ID: 1181670968

View in Genome Browser
Species Human (GRCh38)
Location 22:24425265-24425287
Sequence CGGCCAAAGCAGGGCCAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181670968_1181670986 21 Left 1181670968 22:24425265-24425287 CCTCACTGGCCCTGCTTTGGCCG No data
Right 1181670986 22:24425309-24425331 GCTGGGAAGGCCGGGCCCTGTGG 0: 1
1: 0
2: 13
3: 81
4: 723
1181670968_1181670980 3 Left 1181670968 22:24425265-24425287 CCTCACTGGCCCTGCTTTGGCCG No data
Right 1181670980 22:24425291-24425313 CTGGAGGCCTTGGGTGGGGCTGG 0: 1
1: 1
2: 13
3: 115
4: 742
1181670968_1181670985 13 Left 1181670968 22:24425265-24425287 CCTCACTGGCCCTGCTTTGGCCG No data
Right 1181670985 22:24425301-24425323 TGGGTGGGGCTGGGAAGGCCGGG 0: 1
1: 0
2: 8
3: 145
4: 1130
1181670968_1181670978 -1 Left 1181670968 22:24425265-24425287 CCTCACTGGCCCTGCTTTGGCCG No data
Right 1181670978 22:24425287-24425309 GTTCCTGGAGGCCTTGGGTGGGG 0: 1
1: 0
2: 4
3: 37
4: 401
1181670968_1181670977 -2 Left 1181670968 22:24425265-24425287 CCTCACTGGCCCTGCTTTGGCCG No data
Right 1181670977 22:24425286-24425308 CGTTCCTGGAGGCCTTGGGTGGG 0: 1
1: 0
2: 0
3: 11
4: 189
1181670968_1181670984 12 Left 1181670968 22:24425265-24425287 CCTCACTGGCCCTGCTTTGGCCG No data
Right 1181670984 22:24425300-24425322 TTGGGTGGGGCTGGGAAGGCCGG No data
1181670968_1181670974 -6 Left 1181670968 22:24425265-24425287 CCTCACTGGCCCTGCTTTGGCCG No data
Right 1181670974 22:24425282-24425304 TGGCCGTTCCTGGAGGCCTTGGG 0: 1
1: 0
2: 2
3: 8
4: 140
1181670968_1181670973 -7 Left 1181670968 22:24425265-24425287 CCTCACTGGCCCTGCTTTGGCCG No data
Right 1181670973 22:24425281-24425303 TTGGCCGTTCCTGGAGGCCTTGG 0: 1
1: 0
2: 1
3: 6
4: 150
1181670968_1181670976 -3 Left 1181670968 22:24425265-24425287 CCTCACTGGCCCTGCTTTGGCCG No data
Right 1181670976 22:24425285-24425307 CCGTTCCTGGAGGCCTTGGGTGG 0: 1
1: 1
2: 1
3: 12
4: 175
1181670968_1181670987 22 Left 1181670968 22:24425265-24425287 CCTCACTGGCCCTGCTTTGGCCG No data
Right 1181670987 22:24425310-24425332 CTGGGAAGGCCGGGCCCTGTGGG 0: 1
1: 0
2: 2
3: 26
4: 287
1181670968_1181670982 8 Left 1181670968 22:24425265-24425287 CCTCACTGGCCCTGCTTTGGCCG No data
Right 1181670982 22:24425296-24425318 GGCCTTGGGTGGGGCTGGGAAGG 0: 1
1: 1
2: 8
3: 134
4: 1092
1181670968_1181670981 4 Left 1181670968 22:24425265-24425287 CCTCACTGGCCCTGCTTTGGCCG No data
Right 1181670981 22:24425292-24425314 TGGAGGCCTTGGGTGGGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181670968 Original CRISPR CGGCCAAAGCAGGGCCAGTG AGG (reversed) Intronic
No off target data available for this crispr