63617857 CAGTCATGGCAGAAGGAAAAAGG - Intergenic
1087037059 11:93766353-93766375 CTCTCTTCCCAGAGGGAAAAGGG + Intronic
1087194369 11:95290539-95290561 CTGTTGAAGGAGAGGGAAAATGG + Intergenic
1087257746 11:95975358-95975380 CTTTTTTAGTAGAGGGGAAAGGG + Intergenic
1087630060 11:100639399-100639421 CCGCCTTGGCAGTGGGAAAATGG - Intergenic
1087802609 11:102520105-102520127 CTGCGTTGGCATGGGGAAAAGGG + Intergenic
1087970135 11:104470399-104470421 CTGGTATGGAAGAGGGAGAAAGG + Intergenic
1088607508 11:111545546-111545568 TTGTTTTGGCAGGAGGAAAGTGG - Intronic
1088816159 11:113422473-113422495 CTCCTTTGGAAGAGGGAAGAAGG + Intronic
1088939037 11:114435245-114435267 CAGTTATGGCAGAAGGCAAAGGG + Intronic
1089047284 11:115513267-115513289 ATGTTTTTGCAGAGGGCAAGAGG + Intergenic
1089111959 11:116064284-116064306 CTGTTTTGGGAGAGTAAAGAGGG - Intergenic
1089973825 11:122715677-122715699 CTGTTTTGAGAGAGACAAAAGGG - Intronic
1091225392 11:133954011-133954033 CTGCTCTGGCAGAGGGGGAAAGG - Intronic
1091631736 12:2166602-2166624 CTGTTTTGTCATATGTAAAATGG + Intronic
1092626793 12:10336765-10336787 CTGATTTGGGAGAAAGAAAAAGG + Intergenic
1092740431 12:11623448-11623470 TTGTGTTGCCAGAGGGAATAGGG - Intergenic
1093306960 12:17532390-17532412 CTGTTTTGTCTCAGGGAATAGGG - Intergenic
1093368278 12:18332347-18332369 CTATTTTGGCAGTGGGGACAAGG + Intronic
1094008066 12:25776451-25776473 CTGTTTTGGCAAAGTTCAAAAGG + Intergenic
1094028013 12:25979615-25979637 CAGTTTTTGCAGAAGTAAAATGG - Intronic
1094341251 12:29413957-29413979 ATATGTTGGCAGAGGGAAAACGG - Intronic
1095475164 12:42579615-42579637 TTGATTTGGCAGAGGGCATATGG + Intronic
1096215145 12:49794370-49794392 CTGTTGTGGCAGATGTCAAAGGG + Intronic
1096802099 12:54117397-54117419 CTGATTTAGCAGAGGGTGAAGGG + Intergenic
1096814396 12:54192640-54192662 CTGATTTGGGGAAGGGAAAAGGG + Intergenic
1097427250 12:59461681-59461703 ATGTTTTGTCAGAAGGAGAAAGG + Intergenic
1098856823 12:75662466-75662488 CTGTATTAGCAGTGTGAAAATGG - Intergenic
1099418815 12:82426875-82426897 GTGTTGTGGTAGAGGGAAGATGG - Intronic
1099540015 12:83896045-83896067 TTGTTATAGCAGAGTGAAAATGG + Intergenic
1099838758 12:87939641-87939663 CTGTTTTTGCATATGAAAAATGG + Intergenic
1100021194 12:90071276-90071298 CTTTATTGGCAGTGTGAAAATGG + Intergenic
1100532963 12:95477603-95477625 CTCTTTTGGCGGAGGAAAAATGG + Intronic
1101023573 12:100578227-100578249 CTGTTCTGGCTGAGGAAAGATGG + Intronic
1102333973 12:112061518-112061540 CTATTTTGGTAGATAGAAAATGG - Intronic
1102854642 12:116282772-116282794 ATGTAATGGCAGAGAGAAAATGG + Intergenic
1103050958 12:117779060-117779082 CTGTCTTTGCAGAGGGAAATTGG - Intronic
1104125135 12:125838900-125838922 CTGGTTCAGCAGAGAGAAAAGGG - Intergenic
1104908547 12:132228452-132228474 CTGTCTTGCCAGAGGCAAAGAGG - Intronic
1106614591 13:31315012-31315034 CAATTATGGCAGAGGGCAAAAGG - Intronic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1106775477 13:33004325-33004347 ATGTTTAGGCAGAGGGATAAGGG + Intergenic
1106920171 13:34554698-34554720 CTATTTTGATAGAGGAAAAATGG - Intergenic
1107231827 13:38119165-38119187 CAATTTTGGCAGAAGGCAAAGGG + Intergenic
1107732346 13:43360904-43360926 ATGTTTTGCTAGATGGAAAATGG - Intronic
1108738758 13:53313096-53313118 GTGTTTTGGAAGAAAGAAAAAGG - Intergenic
1108843618 13:54651830-54651852 CTGTTGTGGCAGAGGTGATATGG - Intergenic
1109286473 13:60414928-60414950 CTGCTTAAACAGAGGGAAAAGGG + Intronic
1109341363 13:61064672-61064694 CAGTTATGGCAGAAGGAGAAGGG + Intergenic
1110047457 13:70848044-70848066 CAGGTTTGGCAGTGGGAAATGGG + Intergenic
1110668506 13:78147009-78147031 CTGTTTTGGGAGATAGGAAAAGG + Intergenic
1111617340 13:90676964-90676986 CTATTTTGAGAGATGGAAAATGG + Intergenic
1112966694 13:105205356-105205378 GTGTTTAGGCAGAGGGCATATGG + Intergenic
1113547625 13:111166372-111166394 GTGTTTGGGCAGAGGGGAGAAGG + Intronic
1114706860 14:24736620-24736642 CTTTTTCAGCAGAGTGAAAATGG - Intergenic
1115374375 14:32657153-32657175 CTGATTTGACATAGGGAAAAAGG + Intronic
1115952090 14:38732808-38732830 GTGGTTGAGCAGAGGGAAAAAGG + Intergenic
1116211693 14:41954564-41954586 CTATTGTGGCAGAGGGTGAAGGG + Intergenic
1116865935 14:50031622-50031644 TTCTCGTGGCAGAGGGAAAAGGG + Intergenic
1117827227 14:59716426-59716448 ATGTTTTGGTAGAGGCCAAATGG + Intronic
1118505155 14:66403103-66403125 CTGTTTCCTCAGAGGTAAAATGG + Intergenic
1119062781 14:71493063-71493085 ATGTTTTGGGGGAGGGATAAAGG - Intronic
1119764498 14:77180008-77180030 TTTTTTTGGCATATGGAAAATGG - Intronic
1121250306 14:92494449-92494471 TTGGTTTGGAATAGGGAAAAAGG + Exonic
1122010193 14:98740260-98740282 CTGTTTTGCCACTGGGGAAATGG + Intergenic
1122507778 14:102242699-102242721 CGGTTTTTGGACAGGGAAAATGG - Intronic
1122573927 14:102728809-102728831 TTTATTTGACAGAGGGAAAATGG + Exonic
1124094602 15:26637415-26637437 ATGTTCTAGCAGGGGGAAAAAGG - Intronic
1125074059 15:35592046-35592068 CTTTATTGGCAGTGTGAAAATGG - Intergenic
1126933527 15:53681143-53681165 CTGATTTGGCTGAGAGATAAAGG - Intronic
1127732768 15:61815703-61815725 CCGGTTTCGCAGAGGGGAAAAGG + Intergenic
1128907527 15:71481068-71481090 TTGTTTTGGGGTAGGGAAAAAGG + Intronic
1129147243 15:73659779-73659801 CTGTGTGTGCAGAAGGAAAAAGG + Intergenic
1129356289 15:74994371-74994393 CTAGTGTGGCAGAGGGGAAAAGG - Intronic
1130615941 15:85407845-85407867 GTGGCTTGGCAGAGGGAGAAGGG + Intronic
1130726578 15:86445372-86445394 CTGCTTTGGCTGAAGCAAAAGGG - Intronic
1131338013 15:91568962-91568984 ATGTTAGGGGAGAGGGAAAAGGG + Intergenic
1131447691 15:92513360-92513382 CTGATTTGGGATAAGGAAAAAGG - Intergenic
1131798371 15:96043973-96043995 CTTTTTGGGTAGAGGGTAAAAGG + Intergenic
1133183744 16:4079955-4079977 CTGTTTTGGCAGATGGCAAAGGG - Intronic
1133753800 16:8746123-8746145 GTATTTTGGAAAAGGGAAAAAGG + Intronic
1133950398 16:10386339-10386361 CCGTTTTCGCAGAGGGATACTGG + Intronic
1134368496 16:13601838-13601860 CTTTATTGGCAGTGTGAAAATGG - Intergenic
1135091723 16:19522996-19523018 CTGTTTTTGCATATGTAAAATGG - Intergenic
1135751311 16:25060685-25060707 TTGTTTTGGTAGAGGGAGAAAGG + Intergenic
1136002662 16:27306761-27306783 CTGATTTGCCAGAGGTAAGAGGG + Intergenic
1136024062 16:27458738-27458760 CTGTTCTGGCAGCTGCAAAAGGG + Intergenic
1137031357 16:35527097-35527119 CTGTTCTGGGAAAGGGAGAAAGG - Intergenic
1137372111 16:47917067-47917089 CTGTTTTCCCAGTGAGAAAATGG + Intergenic
1137387483 16:48055145-48055167 CTGTTTACGAAGAGGGAAAACGG - Intergenic
1138055280 16:53826397-53826419 TTATTTTGGCATGGGGAAAATGG + Exonic
1139656963 16:68394240-68394262 CTGATTTGGAAAATGGAAAATGG - Intronic
1139998950 16:71007657-71007679 CTGGTGAGGCAGAGGAAAAAAGG + Intronic
1140047666 16:71453351-71453373 CTGGTTTGGGAGAGGTAAATAGG + Intronic
1140824029 16:78689411-78689433 ATTCTTTGCCAGAGGGAAAAGGG - Intronic
1141049015 16:80743960-80743982 CTGCTTCTGCAAAGGGAAAAGGG + Intronic
1142435741 16:90055876-90055898 CAGTTATGGCAGAAGGCAAAGGG - Intergenic
1143396120 17:6598775-6598797 CTGGTCTAGCAGAGAGAAAAAGG - Intronic
1143999289 17:11037731-11037753 CAGTTGTGGCAGAAGGCAAAGGG + Intergenic
1146043994 17:29486884-29486906 CTGTTTAAGCAGAGAGAAGATGG + Intronic
1146928876 17:36763995-36764017 TTGGTTTGGGAGAGGGAGAAGGG + Intergenic
1147039109 17:37703705-37703727 TGATTTTGGCAGAAGGAAAATGG - Intronic
1148249580 17:46064502-46064524 CAGTTTTGGTAGAGGGAGAAAGG - Intronic
1149277450 17:55058481-55058503 CTTTTTTGACAGATGTAAAAGGG + Intronic
1150204403 17:63391238-63391260 CAGGTTTGGCAGAGGTGAAAGGG - Intronic
1150891869 17:69161240-69161262 CGGTTTGGGCAAAGGGGAAAAGG + Intronic
1151047023 17:70932811-70932833 GTGTTTTGGCAGAGGAAATACGG + Intergenic
1153881572 18:9425902-9425924 CAGTTTTGGGACAGGTAAAATGG + Intergenic
1154959459 18:21293623-21293645 CTGTTTTGGCTGAATAAAAAGGG - Intronic
1156733357 18:40223149-40223171 CAGGTTTGGCACAGGGAACAGGG - Intergenic
1156773570 18:40759992-40760014 ATGTTTTCTCAGAGGTAAAATGG - Intergenic
1156812530 18:41270024-41270046 CTGATTTGGCAGATGTGAAAAGG - Intergenic
1157745070 18:50128195-50128217 TTGGTTTGGCAGAGAGTAAAAGG + Intronic
1158010107 18:52718984-52719006 CTGAGTTTTCAGAGGGAAAATGG - Intronic
1159617274 18:70595952-70595974 CTATTTTGGCAAGGGGCAAAGGG - Intergenic
1159868009 18:73728815-73728837 CAGCTTTGGCAGAGGGGAGAGGG + Intergenic
1159919664 18:74216102-74216124 ATGTTCTGGCAGAGGGAAGGTGG - Intergenic
1159935538 18:74363945-74363967 CTGTCTTGGCAGTGTGAAACTGG + Intergenic
1160006785 18:75074120-75074142 CAGTTATGGCAGAAGGCAAAGGG - Intergenic
1160741311 19:687325-687347 CTGTGTTGGCAGAAGGAACGGGG - Intronic
1161836341 19:6649720-6649742 CTGTTATGGCAGACAGAATAAGG + Intergenic
1162327107 19:10005986-10006008 CTGGGTGGGCAGAGGGAACAAGG + Intronic
1164157934 19:22607751-22607773 CTGATGGGGCAGTGGGAAAAAGG - Intergenic
1164453687 19:28388880-28388902 CAGTCATGGCAGAGGGAAAGGGG - Intergenic
1165190622 19:34059945-34059967 CAGTTTTGGCAAAGGGATAATGG + Intergenic
1166242106 19:41501560-41501582 CTGTATTGGCAGAGAGCCAAAGG + Intergenic
1167863121 19:52301103-52301125 CTGTTTTTGCAAAGTGACAAAGG + Intronic
925475589 2:4210842-4210864 CGGTCATGGCAGAAGGAAAAGGG + Intergenic
925494955 2:4436379-4436401 TTCTTTTAGCAGTGGGAAAATGG - Intergenic
925588486 2:5487043-5487065 CTTTTTAAGCAGAGGGAAAGAGG - Intergenic
926779666 2:16457976-16457998 GTGTTTAGGCAGTAGGAAAATGG - Intergenic
927605790 2:24485047-24485069 CTTTATTAGCAGAGTGAAAACGG + Intergenic
927753847 2:25693066-25693088 TTGCTTTGGCTGAGGGAGAATGG + Intergenic
927858380 2:26541776-26541798 CTTTCTTGCCACAGGGAAAATGG + Intronic
927968960 2:27292003-27292025 CTGTCTTGGGAGAGAGAAATCGG - Intronic
928246428 2:29632660-29632682 CTTTATTGGCAGCGTGAAAATGG - Intronic
928600433 2:32899017-32899039 ATGTGTTGGTAGAGGGACAAAGG - Intergenic
928673661 2:33628524-33628546 TTGTTGTAGCAGAGGGAGAATGG - Intergenic
928883290 2:36121753-36121775 CTGTCTTTGCAGATGGAAAAGGG - Intergenic
930268393 2:49227107-49227129 CAAATTTGGCAGAGGTAAAAAGG + Intergenic
930723477 2:54659913-54659935 CTGTTAGGGAAGAGGGGAAAAGG - Intronic
930874608 2:56200646-56200668 GTGTTTTTGAAAAGGGAAAATGG + Intronic
931006452 2:57855455-57855477 CAATCTTGGCAGAAGGAAAAGGG + Intergenic
931236893 2:60419500-60419522 CTGATTTGGGATAAGGAAAAAGG - Intergenic
932067201 2:68577361-68577383 TTCTTGTGGCAGAGGGGAAATGG + Intronic
933468140 2:82682708-82682730 CTGTTTTCTCAGAGGGAAATTGG - Intergenic
933936842 2:87213026-87213048 TTGTGTTGGCAGAGGGGAAAAGG + Intergenic
934117963 2:88813711-88813733 CAGTATTGGCAGCGTGAAAATGG + Intergenic
934151872 2:89154830-89154852 TAGTTTTGGAAGAGAGAAAAAGG + Intergenic
934166579 2:89299496-89299518 TTGCTTTTGTAGAGGGAAAAGGG + Intergenic
934200698 2:89882960-89882982 TTGCTTTTGTAGAGGGAAAAGGG - Intergenic
934215387 2:90027076-90027098 TAGTTTTGGAAGAGAGAAAAAGG - Intergenic
935720928 2:105978568-105978590 TTGTTTTGAAAGAGGGAAAATGG - Intergenic
935763854 2:106345196-106345218 TTCTTTTGGGAGAGGCAAAAGGG - Intergenic
936356301 2:111752799-111752821 TTGTGTTGGCAGAGGGGAAAAGG - Intergenic
936734093 2:115419368-115419390 CAGTCATGGCAGAAGGAAAAGGG + Intronic
938234762 2:129696750-129696772 CTTTATTTGCAGAGTGAAAATGG + Intergenic
938235517 2:129703192-129703214 CTGTATTAGCAGTGTGAAAATGG - Intergenic
941888531 2:170553953-170553975 CAGTTCTGGCAGAAGGTAAAGGG - Intronic
942452072 2:176114647-176114669 CTTTTTGGGAAGAGGGACAAAGG + Intronic
942596739 2:177598809-177598831 CTCTTTTCACAGATGGAAAAAGG + Intergenic
942803053 2:179898231-179898253 CTGTTTGGAAAGAGTGAAAATGG - Intergenic
942902173 2:181134258-181134280 CTGTTTTGGCAAAGGTCAAAAGG - Intergenic
943258482 2:185628468-185628490 CATTTATGGCAGAAGGAAAAGGG - Intergenic
943543404 2:189244812-189244834 CTTTATTGGCAGAGTGAAAATGG - Intergenic
943943855 2:194033283-194033305 TTTTTTTGGCAGATGTAAAAGGG - Intergenic
944251180 2:197581202-197581224 CGGTTTTGGGACAGGTAAAATGG - Intronic
944380064 2:199098192-199098214 CTGCTTTAGCAAAGGGAATATGG + Intergenic
945127076 2:206524494-206524516 CTTTATTAGCAGAGTGAAAATGG - Intronic
945188388 2:207163072-207163094 CGGTTTTGGGAGGGGGAAGAAGG + Intronic
946017737 2:216617513-216617535 CAGATGTGGCAGAGAGAAAAAGG + Intergenic
946081899 2:217127781-217127803 CTGTGTTTGCTCAGGGAAAATGG + Intergenic
946781094 2:223193701-223193723 CTGATTTGGGATAGAGAAAAAGG + Intronic
947531231 2:230909816-230909838 CTGTCTGGGCAGTGGAAAAAAGG + Exonic
947964132 2:234264962-234264984 CAGTTATGGCAGAAGGCAAAAGG + Intergenic
948078393 2:235185130-235185152 CAGTTTTGCCAGAGGGGAGAAGG - Intergenic
948083909 2:235230240-235230262 CTTTTGTGCCACAGGGAAAAGGG - Intergenic
948329537 2:237154281-237154303 CTGTTGTGGCAGCTAGAAAAAGG + Intergenic
948489873 2:238305675-238305697 CTGTTTTGGTACAGGGTAAAAGG + Intergenic
1169210876 20:3765726-3765748 CTGCTTTGGGAGTGGGAGAAGGG - Intronic
1169846367 20:9996572-9996594 CTGTCTTGGTAGAGAGAACAGGG + Intronic
1170104070 20:12734833-12734855 CTGTCTTGCTACAGGGAAAAAGG - Intergenic
1170394574 20:15912081-15912103 CTGTTTTGACAGTGGGTCAAAGG + Intronic
1170784606 20:19456573-19456595 CTTTATTGGCAGCGTGAAAATGG + Intronic
1170864896 20:20145037-20145059 CCCTTTAGGCAGAAGGAAAATGG + Intronic
1172263492 20:33590273-33590295 CTGTTTGTGCACAGGAAAAAAGG - Intronic
1172400877 20:34650275-34650297 CTTTTTTGGGAGGGGGGAAAGGG + Intronic
1172522788 20:35579110-35579132 CTGTCCTGGGAGGGGGAAAATGG + Intergenic
1172656999 20:36543453-36543475 GGGTTTGGGCAGAGGGAAGAGGG + Intronic
1174392913 20:50228904-50228926 CTGGTTGGATAGAGGGAAAAAGG - Intergenic
1175644883 20:60662722-60662744 CTGTTTTGGCAGATGCAAATTGG - Intergenic
1177170063 21:17645052-17645074 CTGTCATGGCAGAAGGCAAAGGG - Intergenic
1177179915 21:17734077-17734099 CTGTCATGGCAGAAGGCAAAGGG + Intergenic
1177194502 21:17888741-17888763 ATGCTTTGGCTGAGAGAAAATGG - Intergenic
1177551935 21:22634448-22634470 CTGTGTTTTCACAGGGAAAAGGG + Intergenic
1178996692 21:37408107-37408129 CTCTTCTGGGAAAGGGAAAAGGG - Intronic
1179443183 21:41410439-41410461 TTTTTTTTTCAGAGGGAAAATGG + Intergenic
1179821742 21:43941011-43941033 CTGTTTCTGCAGAGGGTCAAAGG + Intronic
1181665944 22:24397168-24397190 CTGTTTTGGCAGAGGGAAAATGG - Intronic
1181792664 22:25280192-25280214 CTCTTTTGGCAGAAAGAACAAGG - Intergenic
1181813198 22:25417777-25417799 CTGTTTTGGCAGAAAGACCAAGG - Intergenic
1182330002 22:29544994-29545016 CTTTATTGGCAGCGTGAAAATGG - Intronic
1182551999 22:31105627-31105649 CTGTTCTGGGGGAGGGGAAATGG - Intronic
1183635516 22:39060098-39060120 CAGTTTTTGCACAGGTAAAAGGG + Intronic
1184915900 22:47568826-47568848 CAATTGTGGCAGAAGGAAAAGGG + Intergenic
949612868 3:5720836-5720858 CTGTGCTTGCAGAGGTAAAATGG - Intergenic
949671101 3:6399531-6399553 CTGATTTGGGATAAGGAAAAAGG - Intergenic
950352441 3:12369594-12369616 GTGTTTTGGAAAAGGGAATATGG - Intronic
950832099 3:15885184-15885206 CTTTATTGGCAGTGTGAAAAAGG - Intergenic
951054254 3:18128981-18129003 CATTTTTGGCATAGGGAAAGTGG + Intronic
951074295 3:18370359-18370381 CTGATTTAACAGAGGGAAAGGGG - Intronic
952522735 3:34178383-34178405 CAGCTTTGGCAGAGTGAAGAAGG + Intergenic
952701671 3:36335375-36335397 TTGTTCTGTCAGAGGGGAAAAGG - Intergenic
952939034 3:38426724-38426746 CTGTTTTTGCAAAGTGATAAAGG - Intergenic
953302102 3:41787515-41787537 CTGAATTGGCAGGGGGAAGAAGG - Intronic
953909031 3:46882648-46882670 ATGTTTTCGTAGAGAGAAAAGGG + Intronic
955402182 3:58600170-58600192 CTTTTTTGGAAAGGGGAAAAGGG + Intronic
955694304 3:61620388-61620410 TTGAATTTGCAGAGGGAAAATGG + Intronic
956220899 3:66902057-66902079 CTTTATTAGCAGGGGGAAAATGG + Intergenic
957179731 3:76861060-76861082 CTGATGTTGCAGAGGGAAGAGGG - Intronic
957214847 3:77307005-77307027 CTATTTTGGCATTGGGAAAGAGG - Intronic
958813320 3:98888483-98888505 CAGTTTTGCCAGGGGTAAAATGG + Intronic
959383881 3:105677046-105677068 CTTTTATGGCAGTGTGAAAACGG + Intronic
959598088 3:108149368-108149390 CAGTTATGGCAGAAGGCAAAAGG - Intergenic
960229093 3:115203694-115203716 CTGTTCTGCCAGAAAGAAAATGG + Intergenic
960927126 3:122805479-122805501 CTCTTTTTGCAGAGGGTACATGG - Intronic
962555934 3:136551437-136551459 TTTTTTTGGCAGGGGGAAGAGGG + Intronic
963520396 3:146355406-146355428 CTGTTTTGGGATAAAGAAAAAGG - Intergenic
963549084 3:146698284-146698306 CAGTTATGGCAGAAGGCAAAGGG + Intergenic
964175889 3:153825899-153825921 CGGTTTTGGGACAGGTAAAATGG + Intergenic
964857131 3:161158684-161158706 TTGTTTTGGCAAAGGGAATGAGG + Intronic
965129130 3:164671841-164671863 CTGTTCTAGCAGAAGTAAAACGG - Intergenic
965224188 3:165966693-165966715 CTGTTATGTCTTAGGGAAAAGGG - Intergenic
965582022 3:170278789-170278811 CAGTCTTGGCAGAAGGCAAAGGG + Intronic
967892937 3:194375817-194375839 CTGCTTTGTCAGCAGGAAAAAGG + Intergenic
968346882 3:198015957-198015979 CAGTTTGGGAAGAGGGAAGATGG + Intronic
969452208 4:7280964-7280986 CTCTTTGGGCAGTGGGAGAAAGG - Intronic
970982514 4:22117253-22117275 CTGTAATAGCAGAGGGGAAAAGG + Intergenic
971842700 4:31874662-31874684 CTGATTTTGAAGATGGAAAAAGG - Intergenic
972205887 4:36772253-36772275 GTGTTTTGGAAGATGGAGAAAGG - Intergenic
972702714 4:41509486-41509508 GTGATTTGGCAGAAGGACAAGGG - Intronic
973295434 4:48514714-48514736 CTATTTTGGCAGATGCCAAATGG - Intronic
974540347 4:63225730-63225752 CTGGTGAGGCAGTGGGAAAAGGG + Intergenic
975933938 4:79557813-79557835 CTGATTTGGGATAAGGAAAAAGG + Intergenic
976884621 4:89968630-89968652 CTGATTTGGGATAAGGAAAAAGG + Intergenic
977656053 4:99522023-99522045 TTGTCCTGGCAGAGGTAAAAAGG - Intronic
977932601 4:102764810-102764832 AGGTGTTGGGAGAGGGAAAATGG - Intergenic
977971496 4:103218561-103218583 CTGCTTTGGCAGTGGCAGAATGG - Intergenic
978001170 4:103557600-103557622 CTGATTTGGCATAAAGAAAAAGG + Intergenic
978312844 4:107404702-107404724 CTGTCTAGGAAGAGGAAAAATGG - Intergenic
978740862 4:112136378-112136400 CTCATTTGGCAGAAGGAAGAAGG + Intergenic
978867117 4:113526552-113526574 CTTGTCTGGAAGAGGGAAAAAGG - Intronic
979177032 4:117678411-117678433 CTTTATTAGCAGTGGGAAAATGG + Intergenic
980062534 4:128147315-128147337 CTGTCTTAGCAGTGAGAAAAAGG - Intronic
980898391 4:138881056-138881078 CAGTTATGGCAGAAGGCAAAGGG - Intergenic
981714168 4:147736602-147736624 CTGGATTGTCAGAGGGGAAAAGG - Intronic
982314572 4:154019018-154019040 CTGTTTTGGCAAAGGTGAACAGG + Intergenic
983809872 4:172048462-172048484 CTGTGGTGACTGAGGGAAAATGG - Intronic
984108205 4:175576645-175576667 CTGCTTTGTCACAGGGAAAATGG + Intergenic
984592996 4:181637170-181637192 CTAATTTTGCAGAGGAAAAAAGG - Intergenic
984694478 4:182765905-182765927 CTGTTTTAGCAGAGGAAATTTGG - Intronic
985995578 5:3595465-3595487 CTGTTTGGGCAGCGGGGAAGGGG - Intergenic
986481613 5:8194595-8194617 CAGTTATGGCAGAAGGCAAAGGG + Intergenic
986605328 5:9517294-9517316 ATGTCTTTGCAGAAGGAAAAGGG + Intronic
988014247 5:25531585-25531607 CTTTATTGGCAGTGTGAAAACGG + Intergenic
989324671 5:40178179-40178201 CTGTTTTGTCTCAGGGAATAGGG + Intergenic
989732295 5:44663553-44663575 CAGTATGGGCAGAGAGAAAAAGG + Intergenic
990012220 5:51013179-51013201 CAGGTTTGACAGAGAGAAAAAGG + Intergenic
990494490 5:56334196-56334218 CAGTTATGGCAGAAGGCAAAGGG + Intergenic
990618292 5:57530709-57530731 TGGTTTTGGCTGAGGGAAAGAGG + Intergenic
992103535 5:73430843-73430865 ATGCTTTGGTAGAGGGTAAAGGG + Intergenic
992111774 5:73501160-73501182 ATGATTTGGCATAGGGAAAGGGG + Intronic
992516219 5:77495450-77495472 CTGACTTTGCAGAGAGAAAAGGG + Intronic
992942776 5:81779253-81779275 CTGTTTTGGCAGTGCAAAACAGG - Intergenic
994739464 5:103599968-103599990 CAGGTTTGGTAGAGGGATAAAGG - Intergenic
995176056 5:109178584-109178606 TTTTTTTGGCAGAGGTACAATGG - Intronic
995788037 5:115852232-115852254 CTGTTTTGGTAAAAGGCAAAAGG + Intronic
996449934 5:123609617-123609639 CTCTTTTGGGAGAGAGCAAATGG + Intronic
996478043 5:123943057-123943079 CTGTTATGGTACAGGGAAAAGGG - Intergenic
996763666 5:127013139-127013161 CTTCTTTGGCAGAGGAAAAGTGG - Intronic
997066235 5:130562759-130562781 CTATTTTGGGAGATGAAAAAGGG + Intergenic
997191221 5:131937651-131937673 CTGATTTTGCAGAGTCAAAATGG - Intronic
998068672 5:139179508-139179530 CTGCTTCTGTAGAGGGAAAATGG - Intronic
998230966 5:140361174-140361196 GTGTCTGGGCAGAGGGAGAAGGG + Intronic
999068207 5:148714999-148715021 CTGTCATGGCAGAAGGCAAAGGG - Intergenic
1000933939 5:167285399-167285421 ATATTTTAGTAGAGGGAAAAGGG - Intronic
1000935696 5:167301752-167301774 CTGATTTGGGATAAGGAAAAAGG + Intronic
1001182284 5:169531582-169531604 CTGTATTGGCAAAGAGCAAAGGG + Intergenic
1001203364 5:169739301-169739323 CTGTAATTGTAGAGGGAAAATGG + Intronic
1001331504 5:170765871-170765893 CTGATTTGGGATAAGGAAAAAGG + Intronic
1002679771 5:180952066-180952088 CTGTGTGGGCAGAGGGTATATGG - Intergenic
1003503493 6:6721922-6721944 AAGTTTTGGCAGAGTGGAAAAGG - Intergenic
1003959933 6:11199383-11199405 CTGTTTTCTCATAGGTAAAATGG + Intronic
1004215579 6:13701104-13701126 CTGTCCTGGAAGAGGAAAAAGGG - Intronic
1004800565 6:19142404-19142426 CGGTTTTGGCAGAGTGCAGAGGG - Intergenic
1005136795 6:22578157-22578179 CCATTTTAGCAGATGGAAAAAGG + Intergenic
1005869614 6:29965043-29965065 CTGTTTTTGCAGACAGACAAGGG + Intergenic
1006150433 6:31984050-31984072 CTGTCGTGGCAGAGAGAAGAGGG - Intronic
1006156734 6:32016788-32016810 CTGTCGTGGCAGAGAGAAGAGGG - Intronic
1007333517 6:41134174-41134196 CTGTTTAGGAAGAGAGATAAAGG + Intergenic
1007819484 6:44550518-44550540 TTGTTTTGGGAGAGGGAAGACGG - Intergenic
1008189134 6:48432860-48432882 CTGTTTAGAAAGAGGAAAAATGG - Intergenic
1009370336 6:62893089-62893111 CTATTATGGCAGAAGGCAAAGGG + Intergenic
1009462847 6:63934743-63934765 CTGTTGTGGCAGAGGGGGAGGGG + Intronic
1009463338 6:63940830-63940852 CTGTTGTGGCAGAGGGGGAGGGG - Intronic
1009733111 6:67635354-67635376 CAATTATGGCAGAAGGAAAAGGG - Intergenic
1010301430 6:74264723-74264745 CGATTGAGGCAGAGGGAAAAAGG + Intergenic
1010605005 6:77877666-77877688 TTGTTTTGGAGGGGGGAAAATGG + Intronic
1010729724 6:79378042-79378064 GTGTTTTGGGGGAGGGGAAAGGG + Intergenic
1011833329 6:91401072-91401094 CTGTTGTGGGAGAGGGGAGAGGG - Intergenic
1012756791 6:103241408-103241430 CTTTCTTGGCAGTGTGAAAATGG + Intergenic
1012856736 6:104510985-104511007 ATATTGGGGCAGAGGGAAAAAGG + Intergenic
1012864117 6:104596989-104597011 CTGTTTTCTCAGTCGGAAAATGG - Intergenic
1013563869 6:111335600-111335622 CTTTTTTAACAGATGGAAAATGG - Exonic
1013859302 6:114615477-114615499 CTGTTTTGGCAGAAAGACAAAGG - Intergenic
1014358529 6:120444418-120444440 CTGTTGAGGCAGAGGTGAAATGG + Intergenic
1014808090 6:125854106-125854128 CTATCTAGGCACAGGGAAAAGGG + Intronic
1015118167 6:129671965-129671987 CTGTGTTCTCAGAGGCAAAATGG - Intronic
1015823818 6:137291202-137291224 CTGGTTTGGAAGAGGGGAAATGG + Intergenic
1016471574 6:144380365-144380387 ATCTCTGGGCAGAGGGAAAATGG + Intronic
1016585697 6:145682037-145682059 CTTTATTAGCAGAGTGAAAACGG - Intronic
1016635710 6:146287760-146287782 CTGGTTTTGAAAAGGGAAAAGGG + Intronic
1017122690 6:151039232-151039254 CAGTGTTGGCACAGGGAGAAGGG + Intronic
1017546460 6:155456548-155456570 CTTTTTTGAAAGAGGGGAAAAGG - Intergenic
1017718024 6:157225513-157225535 CGATTTAGGCATAGGGAAAAGGG + Intergenic
1018394158 6:163364512-163364534 CTTTTTTAGCAAAAGGAAAATGG + Intergenic
1020950685 7:14672740-14672762 GTATTTTGACAGAAGGAAAAAGG + Intronic
1021228124 7:18052262-18052284 CTGTTTTGGGAAAGTTAAAATGG + Intergenic
1021268929 7:18560722-18560744 CTGTTTTGATAGAGGGAACGTGG + Intronic
1021972765 7:25981664-25981686 CTGTCTTAGCAAAGGGAAAGAGG - Intergenic
1022739386 7:33107012-33107034 CTGGTTTGGGAGGGGGAAGAGGG + Intronic
1027582667 7:80018596-80018618 CTTTTTTGGCACAGAGTAAAAGG + Intergenic
1027996915 7:85435690-85435712 CTTTATCAGCAGAGGGAAAATGG + Intergenic
1028143603 7:87297983-87298005 CAGTTATGGCAGAAGGCAAAAGG + Intergenic
1028859841 7:95636775-95636797 CTGTCTAGGCAGAGAGACAAAGG - Intergenic
1030184033 7:106741926-106741948 CAGTTTTAGCAGAAGGATAAAGG - Intergenic
1030190365 7:106804531-106804553 CTATTGTGACAGAGGGAGAAAGG + Intergenic
1030942793 7:115676035-115676057 ATGCTTTGGCATAGAGAAAAGGG - Intergenic
1031268908 7:119619816-119619838 TAGTTTTCACAGAGGGAAAAGGG - Intergenic
1031478692 7:122252458-122252480 CTACTTTGGCATATGGAAAATGG + Intergenic
1031650049 7:124277159-124277181 CTTTATCGGCAGAGTGAAAATGG + Intergenic
1032342404 7:131087044-131087066 GTGTTTTGGCAGAGGCAAATAGG + Intergenic
1032504961 7:132427834-132427856 ATGTTTTTGCAAAAGGAAAATGG + Intronic
1033471100 7:141649905-141649927 CTGTATTGGAAAAGGGAAAAAGG - Intronic
1033919197 7:146367687-146367709 CTGTGTTAGCAAAGGCAAAAAGG - Intronic
1035032161 7:155868442-155868464 CTGTTTAGCCAGAAGGAAGAGGG + Intergenic
1036697083 8:10982551-10982573 CTGTTGTGACTAAGGGAAAACGG + Intronic
1036781809 8:11653290-11653312 CTATTGTGGCAGAAGGCAAAGGG + Intergenic
1037312283 8:17569348-17569370 CTGTTTTGGCACTAGCAAAAAGG - Exonic
1037755027 8:21705036-21705058 CTGTCGTGGCAGCGGGAACATGG - Exonic
1037938735 8:22933192-22933214 CTGCTTTGCCTAAGGGAAAAGGG + Intronic
1038027304 8:23603165-23603187 GTGTGTTCGCAGAGGGCAAAAGG - Intergenic
1038175523 8:25179050-25179072 TTTTTTTGGCAGGGGGAACAGGG + Intergenic
1038375607 8:27037318-27037340 AAGTTTTGGTAGAGGGACAAAGG + Intergenic
1038572805 8:28677370-28677392 GTATTTTGGCAGAGAGACAAAGG - Intronic
1039092586 8:33847932-33847954 GTGCTTTAGCAGAGGGTAAATGG + Intergenic
1039373135 8:37007048-37007070 CTTTATTGGCAGTGTGAAAATGG + Intergenic
1039575453 8:38620176-38620198 CTGAATGGGCAGAGGGAAAAAGG - Intergenic
1041873753 8:62664313-62664335 CTGTTATGGCACAGAGAAATGGG - Intronic
1042205548 8:66326702-66326724 CTGATAGGGCAGAGGGATAAAGG - Intergenic
1042466627 8:69135794-69135816 CTGTTTTGGCAGAGAGATCTGGG + Intergenic
1043085430 8:75826220-75826242 CTATTTTGGCAGAAGATAAAGGG - Intergenic
1045085714 8:98681834-98681856 GTGTTTTGGCAGGGAGGAAATGG - Intronic
1045338159 8:101227202-101227224 CAGTTTTGTCATGGGGAAAAGGG - Intergenic
1046522508 8:115343453-115343475 CCTTTTTTGCAGAAGGAAAATGG - Intergenic
1046564273 8:115878663-115878685 CTGTGTTGACACAGGAAAAATGG + Intergenic
1046934870 8:119875866-119875888 CAGTTTTGGGACAGGTAAAATGG + Intronic
1047215751 8:122874673-122874695 CTGTTTTCTCAGTGGTAAAATGG - Intronic
1048025066 8:130578503-130578525 CTGGCTTGGCAGAGGGACCAGGG + Intergenic
1048475751 8:134740988-134741010 TGGTTATGGTAGAGGGAAAAGGG - Intergenic
1048722725 8:137344937-137344959 CTTTTTTAGCAGTGTGAAAATGG + Intergenic
1049301574 8:141873397-141873419 CTTCTCTGGCAGAGAGAAAATGG + Intergenic
1049444472 8:142623707-142623729 CTGGCCTGGGAGAGGGAAAAAGG - Intergenic
1049835902 8:144735415-144735437 TTGTATTGCCAGAGTGAAAAGGG + Intronic
1050215975 9:3324086-3324108 CTGAGTTGGCCTAGGGAAAAAGG + Intronic
1050276376 9:4005193-4005215 CTGTTTTGGAAGGTGGAATAGGG + Intronic
1050858827 9:10397447-10397469 TTGTTTTTGGAGAGGGAACAAGG + Intronic
1051046941 9:12886962-12886984 CTGTTTTGACATATGGAGAAAGG - Intergenic
1051102519 9:13537294-13537316 CTGCTTTGGGAGAGGGTAAGTGG + Intergenic
1051254137 9:15194891-15194913 TTGTTTTGTCTGAGGGAATAGGG - Intronic
1051656317 9:19385344-19385366 CAGTGTTGGCACAGTGAAAAAGG + Intergenic
1052114321 9:24630908-24630930 CTGTTTTGACTAAGGGAATAAGG - Intergenic
1052223250 9:26053167-26053189 CTGACTAGGCAGAGGGAAAGGGG + Intergenic
1052641718 9:31176167-31176189 TTGTTTTGACTTAGGGAAAATGG - Intergenic
1052701490 9:31942490-31942512 CTTTATTGGCAGTGTGAAAATGG + Intergenic
1052998451 9:34564330-34564352 CTATGTTGTCAGAGGGAATAGGG + Intronic
1053871195 9:42493380-42493402 CTGTTTTGGCTGAGATAAAGTGG - Intergenic
1054153519 9:61624280-61624302 CTGATTTAGCAGAGGGTGAAGGG - Intergenic
1054261034 9:62864997-62865019 CTGTCTAGGCAGCGGGCAAAGGG + Intergenic
1054798267 9:69323032-69323054 CTGTTTCTGCATGGGGAAAAAGG + Intergenic
1057447792 9:95130058-95130080 CTGTTTTGGAAGAGAGGCAAGGG + Intronic
1060253776 9:122007275-122007297 TTGTTGTGGCAGAAGTAAAAGGG + Intronic
1060625659 9:125108899-125108921 CGGTTTTGTCAAATGGAAAAGGG + Intronic
1060654142 9:125357180-125357202 CTGGTCTCGCAGAGGGAATAAGG - Intronic
1203367521 Un_KI270442v1:271721-271743 CTTTATTGGCAGTGTGAAAATGG - Intergenic
1185934849 X:4244788-4244810 CTGTGTTTGAAGACGGAAAAGGG + Intergenic
1186892584 X:13973739-13973761 GTGTTTTGGAAGAGGACAAATGG - Intergenic
1187791966 X:22960371-22960393 CCATTTTGCCAGAGTGAAAAGGG + Intergenic
1190320012 X:49174465-49174487 CTGAGAGGGCAGAGGGAAAAAGG + Intronic
1190881125 X:54493642-54493664 CTGTTTTGGCAGCTGCAAAAAGG + Intronic
1191055119 X:56232914-56232936 CTGAATTGGTAGAGGTAAAAGGG + Intronic
1191226442 X:58049331-58049353 CTTTATTGGCAGTGTGAAAATGG - Intergenic
1191824804 X:65353335-65353357 CTGTTTTGCCACAGAGAATAGGG - Intergenic
1191895362 X:65987031-65987053 CTGTTATAGAAGAGGGAGAAGGG + Intergenic
1192239514 X:69318288-69318310 CTCTTTTGACAGATGGGAAAAGG + Intergenic
1192607134 X:72529968-72529990 CAGTCTTGGCAGAGGGACAAAGG - Intronic
1192856646 X:75019093-75019115 CTTTATTGGCAGCGTGAAAATGG - Intergenic
1193047244 X:77066261-77066283 CTGTTTTGTCAAAAAGAAAAGGG + Intergenic
1193569890 X:83128676-83128698 CTGTCGTGGCAGTGGCAAAAGGG - Intergenic
1193765097 X:85518380-85518402 CTTTTTTGGCATTGGGATAAAGG + Intergenic
1193995045 X:88355268-88355290 TTCTTATGGCAGATGGAAAAGGG + Intergenic
1194041680 X:88949229-88949251 CAATTATGGCAGAGGGAAAGAGG + Intergenic
1195008026 X:100706063-100706085 CAGTTGTGGCAGAGGGATGAAGG - Intronic
1195432766 X:104807731-104807753 TTGTTATGTGAGAGGGAAAACGG - Intronic
1195946177 X:110214644-110214666 GTGTTTTGGGGGAAGGAAAAAGG - Intronic
1196483781 X:116180920-116180942 CTTTATTAGCAGAGTGAAAATGG + Intergenic
1196815555 X:119662920-119662942 CTGTTTTGCCAGACAGACAAGGG - Intronic
1196942155 X:120787727-120787749 CTTTTCTGGAGGAGGGAAAATGG + Intergenic
1197053957 X:122094502-122094524 CTGTTTTGGCAGTTGAAACAGGG + Intergenic
1198269193 X:135038205-135038227 TTGTTTTGGCAGAGGGGACAAGG - Intergenic
1198478621 X:137019667-137019689 CTGTTTTCTCAGCTGGAAAATGG - Intergenic
1199684618 X:150255141-150255163 CTGTCTCTGGAGAGGGAAAAGGG - Intergenic
1200441851 Y:3220522-3220544 CTTTATTGGCAGTGCGAAAATGG - Intergenic
1202062230 Y:20899660-20899682 CAGTTTTTGAATAGGGAAAATGG - Intergenic
1202254937 Y:22911350-22911372 CTTCTTTGGCAGAGGGACCAAGG + Intergenic
1202407928 Y:24545099-24545121 CTTCTTTGGCAGAGGGACCAAGG + Intergenic
1202462854 Y:25124982-25125004 CTTCTTTGGCAGAGGGACCAAGG - Intergenic