ID: 1181669262

View in Genome Browser
Species Human (GRCh38)
Location 22:24418571-24418593
Sequence TGCACTGCAGGCGGGACGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 129}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181669262_1181669272 11 Left 1181669262 22:24418571-24418593 CCATCCGTCCCGCCTGCAGTGCA 0: 1
1: 0
2: 0
3: 11
4: 129
Right 1181669272 22:24418605-24418627 TGCTGATTAGGGTGGCCCTGAGG No data
1181669262_1181669269 0 Left 1181669262 22:24418571-24418593 CCATCCGTCCCGCCTGCAGTGCA 0: 1
1: 0
2: 0
3: 11
4: 129
Right 1181669269 22:24418594-24418616 GCTGCCTTGGATGCTGATTAGGG 0: 1
1: 0
2: 0
3: 14
4: 225
1181669262_1181669268 -1 Left 1181669262 22:24418571-24418593 CCATCCGTCCCGCCTGCAGTGCA 0: 1
1: 0
2: 0
3: 11
4: 129
Right 1181669268 22:24418593-24418615 AGCTGCCTTGGATGCTGATTAGG 0: 1
1: 0
2: 0
3: 24
4: 423
1181669262_1181669274 13 Left 1181669262 22:24418571-24418593 CCATCCGTCCCGCCTGCAGTGCA 0: 1
1: 0
2: 0
3: 11
4: 129
Right 1181669274 22:24418607-24418629 CTGATTAGGGTGGCCCTGAGGGG No data
1181669262_1181669270 3 Left 1181669262 22:24418571-24418593 CCATCCGTCCCGCCTGCAGTGCA 0: 1
1: 0
2: 0
3: 11
4: 129
Right 1181669270 22:24418597-24418619 GCCTTGGATGCTGATTAGGGTGG No data
1181669262_1181669273 12 Left 1181669262 22:24418571-24418593 CCATCCGTCCCGCCTGCAGTGCA 0: 1
1: 0
2: 0
3: 11
4: 129
Right 1181669273 22:24418606-24418628 GCTGATTAGGGTGGCCCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181669262 Original CRISPR TGCACTGCAGGCGGGACGGA TGG (reversed) Intronic
903772161 1:25770785-25770807 TGGACTGAAGGCGGGGCGGGGGG - Intronic
905124445 1:35707458-35707480 TGTGCTGCAGGTGGGGCGGAAGG + Intergenic
905207750 1:36352626-36352648 TGCTCTGCAGGGGGAAGGGAGGG - Intronic
907260101 1:53211633-53211655 TGCACTCCAGCCTGGACGGAGGG - Intronic
907864701 1:58388445-58388467 TGCACTCCAGGCAGGAAGAAGGG - Intronic
915120297 1:153626382-153626404 TGCAAGGCAGGAGGGCCGGAAGG - Exonic
915206240 1:154272541-154272563 TGAAATGGAGGCGGGACCGAAGG - Exonic
915605142 1:156945691-156945713 TGCACTGCAGGGGGCATGAATGG + Intronic
920210057 1:204321435-204321457 TGCACTGCAGGGGGGCAGTAGGG - Intronic
920921713 1:210302904-210302926 TGCACTACAGGCTGGGGGGAGGG - Intergenic
924669677 1:246110812-246110834 TGCACTGCAGCCAGGCAGGATGG - Intronic
1064006557 10:11703681-11703703 TGCACTCCAGGCTGGGCGGCAGG - Intergenic
1066182836 10:32980415-32980437 TACACTGGAGGTGGGACCGAGGG + Intronic
1067279112 10:44857954-44857976 TGCACTGCAGGGGGACCGCAGGG + Intergenic
1067474978 10:46558858-46558880 TGCACTGCATGGGGGAAGGAAGG + Intergenic
1067684064 10:48456827-48456849 GGCACTGCAGTGGGGAAGGAGGG - Intronic
1067726891 10:48777214-48777236 TGCACTGCAGGCAGGATGGGAGG - Intronic
1072737508 10:97889110-97889132 GGCAGTGGAGGCGGGAGGGAAGG + Intronic
1075699352 10:124459041-124459063 TGCATTTCAGGCAGGAAGGAGGG - Intergenic
1077115378 11:881966-881988 TGCACTGCAGCCTGGACGACAGG + Intronic
1078084081 11:8223429-8223451 TGTGCTGCAGGCAGGAAGGATGG - Intergenic
1093153438 12:15651003-15651025 TGCTCTGCAGGAGGGAATGAAGG + Exonic
1095160212 12:38906167-38906189 GGCACAGTAGGAGGGACGGAGGG - Intronic
1095645701 12:44543404-44543426 TGCACTGTAGGAGGGAAAGATGG - Intronic
1096788910 12:54033334-54033356 GGCGCTGCAGGCGGGGCGGTCGG - Exonic
1099860018 12:88214748-88214770 TGAACTGAAGGAGGGAAGGAAGG + Intergenic
1105847811 13:24308307-24308329 TGCACCGCAGGCGGCCCCGACGG - Intronic
1105932761 13:25068063-25068085 GGAAGTGCAGGAGGGACGGATGG + Intergenic
1106398297 13:29403049-29403071 TGAACTTCAGGAGGGAAGGAGGG + Intronic
1113928999 13:113956684-113956706 GGCACAGGAGGCGGGACGGAGGG - Intergenic
1129154482 15:73709354-73709376 TGCACTCCAGGCTGGGTGGATGG + Intronic
1129257648 15:74343171-74343193 TTCCCTGCAGGCGGGTGGGAAGG + Intronic
1130104688 15:80920455-80920477 TGCAAAGCAGGTGGGAGGGAGGG + Intronic
1130882262 15:88065485-88065507 TCCACTCCAGGCAGGAGGGAGGG - Intronic
1131177267 15:90217854-90217876 TGAGCTGCAGGAGGGATGGAGGG + Intronic
1132806714 16:1778382-1778404 TGCACTGCGGGCGGGCCTGGGGG - Intronic
1133170940 16:3982194-3982216 TACAGTGCAGGTGGGAAGGAGGG + Intronic
1134005788 16:10818317-10818339 TGCACTGCAGCCGCAGCGGAGGG - Intronic
1135990124 16:27213650-27213672 TGAAATGCTGGAGGGACGGACGG - Exonic
1139593758 16:67946870-67946892 TGGACTGCAGCTGGCACGGAGGG - Intronic
1141627629 16:85269651-85269673 GGCACTGAAGGCTGGACAGAGGG - Intergenic
1143480671 17:7225986-7226008 TGCACTGCTGGAGGGACTGGAGG + Exonic
1144576619 17:16433747-16433769 TGCACTGCAGGGGGGCCCCAGGG - Intronic
1144769472 17:17751675-17751697 AGCACTGCAGGCAGGACAGGCGG - Intronic
1145392824 17:22469291-22469313 TGCACCGCAGGGAGGAAGGATGG + Intergenic
1147885280 17:43680104-43680126 TGCACTGCATGCAGGCCAGAGGG - Intergenic
1148430144 17:47636067-47636089 TGGAGTGCAGGCAGGACGGCTGG + Intergenic
1148790553 17:50170330-50170352 TGTGCTGCCGGCGGGAGGGAAGG + Exonic
1151418811 17:73984259-73984281 TGCATTGCAGGGGGCATGGAGGG - Intergenic
1152307972 17:79532191-79532213 TGCACTGGAGGGGGGAGGGGAGG + Intergenic
1157826598 18:50818009-50818031 GGCACTGCAGGCAGGAAGGAGGG - Intronic
1158171153 18:54602495-54602517 AGCACTGCTGGTGGGAAGGAAGG + Intergenic
1159188112 18:65005511-65005533 TGCACTGAAGGCAGGAAGAAGGG + Intergenic
1159927567 18:74282521-74282543 TGCACAGCAGGCGGGCAGGCAGG + Intronic
1160225151 18:77006437-77006459 TGCACTGGAGGCTGGAGTGAGGG - Intronic
1160266165 18:77342068-77342090 TCCACTGCAGGCCGCACGGGAGG - Intergenic
1160317497 18:77860736-77860758 CTCTCTGCAGGCTGGACGGAGGG + Intergenic
1160851579 19:1195379-1195401 TGCCCTGCAGGCTGGAGGGCAGG + Intronic
1160852003 19:1197193-1197215 TGCCCTGCAGGCTGGAGGGCAGG + Intronic
1160879154 19:1311654-1311676 GCCACTGCAGGCGCGAGGGAAGG + Intergenic
1161390118 19:4016326-4016348 TGCACAGCAGGCGGGTGGGCAGG - Intronic
1161660071 19:5540452-5540474 TTCACTGCAGACTGGACTGATGG - Intergenic
1162743111 19:12784118-12784140 TGGACTGCTGGCTGGACAGACGG + Intronic
1163182718 19:15615592-15615614 TGCAGGGCAGACGGGATGGAGGG - Intronic
1163218472 19:15897614-15897636 TGCAGGGCAGACGGGATGGACGG + Intronic
1163222845 19:15934411-15934433 TGCAGGGCAGACGGGATGGAGGG + Exonic
1165450100 19:35877535-35877557 GGCACTGCTGGCAGGAAGGATGG - Intronic
1165498365 19:36168150-36168172 TGCACTCCAGCCTGGACGGCAGG - Intergenic
1165914413 19:39248753-39248775 TGCACTGCAGACAGGAGTGAGGG - Intergenic
1167161281 19:47768873-47768895 TGAACAGCAGGAGGGACTGAGGG + Intergenic
925160179 2:1678043-1678065 TGCAATGCTGGGGAGACGGAAGG - Intronic
926016072 2:9452598-9452620 TGCACTGCAGTAGGGAAGGCCGG - Intronic
926164417 2:10510846-10510868 TGGACTGCAGGTGGGAAGGAGGG + Intergenic
931868045 2:66432928-66432950 TGCAGTGCAGGCGGCTGGGAAGG + Intergenic
934835608 2:97587135-97587157 TGCACTGCAGGCTGGGCGACAGG + Intronic
935349909 2:102143742-102143764 TGCACTGCCGGGAGGAAGGAAGG + Intronic
936591915 2:113812465-113812487 TGCACTCCAGCCTGGACAGAGGG + Intergenic
937281904 2:120723164-120723186 TGCCCTGCAGTCAGGACTGAGGG + Intergenic
937320846 2:120959855-120959877 TGCACTGCTGGCGCCAGGGATGG - Intronic
937853106 2:126653376-126653398 TGCAGTGCAGCCGGGATGGACGG - Intergenic
941905306 2:170713671-170713693 CGCACTGCGACCGGGACGGACGG - Exonic
944413616 2:199463633-199463655 TGGACTGCAGGCGACGCGGAAGG - Intronic
946227224 2:218270441-218270463 TGGTCTGTAGGCAGGACGGAAGG + Intronic
947876470 2:233471054-233471076 TGCACTGCAGAGGGGACAGAGGG - Exonic
949077617 2:242071000-242071022 TTCACAGCAGGCGGGAAGGCGGG - Intergenic
1171412570 20:24956969-24956991 TGCACTGCAGGGGTGTCGGGGGG + Intronic
1171813411 20:29763058-29763080 GGAACTGCGGGAGGGACGGAGGG + Intergenic
1172162023 20:32875410-32875432 TCCACTGCAGGGGGCACAGAAGG - Intronic
1173916044 20:46709536-46709558 AGGCCTGGAGGCGGGACGGAGGG - Exonic
1181669262 22:24418571-24418593 TGCACTGCAGGCGGGACGGATGG - Intronic
1183540202 22:38425327-38425349 ATCATTGCAGGCGGGAGGGATGG + Intergenic
1184347287 22:43921702-43921724 TGCAATGCAGGAGGGATGGATGG + Intergenic
950556720 3:13700489-13700511 TGCCCTGCAGGCGGGAAGAGGGG + Intergenic
950743249 3:15066180-15066202 TGCACTCCAGAAGGGAGGGAGGG - Intergenic
952644604 3:35639821-35639843 TGCATTGCTGGTGGGACGGAGGG + Intronic
962030764 3:131597991-131598013 TGCACTGCAAGGGGAAGGGAAGG + Intronic
964351166 3:155805425-155805447 TGCACTCCAGGCGTGACAGAGGG + Intronic
968609088 4:1549043-1549065 TGCACTGCAGGCAGCCCAGAGGG + Intergenic
969688143 4:8688366-8688388 TGTACCCCAGGCGGGACGGCCGG + Intergenic
978292981 4:107168179-107168201 TGCACTCCAGGCTGGGCGAAAGG + Intronic
984758213 4:183342999-183343021 GGCCCTGCAGGAGGGAGGGAGGG - Intergenic
990003799 5:50922802-50922824 TGCACTGCAGGCAGCCCAGAGGG - Intergenic
992515940 5:77492291-77492313 TGCGCTGCAGCCGGGGAGGAAGG - Exonic
999735303 5:154508553-154508575 GGCACTGCAGGCAGGAAGAATGG + Intergenic
1000038337 5:157465989-157466011 TGCAGTGGAGGAGGGAGGGAAGG + Intronic
1002275339 5:178100824-178100846 TGCACTGCAGCCTGGACACAGGG + Intergenic
1002381415 5:178832232-178832254 TGCACTGCCGGCGGCGGGGAGGG - Intergenic
1003143851 6:3493468-3493490 TGCTCTGCAGGCTGCAAGGACGG + Intergenic
1004539501 6:16536351-16536373 TGGACTGCAGGATGGACAGATGG + Intronic
1005327902 6:24720360-24720382 CGCACTGCAGCGGGGATGGAGGG - Exonic
1006694537 6:35920525-35920547 AGCACTGCAGGAGAGAGGGATGG + Exonic
1007212906 6:40211187-40211209 AGCACTGCAGGAGGAAGGGAAGG + Intergenic
1008387758 6:50913341-50913363 TGCAGTGAAGACGTGACGGAGGG + Intergenic
1015328538 6:131951177-131951199 GGCACTGCGGGCGGAGCGGAGGG + Exonic
1019068560 6:169323098-169323120 TGCAGTTCAGGTGGGAGGGAAGG + Intergenic
1019499037 7:1355289-1355311 CGCGGTGCAGGCGGGAGGGAAGG + Intergenic
1019603762 7:1898387-1898409 AGCTCTGCGGGAGGGACGGAAGG + Exonic
1020967241 7:14886719-14886741 TGAACTGCAGGTGGGCCAGATGG - Intronic
1024056907 7:45665773-45665795 CCCACTGCAGGAGGGAGGGAGGG + Intronic
1025919303 7:65895929-65895951 TGCACTCCAGCCTGGACAGAGGG - Intronic
1026901677 7:74040756-74040778 TGCAGGGCAGGCTGGATGGAAGG + Intronic
1027237794 7:76308209-76308231 GGCACTGCAGGCTGGGCGCAGGG + Intergenic
1029544221 7:101201952-101201974 CCCACTGCGGGCGGGACGGGAGG + Intergenic
1032856094 7:135834805-135834827 GGTACTGCAGGCAGGAAGGAGGG + Intergenic
1033653073 7:143356468-143356490 TGTACTGCTGGGGGGAGGGAGGG + Exonic
1034266775 7:149784963-149784985 TGCCCTGCAGGCAGTACTGATGG + Intergenic
1035536156 8:392796-392818 TTCACAGCAGGCGGGAAGGCGGG - Intergenic
1035572861 8:685159-685181 TGCATTCCTGGGGGGACGGAGGG - Intronic
1041240804 8:55847710-55847732 TGCACTCCAGCCTGGACAGAGGG - Intergenic
1047094103 8:121605514-121605536 TGCAATACAGGTGGGACGGGGGG + Intergenic
1049383960 8:142331555-142331577 TGCACTGCAGGACGGCCTGACGG + Intronic
1056780272 9:89543968-89543990 GGCACAGCAGGCAGGACTGAGGG + Intergenic
1057519691 9:95751499-95751521 TGAGCTGCAGGAGGGAGGGAGGG + Intergenic
1057519786 9:95751786-95751808 TGAGCTGCAGGAGGGAGGGAGGG + Intergenic
1058762717 9:108150945-108150967 TGCACTGCACGTGGTACAGAGGG - Intergenic
1061165115 9:128917713-128917735 TGCACTCCAGGCGCCAGGGACGG - Exonic
1062395526 9:136351165-136351187 TGCCCTGCTGGTGGGAAGGATGG - Intronic
1185514284 X:687456-687478 TGCACTGCAGCCTGGGCGGCAGG + Intergenic
1195939695 X:110157920-110157942 TGCACTCCAGCCTGGACGGCAGG - Intronic
1196202411 X:112900461-112900483 TGCACTCCAGCCTGGACGGCAGG - Intergenic
1197291371 X:124662416-124662438 TGCACTGCAGCCTGGACGACAGG + Intronic