ID: 1181675040

View in Genome Browser
Species Human (GRCh38)
Location 22:24445834-24445856
Sequence CTCATGCTGACTTCCTGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181675040_1181675050 21 Left 1181675040 22:24445834-24445856 CCAGGCCAGGAAGTCAGCATGAG No data
Right 1181675050 22:24445878-24445900 GCCAACCCAGGGTCCTCTGAGGG No data
1181675040_1181675048 10 Left 1181675040 22:24445834-24445856 CCAGGCCAGGAAGTCAGCATGAG No data
Right 1181675048 22:24445867-24445889 TGACAGGTGTAGCCAACCCAGGG No data
1181675040_1181675047 9 Left 1181675040 22:24445834-24445856 CCAGGCCAGGAAGTCAGCATGAG No data
Right 1181675047 22:24445866-24445888 GTGACAGGTGTAGCCAACCCAGG No data
1181675040_1181675057 29 Left 1181675040 22:24445834-24445856 CCAGGCCAGGAAGTCAGCATGAG No data
Right 1181675057 22:24445886-24445908 AGGGTCCTCTGAGGGAGGTGGGG No data
1181675040_1181675055 27 Left 1181675040 22:24445834-24445856 CCAGGCCAGGAAGTCAGCATGAG No data
Right 1181675055 22:24445884-24445906 CCAGGGTCCTCTGAGGGAGGTGG No data
1181675040_1181675049 20 Left 1181675040 22:24445834-24445856 CCAGGCCAGGAAGTCAGCATGAG No data
Right 1181675049 22:24445877-24445899 AGCCAACCCAGGGTCCTCTGAGG No data
1181675040_1181675052 24 Left 1181675040 22:24445834-24445856 CCAGGCCAGGAAGTCAGCATGAG No data
Right 1181675052 22:24445881-24445903 AACCCAGGGTCCTCTGAGGGAGG No data
1181675040_1181675056 28 Left 1181675040 22:24445834-24445856 CCAGGCCAGGAAGTCAGCATGAG No data
Right 1181675056 22:24445885-24445907 CAGGGTCCTCTGAGGGAGGTGGG No data
1181675040_1181675046 -6 Left 1181675040 22:24445834-24445856 CCAGGCCAGGAAGTCAGCATGAG No data
Right 1181675046 22:24445851-24445873 CATGAGGCTGGGCAGGTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181675040 Original CRISPR CTCATGCTGACTTCCTGGCC TGG (reversed) Intergenic
No off target data available for this crispr