ID: 1181677609

View in Genome Browser
Species Human (GRCh38)
Location 22:24466853-24466875
Sequence TGTTGTGACAAGCAGCAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181677606_1181677609 19 Left 1181677606 22:24466811-24466833 CCTTCTTATTGTGTAAGGAGTTT No data
Right 1181677609 22:24466853-24466875 TGTTGTGACAAGCAGCAGAGAGG No data
1181677608_1181677609 -6 Left 1181677608 22:24466836-24466858 CCTTCTGTTGGCAGTTGTGTTGT No data
Right 1181677609 22:24466853-24466875 TGTTGTGACAAGCAGCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181677609 Original CRISPR TGTTGTGACAAGCAGCAGAG AGG Intergenic
No off target data available for this crispr