ID: 1181675056

View in Genome Browser
Species Human (GRCh38)
Location 22:24445885-24445907
Sequence CAGGGTCCTCTGAGGGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181675042_1181675056 23 Left 1181675042 22:24445839-24445861 CCAGGAAGTCAGCATGAGGCTGG No data
Right 1181675056 22:24445885-24445907 CAGGGTCCTCTGAGGGAGGTGGG No data
1181675040_1181675056 28 Left 1181675040 22:24445834-24445856 CCAGGCCAGGAAGTCAGCATGAG No data
Right 1181675056 22:24445885-24445907 CAGGGTCCTCTGAGGGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181675056 Original CRISPR CAGGGTCCTCTGAGGGAGGT GGG Intergenic
No off target data available for this crispr