ID: 1181676790

View in Genome Browser
Species Human (GRCh38)
Location 22:24459804-24459826
Sequence CAAGGGAATCCCCTGGACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181676785_1181676790 10 Left 1181676785 22:24459771-24459793 CCAGAAAACAGGCAATCTAACAC No data
Right 1181676790 22:24459804-24459826 CAAGGGAATCCCCTGGACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181676790 Original CRISPR CAAGGGAATCCCCTGGACAG TGG Intergenic
No off target data available for this crispr